|
|
| Line 1: |
Line 1: |
| == Singular Sequencing ==
| | #REDIRECT [[BioMicroCenter:ShortRead]] |
| The Center currently hosts a G4 platform by [https://singulargenomics.com/| Singular Genomics]. Singular’s G4 platform is a short-read mid-throughput sequencing platform delivering adequate sequencing data through its proprietary sequencing-by-synthesis chemistry at a significantly competitive price point.
| |
| {|
| |
| | valign="top" |
| |
| {| class="wikitable" border=1
| |
| !width=150| Service
| |
| !width=300| Singular Sequencing
| |
| |-
| |
| |INPUT || Singular libraries
| |
| |-
| |
| |MIN VOLUME || 12 uL
| |
| |-
| |
| |MIN CONCENTRATION || 4 nM
| |
| |-
| |
| |INCLUDED SERVICES
| |
| |
| |
| * Quality Control:Fragment Analyzer and qPCR
| |
| * Singular Sequencing
| |
| * Demultiplexing
| |
| |-
| |
| |ADDITIONAL SERVICES ||
| |
| * Quality Control
| |
| * Singular library preparation
| |
| |-
| |
| |DATA FORMATS
| |
| |
| |
| *FASTQ (stored 1 year)
| |
| |-
| |
| |QUALITY CONTROL
| |
| |
| |
| * [https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ FASTQC]
| |
| * Basic run metrics (alignment rate, complexity)
| |
| * Basic RNAseq metrics (where applicable)
| |
| * Basic paired end metrics (where applicable)
| |
| * Contamination checks
| |
| |-
| |
| |PRICING || [[BioMicroCenter:Pricing#SINGULAR_G4|LINK]]
| |
| |-
| |
| |SUBMISSION
| |
| |
| |
| * MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs]
| |
| |-
| |
| |}
| |
| | valign="top" |
| |
| | |
| === ANCHORS ===
| |
| Singular requires S1/S2 anchors in place of Illumina P5/P7 anchors. These can be replaced 1:1 in most oligo designs:
| |
| *s1:ACAAAGGCAGCCACGCACTCCTTCCCTGT
| |
| *s2:CTCCAGCGAGATGACCCTCACCAACCACT
| |
| | |
| === INDEXING ===
| |
| Singular indexes are read from the Anchor sequences in all cases and custom primers for indexes are not allowed. <BR>
| |
| Indexes are read from the S1 primer first (index1) followed by S2 (index2) <BR>
| |
| Index reads are the SAME SEQUENCE as ordered in most classical library preps. <BR>
| |
| Indexes are REQUIRED and should be 8 nucleotides in all lane by lane sequencing.
| |
| *Min custom primer submission: 20 µL at 100 µM
| |
| | |
| ===LANE BY LANE===
| |
| *Must be 50 or 150 paired-end dual indexed
| |
| *Pool must be compatible with TruSeq, Nextera, TruSeq, smRNA and Solexa sequencing primers
| |
| | |
| === MINIMUM READS ===
| |
| *the BMC has performed quality control.
| |
| * No custom primers.
| |
| *submitted libraries are at least 2 nM.
| |
| | |
| All other requests, including use of custom sequencing primers require a full flowcell. Illumina libraries which have been converted in the Center will also require a full flowcell.
| |
| | |
| | |
| | |
| |}
| |
| | |
| {|
| |
| |
| |
| == The G4 Platform ==
| |
| {| class="wikitable" border=1
| |
| !width=100| SPEC
| |
| !width=250| G4
| |
| |-
| |
| |'''SEQUENCER'''||[[Image:2023_Singular_G4.jpg|center|200px]]
| |
| |-
| |
| | '''READS/LANE'''<BR> Low number is minimum per lane for standard libraries||
| |
| * F3 per Lane: 50-100 M
| |
| |-
| |
| |'''RUN TIME'''||
| |
| * 50 PE 11 hours
| |
| * 150 PE 24 hours
| |
| |-
| |
| |'''KITS AVAILABLE'''||
| |
| * 100nt
| |
| * 300nt
| |
| |-
| |
| |'''KEY NOTES'''||
| |
| * 4-color chemistry
| |
| * Patterned flow cell
| |
| * 4-lanes per flow cell
| |
| * 4-flow cells per run
| |
| * Anchor replacement or anchor expansion of Illumina libraries
| |
| |-
| |
| |'''THANKS TO'''||
| |
| * Singular Genomics
| |
| |}
| |
| | valign='top' |
| |
| {|
| |
| ! INDEX HOPPING
| |
| ! ACCURACY
| |
| |-
| |
| |
| |
| [[IMAGE:IndexhopF3.jpeg|left|250px|Index hopping for a standard set of Singular libraries]]
| |
| |
| |
| [[IMAGE:PPPPF3.jpeg|right|200px|Percent Perfect Plot for Singular libraries 150PE]]
| |
| |-
| |
| | Index hopping on Singular runs is on par with GAIIx and HiSeq. High levels of index hopping as observed on Illumina X-AMP chemistry is not observed.
| |
| | Percent perfect plot for phiX on current Singular chemistry ([https://pmc.ncbi.nlm.nih.gov/articles/pmid/27672352/ Manley et al., 2016])
| |
| |}
| |
| |}
| |
