BioMicroCenter:Singular Sequencing

Singular Sequencing

The Center currently hosts a G4 platform by Singular Genomics. Singular’s G4 platform is a short-read mid-throughput sequencing platform delivering adequate sequencing data through its proprietary sequencing-by-synthesis chemistry at a significantly competitive price point.

Service Singular Sequencing INPUT Singular libraries MIN VOLUME 12 uL MIN CONCENTRATION 4 nM INCLUDED SERVICES Quality Control:Fragment Analyzer and qPCR Singular Sequencing Demultiplexing ADDITIONAL SERVICES Quality Control Singular library preparation DATA FORMATS FASTQ (stored 1 year) QUALITY CONTROL FASTQC Basic run metrics (alignment rate, complexity) Basic RNAseq metrics (where applicable) Basic paired end metrics (where applicable) Contamination checks PRICING LINK SUBMISSION MIT - ilabs

ANCHORS Singular requires S1/S2 anchors in place of Illumina P5/P7 anchors. These can be replaced 1:1 in most oligo designs: s1:ACAAAGGCAGCCACGCACTCCTTCCCTGT s2:CTCCAGCGAGATGACCCTCACCAACCACT INDEXING Singular indexes are read from the Anchor sequences in all cases and custom primers for indexes are not allowed. Indexes are read from the S1 primer first (index1) followed by S2 (index2) Index reads are the SAME SEQUENCE as ordered in most classical library preps. Indexes are REQUIRED and should be 8 nucleotides in all lane by lane sequencing. Min custom primer submission: 20 uL at 100 uM LANE BY LANE Must be 50 or 150 paired-end dual indexed Pool must be compatible with TruSeq, Nextera, TruSeq, smRNA and Solexa sequencing primers MINIMUM READS the BMC has performed quality control. No custom primers. submitted libraries are at least 2 nM. All other requests, including use of custom sequencing primers require a full flowcell. Illumina libraries which have been converted in the Center will also require a full flowcell.

The G4 Platform SPEC G4 SEQUENCER READS/LANE Low number is minimum per lane for standard libraries F3 per Lane: 50-100 M RUN TIME 50 PE 11 hours 150 PE 24 hours KITS AVAILABLE 100nt 300nt KEY NOTES 4-color chemistry Patterned flow cell 4-lanes per flow cell 4-flow cells per run Anchor replacement or anchor expansion of Illumina libraries THANKS TO Singular Genomics

INDEX HOPING ACCURACY Index hopping for a standard set of Singular libraries Percent Perfect Plot for Singular libraries 150PE Index hopping on Singular runs is on par with GAIIx and HiSeq. High levels of index hopping as observed on Illumina X-AMP chemistry is not observed. Percent perfect plot for phiX on current Singular chemistry (Manley et al., 2016)