The Center currently hosts a G4 platform by [https://singulargenomics.com/| Singular Genomics]. Singular’s G4 platform is a short-read mid-throughput sequencing platform delivering adequate sequencing data through its proprietary sequencing-by-synthesis chemistry at a significantly competitive price point.
{|
{|
|- style="vertical-align: top;"
| valign="top" |
|style="width: 400px;"|
{| class="wikitable" border=1
{| class="wikitable" border=1
!Service
!width=150| Service
!Singular Sequencing
!width=300| Singular Sequencing
|-
|-
|INPUT || Illumina or Singular libraries
|INPUT || Singular libraries
|-
|-
|MIN VOLUME || 12 uL
|MIN VOLUME || 12 uL
Line 20:
Line 21:
|ADDITIONAL SERVICES ||
|ADDITIONAL SERVICES ||
* Quality Control
* Quality Control
* Singular library preperation
* Singular library preparation
|-
|-
|DATA FORMATS
|DATA FORMATS
Line 41:
Line 42:
|-
|-
|}
|}
| valign="top" |
=== ANCHORS ===
Singular requires S1/S2 anchors in place of Illumina P5/P7 anchors. These can be replaced 1:1 in most oligo designs:
*s1:ACAAAGGCAGCCACGCACTCCTTCCCTGT
*s2:CTCCAGCGAGATGACCCTCACCAACCACT
=== INDEXING ===
Singular indexes are read from the Anchor sequences in all cases and custom primers for indexes are not allowed. <BR>
Indexes are read from the S1 primer first (index1) followed by S2 (index2) <BR>
Index reads are the SAME SEQUENCE as ordered in most classical library preps. <BR>
Indexes are REQUIRED and should be 8 nucleotides in all lane by lane sequencing.
*Min custom primer submission: 20 uL at 100 uM
===LANE BY LANE===
*Must be 50 or 150 paired-end dual indexed
*Pool must be compatible with TruSeq, Nextera, TruSeq, smRNA and Solexa sequencing primers
=== MINIMUM READS ===
*the BMC has performed quality control.
* No custom primers.
*submitted libraries are at least 2 nM.
All other requests, including use of custom sequencing primers require a full flowcell. Illumina libraries which have been converted in the Center will also require a full flowcell.
| '''READS/LANE'''<BR> Low number is minimum per lane for standard Illumina libraries.||
| '''READS/LANE'''<BR> Low number is minimum per lane for standard libraries||
* F3 per Lane: 50-100 M
* F3 per Lane: 50-100 M
|-
|-
|'''RUN TIME'''||
|'''RUN TIME'''||
Line 62:
Line 90:
* 100nt
* 100nt
* 300nt
* 300nt
|-
|'''KNOWN APPLICATIONS'''||
* RNAseq including single cell
* Gene Expression
* Exome
* Target Enrichment
* Metagenomics
|-
|-
|'''KEY NOTES'''||
|'''KEY NOTES'''||
Line 75:
Line 96:
* 4-lanes per flow cell
* 4-lanes per flow cell
* 4-flow cells per run
* 4-flow cells per run
* Index replacement or anchor expansion of Illumina libraries
* Anchor replacement or anchor expansion of Illumina libraries
|-
|-
|'''THANKS TO'''||
|'''THANKS TO'''||
* Singular Genomics
* Singular Genomics
|}
|}
| valign='top' |
== Singular Sequencing ==
{|
The Center currently hosts a G4 platform by [https://singulargenomics.com/| Singular Genomics]. Singular’s G4 platform is a short-read mid-throughput sequencing platform delivering adequate sequencing data through its proprietary sequencing-by-synthesis chemistry at a significantly competitive price point. The G4 platform is unique in its flexibility to run 1 to 4 flow cells in parallel, each with 4 independent lanes.<br>
! INDEX HOPING
=== Workflow ===
! ACCURACY
Library prep options for [https://openwetware.org/wiki/BioMicroCenter:DNA_LIB DNA] or [https://openwetware.org/wiki/BioMicroCenter:RNA_LIB RNA] are available for Singular sequencing. Once Singular-ready or Illumina libraries have been submitted, we will verify fragment size via [https://openwetware.org/wiki/BioMicroCenter:QC AATI's Fragment Analyzer] or [https://openwetware.org/wiki/BioMicroCenter:QC Femto Pulse], adapt Singular flow cell binding sites S1/S2 if needed, and the quantify the final loading pool via qPCR. '''We can only guarantee minimum reads per lane if: a)the BMC has performed quality control, b)the samples are high-complexity, especially for the first 10 nt of read 1, and c)submitted libraries are at least 2 nM.'''
|-
===Requirements/Things to Consider===
|
<OL>
[[IMAGE:IndexhopF3.jpeg|left|250px|Index hopping for a standard set of Singular libraries]]
<LI>All 4 bases (A, G, C, T) must appear within the first 10 cycles of read 1.
|
<LI>Both forward and reverse read strands are present and accessible during sequencing. After the desired number of cycles have been reached for a given read, a block is introduced to prevent any continued extension of the growing read chain, but the generated read chain is NOT denatured/melted away before the priming and extension of the next read. For this reason, lane-by-lane requests must be either 50 or 150 paired-end compatible with a dual index of 8 nt each. All other requests will require a 4 lane (or 1 flow cell) minimum.
[[IMAGE:PPPPF3.jpeg|right|200px|Percent Perfect Plot for Singular libraries 150PE]]
<LI>Indexes are read off flow cell binding regions, S1 and S2. For standard lane-by-lane requests, the first index will be read off the S1 region of the final library, and index 2 will be read off the S2 region. Compared to a typical Illumina library, a Singular index 1 would be the reverse compliment of the i5 index, whereas index 2 would be the reverse compliment of the i7 index.
|-
<LI>Each flow cell runs off a single reagent cartridge, thus each lane on that flow cell will be treated with the same primer cocktail by run. For standard lane-by-lane requests, this means all custom primers must be compatible with TruSeq, Nextera, TruSeq smaRNA, and Solexa sequencing primers.
| Index hopping on Singular runs is on par with GAIIx and HiSeq. High levels of index hopping as observed on Illumina X-AMP chemistry is not observed.
<LI>Singular also supports the conversion of Illumina libraries through either index replacement or anchor expansion for completed libraries that wish to be run on this platform. Index hopping rates are near zero, limiting the need for UDI's. Early quality metrics can be seen below.
| Percent perfect plot for phiX on current Singular chemistry ([https://pmc.ncbi.nlm.nih.gov/articles/pmid/27672352/ Manley et al., 2016])
|}
=== Data Handling ===
|}
=== Illumina Library to Singular Library Conversions and Custom Sequencing ===
The BioMicro Center can modify Illumina ready libraries by using the p5 and p7 flow cell binding sequences to attach Singular S1 and S2 flow cell binding sequences. However, this process leaves behind a 16 bp portion of the p5/p7 sequences requiring a different set of primers that will compete with the onboard S1 and S2 index primers. Like custom runs, these requests are rare and must be run on an entire flow cell.
The Center currently hosts a G4 platform by Singular Genomics. Singular’s G4 platform is a short-read mid-throughput sequencing platform delivering adequate sequencing data through its proprietary sequencing-by-synthesis chemistry at a significantly competitive price point.
Singular indexes are read from the Anchor sequences in all cases and custom primers for indexes are not allowed.
Indexes are read from the S1 primer first (index1) followed by S2 (index2)
Index reads are the SAME SEQUENCE as ordered in most classical library preps.
Indexes are REQUIRED and should be 8 nucleotides in all lane by lane sequencing.
All other requests, including use of custom sequencing primers require a full flowcell. Illumina libraries which have been converted in the Center will also require a full flowcell.
