Jump to content

BioMicroCenter:Singular Sequencing: Difference between revisions

From BioMicro Center
← Older edit
No edit summary
No edit summary
 
(54 intermediate revisions by 3 users not shown)
Line 1: Line 1:
== Singular Sequencing ==
The Center currently hosts a G4 platform by [https://singulargenomics.com/| Singular Genomics].  Singular’s G4 platform is a short-read mid-throughput sequencing platform delivering adequate sequencing data through its proprietary sequencing-by-synthesis chemistry at a significantly competitive price point. 
{|
{|
  |- style="vertical-align: top;"
  | valign="top" |
|style="width: 400px;"|
  {| class="wikitable" border=1
  {| class="wikitable" border=1
   !Service  
   !width=150| Service  
   !Singular Sequencing
   !width=300| Singular Sequencing
   |-
   |-
   |INPUT || Illumina or Singular libraries
   |INPUT || Singular libraries  
   |-
   |-
   |MIN VOLUME || 12 uL
   |MIN VOLUME || 12 uL
Line 20: Line 21:
   |ADDITIONAL SERVICES ||
   |ADDITIONAL SERVICES ||
* Quality Control
* Quality Control
* Singular library preperation
* Singular library preparation
   |-
   |-
   |DATA FORMATS  
   |DATA FORMATS  
Line 41: Line 42:
   |-
   |-
  |}
  |}
| valign="top" |
=== ANCHORS ===
Singular requires S1/S2 anchors in place of Illumina P5/P7 anchors. These can be replaced 1:1 in most oligo designs:
*s1:ACAAAGGCAGCCACGCACTCCTTCCCTGT
*s2:CTCCAGCGAGATGACCCTCACCAACCACT
=== INDEXING ===
Singular indexes are read from the Anchor sequences in all cases and custom primers for indexes are not allowed. <BR>
Indexes are read from the S1 primer first (index1) followed by S2 (index2) <BR>
Index reads are the SAME SEQUENCE as ordered in most classical library preps. <BR>
Indexes are REQUIRED and should be 8 nucleotides in all lane by lane sequencing.
*Min custom primer submission: 20 uL at 100 uM
===LANE BY LANE===
*Must be 50 or 150 paired-end dual indexed
*Pool must be compatible with TruSeq, Nextera, TruSeq, smRNA and Solexa sequencing primers
=== MINIMUM READS ===
*the BMC has performed quality control.
* No custom primers.
*submitted libraries are at least 2 nM.
All other requests, including use of custom sequencing primers require a full flowcell. Illumina libraries which have been converted in the Center will also require a full flowcell.


== Singular Sequencing ==
The Center currently hosts a G4 platform by [https://singulargenomics.com/| Singular Genomics].  Singular’s G4 platform is a short-read mid-throughput sequencing platform delivering adequate sequencing data through its proprietary sequencing-by-synthesis chemistry at a significantly competitive price point.  The G4 platform is unique in its flexibility to run 1 to 4 flow cells in parallel, each with 4 independent lanes.<br>




|}
{|
|
== The G4 Platform ==
== The G4 Platform ==
{| class="wikitable" border=1  
{| class="wikitable" border=1  
Line 53: Line 80:
  |'''SEQUENCER'''||[[Image:2023_Singular_G4.jpg|center|200px]]
  |'''SEQUENCER'''||[[Image:2023_Singular_G4.jpg|center|200px]]
  |-
  |-
  | '''READS/LANE'''<BR> Low number is minimum per lane for standard Illumina libraries.||
  | '''READS/LANE'''<BR> Low number is minimum per lane for standard libraries||
* F3 per Lane: 50-100 M
* F3 per Lane: 50-100 M  
  |-
  |-
|'''RUN TIME'''||
|'''RUN TIME'''||
Line 63: Line 90:
* 100nt
* 100nt
* 300nt
* 300nt
|-
|'''KNOWN APPLICATIONS'''||
* RNAseq including single cell
* Gene Expression
* Exome
* Target Enrichment
* Metagenomics
|-
|-
|'''KEY NOTES'''||
|'''KEY NOTES'''||
Line 76: Line 96:
* 4-lanes per flow cell
* 4-lanes per flow cell
* 4-flow cells per run
* 4-flow cells per run
* Index replacement or anchor expansion of Illumina libraries
* Anchor replacement or anchor expansion of Illumina libraries
|-
|-
|'''THANKS TO'''||
|'''THANKS TO'''||
* Singular Genomics
* Singular Genomics
|}
|}
 
| valign='top' |
 
{|
=== Workflow ===
  ! INDEX HOPING
Library prep options for [https://openwetware.org/wiki/BioMicroCenter:DNA_LIB DNA] or [https://openwetware.org/wiki/BioMicroCenter:RNA_LIB RNA] are available for Singular sequencing. Once Singular libraries are prepared, we verify fragment size via [https://openwetware.org/wiki/BioMicroCenter:QC AATI's Fragment Analyzer] and quantify the final loading pool via qPCR. '''We can only guarantee minimum reads per lane if: a)the BMC has performed quality control, b)the samples are high-complexity, especially for the first 10 nt of read 1, and c)submitted libraries are at least 2 nM.'''
  ! ACCURACY
===Requirements===
  |-
<OL>
  |
<LI>All 4 bases (A, G, C, T) must appear within the first 10 cycles of read 1.
[[IMAGE:IndexhopF3.jpeg|left|250px|Index hopping for a standard set of Singular libraries]]
<LI>Both forward and reverse read strands are present and accessible during sequencing. After a read completes, a block is introduced to prevent any continued extension of the growing read chain, but the generated read chain is NOT denatured/melted away before the priming and extension of the next read.
  |
<LI>Lane-by-lane requests must be either 50 or 150 paired-end compatible and compatible with TruSeq, Nextera, TruSeq, smRNA and Solexa sequencing primers. All other requests will require a 4 lane minimum since all lanes use the flowcell's sequencing primers and this includes Illumina libraries which have been converted by adding S1 and S2 to omit P5 and P7 regions.
[[IMAGE:PPPPF3.jpeg|right|200px|Percent Perfect Plot for Singular libraries 150PE]]
<LI>Indexes are read off flow cell binding regions, S1 and S2. For standard lane-by-lane requests, the first index will be read off the S1 region of the final library, and index 2 will be read off the S2 region. Compared to a typical Illumina library, a Singular index 1 would be the reverse compliment of the i5 index, whereas index 2 would be the reverse compliment of the i7 index.
  |-
<LI>Singular also supports the conversion of Illumina libraries through either index replacement or anchor expansion for completed libraries that wish to be run on this platform. Index hopping rates are near zero, limiting the need for UDI's.
  | Index hopping on Singular runs is on par with GAIIx and HiSeq. High levels of index hopping as observed on Illumina X-AMP chemistry is not observed.
  | Percent perfect plot for phiX on current Singular chemistry ([https://pmc.ncbi.nlm.nih.gov/articles/pmid/27672352/ Manley et al., 2016])
  |}
|}

Latest revision as of 16:12, 20 July 2025

Singular Sequencing[edit]

The Center currently hosts a G4 platform by Singular Genomics. Singular’s G4 platform is a short-read mid-throughput sequencing platform delivering adequate sequencing data through its proprietary sequencing-by-synthesis chemistry at a significantly competitive price point.

Service Singular Sequencing
INPUT Singular libraries
MIN VOLUME 12 uL
MIN CONCENTRATION 4 nM
INCLUDED SERVICES
  • Quality Control:Fragment Analyzer and qPCR
  • Singular Sequencing
  • Demultiplexing
ADDITIONAL SERVICES
  • Quality Control
  • Singular library preparation
DATA FORMATS
  • FASTQ (stored 1 year)
QUALITY CONTROL
  • FASTQC
  • Basic run metrics (alignment rate, complexity)
  • Basic RNAseq metrics (where applicable)
  • Basic paired end metrics (where applicable)
  • Contamination checks
PRICING LINK
SUBMISSION

ANCHORS[edit]

Singular requires S1/S2 anchors in place of Illumina P5/P7 anchors. These can be replaced 1:1 in most oligo designs:

  • s1:ACAAAGGCAGCCACGCACTCCTTCCCTGT
  • s2:CTCCAGCGAGATGACCCTCACCAACCACT

INDEXING[edit]

Singular indexes are read from the Anchor sequences in all cases and custom primers for indexes are not allowed.
Indexes are read from the S1 primer first (index1) followed by S2 (index2)
Index reads are the SAME SEQUENCE as ordered in most classical library preps.
Indexes are REQUIRED and should be 8 nucleotides in all lane by lane sequencing.

  • Min custom primer submission: 20 uL at 100 uM

LANE BY LANE[edit]

  • Must be 50 or 150 paired-end dual indexed
  • Pool must be compatible with TruSeq, Nextera, TruSeq, smRNA and Solexa sequencing primers

MINIMUM READS[edit]

  • the BMC has performed quality control.
  • No custom primers.
  • submitted libraries are at least 2 nM.

All other requests, including use of custom sequencing primers require a full flowcell. Illumina libraries which have been converted in the Center will also require a full flowcell.


The G4 Platform[edit]

SPEC G4
SEQUENCER
READS/LANE
Low number is minimum per lane for standard libraries
  • F3 per Lane: 50-100 M
RUN TIME
  • 50 PE 11 hours
  • 150 PE 24 hours
KITS AVAILABLE
  • 100nt
  • 300nt
KEY NOTES
  • 4-color chemistry
  • Patterned flow cell
  • 4-lanes per flow cell
  • 4-flow cells per run
  • Anchor replacement or anchor expansion of Illumina libraries
THANKS TO
  • Singular Genomics
INDEX HOPING ACCURACY
Index hopping for a standard set of Singular libraries
Index hopping for a standard set of Singular libraries
Percent Perfect Plot for Singular libraries 150PE
Percent Perfect Plot for Singular libraries 150PE
Index hopping on Singular runs is on par with GAIIx and HiSeq. High levels of index hopping as observed on Illumina X-AMP chemistry is not observed. Percent perfect plot for phiX on current Singular chemistry (Manley et al., 2016)
Retrieved from "http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Singular_Sequencing&oldid=22688"