BioMicroCenter:Singular Sequencing - Revision history

Asoberan: Redirect to consolidated BioMicroCenter:ShortRead page

2026-04-21T00:52:01Z

Redirect to consolidated BioMicroCenter:ShortRead page

← Older revision		Revision as of 00:52, 21 April 2026
Line 1:		Line 1:
	~~== Singular Sequencing ==~~		#REDIRECT [[BioMicroCenter:ShortRead]]
	The Center currently hosts a G4 platform by [https://singulargenomics.com/\| Singular Genomics]. Singular’s G4 platform is a short-read mid-throughput sequencing platform delivering adequate sequencing data through its proprietary sequencing-by-synthesis chemistry at a significantly competitive price point.
	{\|
	~~\| valign="top" \|~~
	~~{\| class="wikitable" border=1~~
	~~!width=150\| Service~~
	~~!width=300\| Singular Sequencing~~
	\|-
	~~\|INPUT \|\| Singular libraries~~
	\|-
	~~\|MIN VOLUME \|\| 12 uL~~
	\|-
	~~\|MIN CONCENTRATION \|\| 4 nM~~
	\|-
	~~\|INCLUDED SERVICES~~
	\|
	* Quality Control:Fragment Analyzer and qPCR
	* Singular Sequencing
	* Demultiplexing
	\|-
	~~\|ADDITIONAL SERVICES \|\|~~
	* Quality Control
	* Singular library preparation
	\|-
	~~\|DATA FORMATS~~
	\|
	*FASTQ (stored 1 year)
	\|-
	~~\|QUALITY CONTROL~~
	\|
	* [https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ FASTQC]
	* Basic run metrics (alignment rate, complexity)
	* Basic RNAseq metrics (where applicable)
	* Basic paired end metrics (where applicable)
	* Contamination checks
	\|-
	~~\|PRICING \|\|~~ [[BioMicroCenter:~~Pricing#SINGULAR_G4\|LINK]]~~
	\|-
	~~\|SUBMISSION~~
	\|
	* MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs]
	\|-
	\|}
	~~\| valign="top" \|~~

	~~=== ANCHORS ===~~
	~~Singular requires S1/S2 anchors in place of Illumina P5/P7 anchors. These can be replaced 1:1 in most oligo designs:~~
	*s1:ACAAAGGCAGCCACGCACTCCTTCCCTGT
	*s2:CTCCAGCGAGATGACCCTCACCAACCACT

	~~=== INDEXING ===~~
	~~Singular indexes are read from the Anchor sequences in all cases and custom primers for indexes are not allowed. <BR>~~
	~~Indexes are read from the S1 primer first (index1) followed by S2 (index2) <BR>~~
	~~Index reads are the SAME SEQUENCE as ordered in most classical library preps. <BR>~~
	~~Indexes are REQUIRED and should be 8 nucleotides in all lane by lane sequencing.~~
	*Min custom primer submission: 20 µL at 100 µM

	~~===LANE BY LANE===~~
	*Must be 50 or 150 paired-end dual indexed
	*Pool must be compatible with TruSeq, Nextera, TruSeq, smRNA and Solexa sequencing primers

	~~=== MINIMUM READS ===~~
	*the BMC has performed quality control.
	* No custom primers.
	*submitted libraries are at least 2 nM.

	~~All other requests, including use of custom sequencing primers require a full flowcell. Illumina libraries which have been converted in the Center will also require a full flowcell.~~



	\|}

	{\|
	\|
	~~== The G4 Platform ==~~
	~~{\| class="wikitable" border=1~~
	~~!width=100\| SPEC~~
	~~!width=250\| G4~~
	\|-
	~~\|'''SEQUENCER'''\|\|[[Image:2023_Singular_G4.jpg\|center\|200px]]~~
	\|-
	~~\| '''READS/LANE'''<BR> Low number is minimum per lane for standard libraries\|\|~~
	* F3 per Lane: 50-100 M
	\|-
	~~\|'''RUN TIME'''\|\|~~
	* 50 PE 11 hours
	* 150 PE 24 hours
	\|-
	~~\|'''KITS AVAILABLE'''\|\|~~
	* 100nt
	* 300nt
	\|-
	~~\|'''KEY NOTES'''\|\|~~
	* 4-color chemistry
	* Patterned flow cell
	* 4-lanes per flow cell
	* 4-flow cells per run
	* Anchor replacement or anchor expansion of Illumina libraries
	\|-
	~~\|'''THANKS TO'''\|\|~~
	* Singular Genomics
	\|}
	~~\| valign='top' \|~~
	{\|
	~~! INDEX HOPPING~~
	~~! ACCURACY~~
	\|-
	\|
	~~[[IMAGE:IndexhopF3.jpeg\|left\|250px\|Index hopping for a standard set of Singular libraries~~]]
	\|
	~~[[IMAGE:PPPPF3.jpeg\|right\|200px\|Percent Perfect Plot for Singular libraries 150PE]]~~
	\|-
	~~\| Index hopping on Singular runs is on par with GAIIx and HiSeq. High levels of index hopping as observed on Illumina X-AMP chemistry is not observed.~~
	~~\| Percent perfect plot for phiX on current Singular chemistry ([https://pmc.ncbi.nlm.nih.gov/articles/pmid/27672352/ Manley et al., 2016])~~
	\|}
	\|}

Gibcus: /* INDEXING */

2025-11-14T16:46:04Z

INDEXING

← Older revision		Revision as of 16:46, 14 November 2025
Line 54:		Line 54:
	Index reads are the SAME SEQUENCE as ordered in most classical library preps. <BR>		Index reads are the SAME SEQUENCE as ordered in most classical library preps. <BR>
	Indexes are REQUIRED and should be 8 nucleotides in all lane by lane sequencing.		Indexes are REQUIRED and should be 8 nucleotides in all lane by lane sequencing.
	*Min custom primer submission: 20 uL at 100 uM		*Min custom primer submission: 20 µL at 100 µM

	===LANE BY LANE===		===LANE BY LANE===

Gibcus at 16:43, 14 November 2025

2025-11-14T16:43:55Z

← Older revision		Revision as of 16:43, 14 November 2025
Line 103:		Line 103:
	\| valign='top' \|		\| valign='top' \|
	{\|		{\|
	! INDEX ~~HOPING~~		! INDEX HOPPING
	! ACCURACY		! ACCURACY
	\|-		\|-

Slevine at 16:12, 20 July 2025

2025-07-20T16:12:54Z

← Older revision		Revision as of 16:12, 20 July 2025
Line 1:		Line 1:
	== Singular Sequencing ==		== Singular Sequencing ==
	The Center currently hosts a G4 platform by [https://singulargenomics.com/\| Singular Genomics]. Singular’s G4 platform is a short-read mid-throughput sequencing platform delivering adequate sequencing data through its proprietary sequencing-by-synthesis chemistry at a significantly competitive price point.		The Center currently hosts a G4 platform by [https://singulargenomics.com/\| Singular Genomics]. Singular’s G4 platform is a short-read mid-throughput sequencing platform delivering adequate sequencing data through its proprietary sequencing-by-synthesis chemistry at a significantly competitive price point.
	{\| class="wikitable" border=1		{\|
	!width=~~100~~\| Service		\| valign="top" \|
	!width=~~250~~\| Singular Sequencing		{\| class="wikitable" border=1
			!width=150\| Service
			!width=300\| Singular Sequencing
	\|-		\|-
	\|INPUT \|\| Singular libraries		\|INPUT \|\| Singular libraries
Line 40:		Line 42:
	\|-		\|-
	\|}		\|}
			\| valign="top" \|

	~~Compared to a typical Illumina library, a~~ Singular ~~index 1 would be the reverse compliment~~ of ~~the i5 index, whereas index 2 would~~ be ~~the reverse compliment of the i7 index.~~		=== ANCHORS ===
			Singular requires S1/S2 anchors in place of Illumina P5/P7 anchors. These can be replaced 1:1 in most oligo designs:
			*s1:ACAAAGGCAGCCACGCACTCCTTCCCTGT
			*s2:CTCCAGCGAGATGACCCTCACCAACCACT

	===~~Lane-~~by-lane ~~Requirements~~===		=== INDEXING ===
			Singular indexes are read from the Anchor sequences in all cases and custom primers for indexes are not allowed. <BR>
			Indexes are read from the S1 primer first (index1) followed by S2 (index2) <BR>
			Index reads are the SAME SEQUENCE as ordered in most classical library preps. <BR>
			Indexes are REQUIRED and should be 8 nucleotides in all lane by lane sequencing.
			*Min custom primer submission: 20 uL at 100 uM

			===LANE BY LANE===
	*Must be 50 or 150 paired-end dual indexed		*Must be 50 or 150 paired-end dual indexed
	*Pool must be compatible with TruSeq, Nextera, TruSeq, smRNA and Solexa sequencing primers		*Pool must be compatible with TruSeq, Nextera, TruSeq, smRNA and Solexa sequencing primers

	~~Minimum reads per lane are guaranteed if:~~		=== MINIMUM READS ===
	*the BMC has performed quality control,		*the BMC has performed quality control.
	*~~the samples are high-complexity, especially for the first 10 nt of read 1, and~~		* No custom primers.
	*submitted libraries are at least 2 nM.		*submitted libraries are at least 2 nM.

	All other requests, including use of custom sequencing primers require a full flowcell. Illumina libraries which have been converted in the Center will also require a full flowcell.		All other requests, including use of custom sequencing primers require a full flowcell. Illumina libraries which have been converted in the Center will also require a full flowcell.

	*Min custom primer submission: 20 uL at 100 uM


	~~[[IMAGE:IndexhopF3.jpeg\|left\|250px\|Index hopping for a standard set of Singular libraries]] [[IMAGE:PPPPF3.jpeg\|right\|200px\|Percent Perfect Plot for Singular libraries 150PE]]~~

	~~Index hopping on Singular runs has been low. The performance of an F3 flowcell mimics other short-read 4 color chemistry sequencers with patterned flowcells.~~
	~~<br><br><br><br>~~

			\|}

			{\|
			\|
	== The G4 Platform ==		== The G4 Platform ==
	{\| class="wikitable" border=1		{\| class="wikitable" border=1
Line 80:		Line 90:
	* 100nt		* 100nt
	* 300nt		* 300nt
	\|-
	~~\|'''KNOWN APPLICATIONS'''\|\|~~
	* RNAseq including single cell
	* Gene Expression
	* Exome
	* Target Enrichment
	* Metagenomics
	\|-		\|-
	\|'''KEY NOTES'''\|\|		\|'''KEY NOTES'''\|\|
Line 93:		Line 96:
	* 4-lanes per flow cell		* 4-lanes per flow cell
	* 4-flow cells per run		* 4-flow cells per run
	* ~~Index~~ replacement or anchor expansion of Illumina libraries		* Anchor replacement or anchor expansion of Illumina libraries
	\|-		\|-
	\|'''THANKS TO'''\|\|		\|'''THANKS TO'''\|\|
	* Singular Genomics		* Singular Genomics
			\|}
			\| valign='top' \|
			{\|
			! INDEX HOPING
			! ACCURACY
			\|-
			\|
			[[IMAGE:IndexhopF3.jpeg\|left\|250px\|Index hopping for a standard set of Singular libraries]]
			\|
			[[IMAGE:PPPPF3.jpeg\|right\|200px\|Percent Perfect Plot for Singular libraries 150PE]]
			\|-
			\| Index hopping on Singular runs is on par with GAIIx and HiSeq. High levels of index hopping as observed on Illumina X-AMP chemistry is not observed.
			\| Percent perfect plot for phiX on current Singular chemistry ([https://pmc.ncbi.nlm.nih.gov/articles/pmid/27672352/ Manley et al., 2016])
			\|}
	\|}		\|}

Hilo1 at 17:26, 9 June 2025

2025-06-09T17:26:02Z

← Older revision		Revision as of 17:26, 9 June 2025
Line 42:		Line 42:

	Compared to a typical Illumina library, a Singular index 1 would be the reverse compliment of the i5 index, whereas index 2 would be the reverse compliment of the i7 index.		Compared to a typical Illumina library, a Singular index 1 would be the reverse compliment of the i5 index, whereas index 2 would be the reverse compliment of the i7 index.

			===Lane-by-lane Requirements===
			*Must be 50 or 150 paired-end dual indexed
			*Pool must be compatible with TruSeq, Nextera, TruSeq, smRNA and Solexa sequencing primers

	Minimum reads per lane are guaranteed if:		Minimum reads per lane are guaranteed if:
Line 47:		Line 51:
	*the samples are high-complexity, especially for the first 10 nt of read 1, and		*the samples are high-complexity, especially for the first 10 nt of read 1, and
	*submitted libraries are at least 2 nM.		*submitted libraries are at least 2 nM.

			All other requests, including use of custom sequencing primers require a full flowcell. Illumina libraries which have been converted in the Center will also require a full flowcell.

			*Min custom primer submission: 20 uL at 100 uM


	[[IMAGE:IndexhopF3.jpeg\|left\|250px\|Index hopping for a standard set of Singular libraries]] [[IMAGE:PPPPF3.jpeg\|right\|200px\|Percent Perfect Plot for Singular libraries 150PE]]		[[IMAGE:IndexhopF3.jpeg\|left\|250px\|Index hopping for a standard set of Singular libraries]] [[IMAGE:PPPPF3.jpeg\|right\|200px\|Percent Perfect Plot for Singular libraries 150PE]]
Line 52:		Line 61:
	Index hopping on Singular runs has been low. The performance of an F3 flowcell mimics other short-read 4 color chemistry sequencers with patterned flowcells.		Index hopping on Singular runs has been low. The performance of an F3 flowcell mimics other short-read 4 color chemistry sequencers with patterned flowcells.
	<br><br><br><br>		<br><br><br><br>
	~~===Lane-by-lane Requirements===~~
	*Must be 50 or 150 paired-end dual indexed
	*Pool must be compatible with TruSeq, Nextera, TruSeq, smRNA and Solexa sequencing primers

	~~All other requests require a full flowcell. Illumina libraries which have been converted in the Center will also require a full flowcell.~~
	*Min custom primer submission: 20 uL at 100 uM

	== The G4 Platform ==		== The G4 Platform ==

Hilo1 at 17:23, 9 June 2025

2025-06-09T17:23:25Z

← Older revision		Revision as of 17:23, 9 June 2025
Line 51:		Line 51:

	Index hopping on Singular runs has been low. The performance of an F3 flowcell mimics other short-read 4 color chemistry sequencers with patterned flowcells.		Index hopping on Singular runs has been low. The performance of an F3 flowcell mimics other short-read 4 color chemistry sequencers with patterned flowcells.
			<br><br><br><br>
	===Lane-by-lane Requirements===		===Lane-by-lane Requirements===
	*Must be 50 or 150 paired-end dual indexed		*Must be 50 or 150 paired-end dual indexed

Hilo1: /* Singular Sequencing */

2025-06-09T17:22:43Z

Singular Sequencing

← Older revision		Revision as of 17:22, 9 June 2025
Line 48:		Line 48:
	*submitted libraries are at least 2 nM.		*submitted libraries are at least 2 nM.

	[[IMAGE:IndexhopF3.jpeg\|left\|250px\|Index hopping for a standard set of Singular libraries]] [[IMAGE:PPPPF3.jpeg\|right\|~~250px~~\|Percent Perfect Plot for Singular libraries 150PE]]		[[IMAGE:IndexhopF3.jpeg\|left\|250px\|Index hopping for a standard set of Singular libraries]] [[IMAGE:PPPPF3.jpeg\|right\|200px\|Percent Perfect Plot for Singular libraries 150PE]]

	Index hopping on Singular runs has been low. The performance of an F3 flowcell mimics other short-read 4 color chemistry sequencers with patterned flowcells.		Index hopping on Singular runs has been low. The performance of an F3 flowcell mimics other short-read 4 color chemistry sequencers with patterned flowcells.

172.18.0.1: /* Singular Sequencing */

2025-06-09T17:21:39Z

Singular Sequencing

← Older revision		Revision as of 17:21, 9 June 2025
Line 48:		Line 48:
	*submitted libraries are at least 2 nM.		*submitted libraries are at least 2 nM.

			[[IMAGE:IndexhopF3.jpeg\|left\|250px\|Index hopping for a standard set of Singular libraries]] [[IMAGE:PPPPF3.jpeg\|right\|250px\|Percent Perfect Plot for Singular libraries 150PE]]

	Index hopping on Singular runs has been low. The performance of an F3 flowcell mimics other short-read 4 color chemistry sequencers with patterned flowcells.		Index hopping on Singular runs has been low. The performance of an F3 flowcell mimics other short-read 4 color chemistry sequencers with patterned flowcells.


	~~Index Hopping F3 flowcell~~

	~~Percent Perfect Plot 150 PE~~


	===Lane-by-lane Requirements===		===Lane-by-lane Requirements===

172.18.0.1: /* Singular Sequencing */

2025-06-09T17:18:34Z

Singular Sequencing

← Older revision		Revision as of 17:18, 9 June 2025
Line 48:		Line 48:
	*submitted libraries are at least 2 nM.		*submitted libraries are at least 2 nM.

	~~Index hopping on Singular runs has been low. In many respects, the performance of an F3 flowcell mimics other short-read 4 color chemistry sequencers with patterned flowcells.~~

	~~{\| class="wikitable" border=1~~
	Index ~~Hopping\|\|Percent Perfect Plot~~		Index hopping on Singular runs has been low. The performance of an F3 flowcell mimics other short-read 4 color chemistry sequencers with patterned flowcells.
	\|-
	\| Index Hopping F3 flowcell\|\|Percent Perfect Plot 150 PE
	}		Index Hopping F3 flowcell

			Percent Perfect Plot 150 PE


	===Lane-by-lane Requirements===		===Lane-by-lane Requirements===

172.18.0.1: /* Singular Sequencing */

2025-06-09T17:18:00Z

Singular Sequencing

← Older revision		Revision as of 17:18, 9 June 2025
Line 54:		Line 54:
	\|-		\|-
	\| Index Hopping F3 flowcell\|\|Percent Perfect Plot 150 PE		\| Index Hopping F3 flowcell\|\|Percent Perfect Plot 150 PE
	}}		}

	===Lane-by-lane Requirements===		===Lane-by-lane Requirements===