imported>Allison Perrotta: /* Procedure: */

2009-03-22T20:36:55Z

Procedure:

New page

{{BioMicroCenter}}

== Testing of RT-PCR assay to control DNA concentration for Solexa sequencing ==

Standard curve using serial dilution of PhiX control DNA. 
[[Image:BioMicroCenter_RTPCR_std1.jpg|400px]]

Simultaneous test. Samples were tested for RT-PCR and clustered for sequencing on the same day. Their DNA concentration and the correlation of the concentration as measured by RT-PCR was then compared to their cluster number. All DNA samples had been thought to be at 10nM. 
[[Image:BioMicroCenter-QPCR_proof_of_concept.jpg|400px]]

Each sample is individually colored and represented as two replicates.

== RT-PCR Protocol ==

'''QPCR Quantification for Solexa Sequencing Libraries'''

'''Materials:'''

-Enriched sample libraries (with either paired end or standard adapters)

-Phix 335bp control library (Cat. No. CT-901-1001)

-Qiagen Buffer EB

-Molecular biology grade water

-10uM Forward Primer: AATGATACGGCGACCACCGA

-10uM Reverse Primer: CAAGCAGAAGACGGCATACGA

-LightCycler 480 SYBR Master Mix (Cat. No. 04707516001)

-LightCycler 480 Multiwell Plate 96, Clear (Cat No. 05102413001)

-Light Cycler 480 Sealing Foil (included in Lightcycler plate order)

-Light Cycler 480 II RT-PCR machine (Roche)

SYBR Green and 96 well plate listed in materials are specific for Roche LightCycler 480, please adjust for use on other RT-PCR machines

'''Remember to turn on the RT-PCR machine before preparing your plate so it can warm up.
'''

== Preparing Standards: ==

- This procedure creates seven standards ranging from ~20nM to 0.3nM with which to create the standard curve. In preparing these standards 1:100 dilutions are created. After this step the standards are ready to use, they do not need to be diluted any further, and they can be kept at 4° for up to seven days.

S1 – add 2uL of Phix control to 98uL of EB

S2 – add 50uL of S1 to 50uL of EB

S3 – add 50uL of S2 to 50uL of EB

S4 – add 50uL of S3 to 50uL of EB

S5 – add 50uL of S4 to 50uL of EB

S6 – add 50uL of S5 to 50uL of EB

S7 – add 50uL of S6 to 50uL of EB

Vortex '''well''' and spin down in between each step

Illumina Phix concentrations vary from lot to lot. It is recommended that you quantify Phix each time you are preparing a new set of standards. We usually use the Qubit to accomplish this.

== Preparing Samples: ==

-Dilute all samples to ~10nM with EB using previous quantification (bioanalyzer or Qubit are recommended).

-Create 10nM 1:500 stocks of each sample by adding 2uL of 10nM sample to 998uL of EB. If a sample is suspected to be very concentrated (or you do not have a previous quantification) do a 1:1000 dilution by adding 2uL sample to 1998uL EB.

-Make sure to vortex well and spin down each sample

Having a rough idea of the concentrations of your samples helps to avoid loading samples that are too concentrated for the RT-PCR machine to read.

== Preparing Master Mix: ==

Make the following reaction mix for each well being used. Keep in mind that each sample requires three wells (triplicates) and the 16 standard wells.

'''For 1 well:'''

Water – 3uL

PCR Primer Forward (P5), 10uM – 1uL

PCR Primer Reverse (P7), 10uM – 1uL

Roche SYBR Green – 10uL

'''For 45 wells:'''

Water – 135uL

PCR Primer Forward (P5), 10uM – 45uL

PCR Primer Reverse (P7), 10uM – 45uL

Roche SYBR Green – 450uL

- flick and spin down master mix after SYBR green has been added

'''Do not add SYBR Green to master mix until right before use
'''
Master mix may vary depending on type of RT-PCR machine and brand of SYBR green being used

== Plate Preparation: ==

-Add 5uL of samples and standards to appropriate wells

-Add 5uL of EB to wells H11 and H12 for negative controls

-Add 15uL of Master Mix

We have found that the most effective way to load the plate is:

-prepare the samples and incomplete master mix (containing everything but SYBR green)

-plate all of the samples and standards

-then add SYBR green to master mix and add now complete master mix to all wells being used.

We have also found that it is beneficial to “cold load” the plate by preparing it over ice.

'''Final plate set up:'''

BioMicroCenter:RTPCR for Solexa - Revision history

imported>Allison Perrotta: /* Procedure: */