Editing BioMicroCenter:Singular Sequencing

== Singular Sequencing ==
The Center currently hosts a G4 platform by [https://singulargenomics.com/| Singular Genomics].  Singular’s G4 platform is a short-read mid-throughput sequencing platform delivering adequate sequencing data through its proprietary sequencing-by-synthesis chemistry at a significantly competitive price point.  
{|
 | valign="top" |
 {| class="wikitable" border=1
  !width=150| Service 
  !width=300| Singular Sequencing
  |-
  |INPUT || Singular libraries 
  |-
  |MIN VOLUME || 12 uL
  |-
  |MIN CONCENTRATION || 4 nM
  |-
  |INCLUDED SERVICES 
  | 
* Quality Control:Fragment Analyzer and qPCR
* Singular Sequencing 
* Demultiplexing
  |-
  |ADDITIONAL SERVICES ||
* Quality Control
* Singular library preparation
  |-
  |DATA FORMATS 
  |
*FASTQ (stored 1 year)
  |-
  |QUALITY CONTROL 
  |
* [https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ FASTQC]
* Basic run metrics (alignment rate, complexity)
* Basic RNAseq metrics (where applicable)
* Basic paired end metrics (where applicable)
* Contamination checks
  |-
  |PRICING || [[BioMicroCenter:Pricing#SINGULAR_G4|LINK]]
  |-
  |SUBMISSION 
  |
* MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] 
  |-
 |}
 | valign="top" |

=== ANCHORS ===
Singular requires S1/S2 anchors in place of Illumina P5/P7 anchors. These can be replaced 1:1 in most oligo designs:
*s1:ACAAAGGCAGCCACGCACTCCTTCCCTGT
*s2:CTCCAGCGAGATGACCCTCACCAACCACT

=== INDEXING ===
Singular indexes are read from the Anchor sequences in all cases and custom primers for indexes are not allowed. <BR>
Indexes are read from the S1 primer first (index1) followed by S2 (index2) <BR>
Index reads are the SAME SEQUENCE as ordered in most classical library preps. <BR>
Indexes are REQUIRED and should be 8 nucleotides in all lane by lane sequencing.
*Min custom primer submission: 20 µL at 100 µM

===LANE BY LANE===
*Must be 50 or 150 paired-end dual indexed
*Pool must be compatible with TruSeq, Nextera, TruSeq, smRNA and Solexa sequencing primers

=== MINIMUM READS ===
*the BMC has performed quality control.
* No custom primers.
*submitted libraries are at least 2 nM.

All other requests, including use of custom sequencing primers require a full flowcell. Illumina libraries which have been converted in the Center will also require a full flowcell.



|}

{|
 |
== The G4 Platform ==
{| class="wikitable" border=1 
 !width=100| SPEC
 !width=250| G4
 |-
 |'''SEQUENCER'''||[[Image:2023_Singular_G4.jpg|center|200px]]
 |-
 | '''READS/LANE'''<BR> Low number is minimum per lane for standard libraries||
* F3 per Lane: 50-100 M 
 |-
|'''RUN TIME'''||
* 50 PE 11 hours
* 150 PE 24 hours
 |-
|'''KITS AVAILABLE'''||
* 100nt
* 300nt
|-
|'''KEY NOTES'''||
* 4-color chemistry
* Patterned flow cell
* 4-lanes per flow cell
* 4-flow cells per run
* Anchor replacement or anchor expansion of Illumina libraries
|-
|'''THANKS TO'''||
* Singular Genomics
|}
| valign='top' |
 {|
  ! INDEX HOPPING
  ! ACCURACY
  |-
  |
[[IMAGE:IndexhopF3.jpeg|left|250px|Index hopping for a standard set of Singular libraries]]
  |
[[IMAGE:PPPPF3.jpeg|right|200px|Percent Perfect Plot for Singular libraries 150PE]]
  |-
  | Index hopping on Singular runs is on par with GAIIx and HiSeq. High levels of index hopping as observed on Illumina X-AMP chemistry is not observed.
  | Percent perfect plot for phiX on current Singular chemistry ([https://pmc.ncbi.nlm.nih.gov/articles/pmid/27672352/ Manley et al., 2016])
 |}
|}