Editing BioMicroCenter:DNA HTL (section)

== 16S / AMPLICON SEQUENCING ==
{|
|- style="vertical-align: top;"
| style="width:350px;" |
  {| class="wikitable" border=1
  |+ '''16S Metagenomic/Amplicon Library Preparation'''
  |-
  ! style="text-align: center; width: 100px;" | Parameter
  ! style="text-align: center; width: 250px;" | General requirements
  |-
  | style="text-align: center; height: 2em;" | SAMPLE INPUT
  | style="text-align: center; height: 2em;" | Clean DNA
  |-
  | style="text-align: center; height: 2em;" | RANGE OF INPUT
  | style="text-align: center; height: 2em;" | As available
  |-
  | style="text-align: center; height: 2em;" | SUBMISSION VOLUME
  | style="text-align: center; height: 2em;" | >10&micro;L 10 mM Tris Buffer
  |-
  | style="text-align: center; height: 2em;" | UNIT
  | style="text-align: center; height: 2em;" | 48 samples* <br> The BioMicro Center '''strongly''' encourages leaving space for 4 control samples within each batch of 48. 
  |-
  | style="text-align: center; height: 2em;" | PLATE SETUP
  | style="text-align: center; height: 2em;" | Samples should be arrayed by column from left to right in a 96-well full-skirt plate (Axygen)
  |-
  | style="text-align: center; height: 2em;" | SEQUENCING RECOMMENDATIONS
  | style="text-align: center; height: 2em;" | 250PE/300PE MiSeq
  |-
  | style="text-align: center; height: 2em;" | INDEX AVAILABILITY
  | style="text-align: center; height: 2em;" | 16 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] <br> 96 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]
  |-
  | style="text-align: center; height: 2em;" | INCLUDED
  | style="text-align: center; height: 2em;" | Initial qPCR <BR> Library preparation <BR> Spot check of final libraries
  |-
  | style="text-align: center; height: 2em;" | ADDITIONAL SERVICES AVAILABLE
  | style="text-align: center; height: 2em;" | Sample QC <BR> Sample cleaning <BR> Sample arraying 
  |-
  | style="text-align: center; height: 2em;" | SUBMISSION FORM
  | style="text-align: center; height: 2em;" | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=4110 ilabs] <BR> External - [[BioMicroCenter:Forms|form]]
  |-
  | style="text-align: center; height: 2em;" | PRICING
  | style="text-align: center; height: 2em;" | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]
  |}
  |
<br>
[[image:16S_layout.jpg|thumb|200px|(Lopez-Aladid et al Sci. Rep. 2023) 16S v4 region is amplified in standard BioMicro Center preps. Other regions can be substituted by submitting oligos with different variable regions]] 
:The BioMicro Center offers 16S and amplicon sequencing for metagenomics projects. Derived from the [http://be.mit.edu/directory/eric-alm Alm Lab] with support from a pilot grant from [http://cehs.mit.edu/ MIT CEHS], our protocol uses a two step amplification to first expand the 16S population and add defined 3' and 5' sequences which are then used to add Illumina anchors and sequences. This two step method allows easy multiplexing and the ability change the amplicon insert sequence at minimal cost. 
[[image:16S_diagram.jpg|thumb|400px|Standard NGS amplicon design]]
:The same method used for 16S is also applicable to other amplicons as well with minor adaption. Because we use a nested PCR, only the internal sequences need to be modified. The adapter sequences - Green:Blue - are the key element of this method. On the 5' end, they contain a "YRYR" sequence that introduces the complexity required for Illumina sequencing. 
<br>
::FORWARD: <font color=green>ACACGACGCTCTTCCGATCT</font><font color=orange>'''YRYR'''</font><font color=blue>XXXXXXX</font>
::REVERSE: <font color=green>CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT</font><font color=blue>XXXXXXX</font>
::(<font color=blue>X</font> = insert element)
:{| class="wikitable" style="margin-left: auto; margin-right: auto; border: none;"
    |+ '''Regions'''
    |-
    ! style="text-align: center; width: 200px; background: #F2F2F2;" | Target Region
    ! style="text-align: center; width: 200px; background: #F2F2F2" | Forward Primer
    ! style="text-align: center; width: 200px; background: #F2F2F2" | Reverse Primer
    |-
    | colspan="3" style="text-align: center; height: 0.5em; background: #d0e5f5;" |'''Standard Region'''
    |-
    | style="text-align: center; height: 2em; background: #f1f5fc;" |16S V4
    | style="text-align: center; height: 2em; background: #f1f5fc;" |Primer ID: U515F<br>GTGCCAGCMGCCGCGGTAA
    | style="text-align: center; height: 2em; background: #f1f5fc;" |Primer ID: E786R<br>GGACTACHVGGGTWTCTAAT
    |-
    | colspan="3" style="text-align: center; height: 0.5em; background: #d0e5f5;" |'''Alternative Regions'''
    |-
    | style="text-align: center; height: 2em; background: #f1f5fc;" |16S V1-V3
    | style="text-align: center; height: 2em; background: #f1f5fc;" |Primer ID: U24F<br>GAGTTTGATYMTGGCTCAG
    | style="text-align: center; height: 2em; background: #f1f5fc;" |Primer ID: U553R<br>GCGGCTGCTGGCACG
    |-
    | style="text-align: center; height: 2em; background: #f1f5fc;" |18S
    | style="text-align: center; height: 2em; background: #f1f5fc;" |-
    | style="text-align: center; height: 2em; background: #f1f5fc;" |-
    |}
:The most common source of failures for amplicon sequencing are samples that fail to amplify in the initial qPCR. The first step of the process is a qPCR reaction using the forward and reverse primers of the specific target regions to determine the number of cycles to be used in library generation. Libraries that fail to amplify in 20 cycles generally perform poorly enough to be unusable. Removal of PCR inhibitors is critical to success of this protocol. We do attempt to do this by serially diluting the samples and testing dilutions in the initial qPCR.
|
|}