Editing BioMicroCenter:RTPCR Protocol for Sample QC (section)

== Materials ==

* '''Enriched sample libraries (with either paired end or standard adapters)'''

* '''Phix 335bp control library (Cat. No. CT-901-1001)'''

* '''Qiagen Buffer EB'''

* '''Molecular biology grade water'''

* '''10uM Forward Primer: AATGATACGGCGACCACCGA'''

* '''10uM Reverse Primer: CAAGCAGAAGACGGCATACGA'''

* '''SYBR Green'''

<span style="color: red">Roche LightCycler 480 SYBR Master Mix (Cat. No. 04707516001)</span><br>
or <br>
<span style="color: green">KAPA LightCycler 480 SYBR Fast Master Mix (Cat. No. KK4611)</span>

* '''LightCycler Plate'''

<span style="color: red">Roche LightCycler 480 Multiwell Plate 96, Clear (Cat No. 05102413001) and Sealing Foil</span><br>
or<br>
<span style="color: green">Axygen LightCycler 480 Multiwell Plate 96, White (Cat No. PCR-96-LC480-W) and Sealing Foil</span>