Editing BioMicroCenter:DNA HTL (section)

= High-throughput DNA Library Preparation =
The BioMicro Center offers high-throuhgput DNA library preparation ([[BioMicroCenter:FAQ#STANDARD_versus_HIGH_THROUGHPUT_LIBRARY_PREPARATION|HTL-DNA]]) for both intact and fragmented samples as well as for metagenomics/amplicon generation. High-throughput library generation focuses on reducing price and processing time on a per sample basis. To do this, there are several key differences from our standard library preparation service. First, HTL-DNA services have set batch sizes (24 and 96) with fixed price points (i.e. charge for 16 samples will be the as 24 samples; similarly for 80 samples as 96). If under these batch sizes, DO MORE REPLICATES to simultaneously enhance experimental power and reduce price per sample. Some samples may fail and the cost of re-prepping those samples is NOT included in the quoted cost unless re-prep of the entire plate is deemed necessary. Re-preps can be done by hand, but at a higher rate. Second, the HTL option focuses on reducing price and processing time per sample, so some routine services provided with standard library preparation - such as initial and final quality control for all samples, sample arraying, or automatic re-prep of failed samples - are not built in. These services are available as add ons to the original service request. <br><br>

<b>Reminder: </b> high throughput projects are treated with <b>one condition</b> (PCR cycles, fragmentation time, etc...). They are meant for allowing high replicates of the same samples. High throughput submissions for projects with multiple sub-projects from separate individuals combined on the same plate result in a low success rate due to the different conditions for each sub project. Therefore, htl submissions from multiple projects will tolerate and may expect, failure rates well over 10%.

== FRAGMENTED DNA ==
=== NEB Ultra II ===
{|
|- style="vertical-align: top;"
| style="width:500px;" |
  {| class="wikitable" border=1
  |-
  ! style="text-align: center; width: 150px;" | Parameter
  ! style="text-align: center; width: 300px;" | General requirements
  ! style="text-align: center; width: 300px;" | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]
  |-
  | style="text-align: center; height: 2em;" | SAMPLE INPUT
  | colspan="2" style="text-align: center; height: 2em;" | Fragmented DNA (i.e. ChIP-Seq, small PCR amplicons)
  |-
  | style="text-align: center; height: 2em;" | RANGE OF INPUT
  | style="text-align: center; height: 2em;" | 100pg - 75ng
  | style="text-align: center; height: 2em;" | Samples all [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to same concentration in 10&micro;L (100pg/&micro;L - 7.5ng/&micro;L)
  |-
  | style="text-align: center; height: 2em;" | SUBMISSION VOLUME
  | style="text-align: center; height: 2em;" | >10&micro;L 10 mM Tris pH 8.0
  | style="text-align: center; height: 2em;" | Exactly 10&micro;L 10mM Tris pH 8.0
  |-
  | style="text-align: center; height: 2em;" | UNIT
  | colspan="2" style="text-align: center; height: 2em;" | 24 samples <BR> 96 samples
  |-
  | style="text-align: center; height: 2em;" | PLATE SETUP
  | style="text-align: center; height: 2em;" | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)
  | style="text-align: center; height: 2em;" | Samples arrayed by column in [[BioMicroCenter:DNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)
  |-
  | style="text-align: center; height: 2em;" | SEQUENCING RECOMMENDATIONS
  | colspan="2" style="text-align: center; height: 2em;" | All platforms
  |-
  | style="text-align: center; height: 2em;" | INDEX AVAILABILITY
  | colspan="2" style="text-align: center; height: 2em;" |112 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] <br> 192 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]
  |-
  | style="text-align: center; height: 2em;" | INCLUDED
  | colspan="2" style="text-align: center; height: 2em;" | Library preparation <BR> Spot check of final libraries
  |-
  | style="text-align: center; height: 2em;" | ADDITIONAL SERVICES AVAILABLE
  | style="text-align: center; height: 2em;" | Sample QC <BR> Sample cleaning <BR> Sample arraying <BR> Sample re-prep
  | style="text-align: center; height: 2em;" | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]
  |-
  | style="text-align: center; height: 2em;" | SUBMISSION FORM
  | colspan="2" style="text-align: center; height: 2em;" | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] <BR> External - [[BioMicroCenter:Forms|form]]
  |-
  | style="text-align: center; height: 2em;" | PRICING
  | colspan="2" style="text-align: center; height: 2em;" | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]
  |}
 |
<br>
:NEBNext Ultra II is used for standard ligation-mediated PCR based approaches. We have miniaturized the reaction volume to a 1/5th scale that reliably performs on inputs ranging from 10pg to 75ng (recommended minimum of 100pg). The reaction begins with 10&micro;L of normalized sample to which reagents are added. As such, initial submission of clean samples that have been pre-normalized in greater than 10&micro;L of appropriate buffer will hasten sample processing. 
<br><br>
:[[IMAGE:Ultra_II_DNA_Input.jpg | 400px]] [[IMAGE:Ultra_II_FAtrace.jpg | 400px]]
 |
|}

== INTACT GENOMES ==
=== Nextera Flex ===
{|
|- style="vertical-align: top;"
| style="width:500px;" |
  {| class="wikitable" border=1
  |-
  ! style="text-align: center; width: 150px;" | Parameter
  ! style="text-align: center; width: 300px" | General requirements
  ! style="text-align: center; width: 300px" | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]
  |-
  | style="text-align: center; height: 2em;" | SAMPLE INPUT
  | colspan="2" style="text-align: center; height: 2em;" | Intact DNA and large amplicons
  |-
  | style="text-align: center; height: 2em;" | RANGE OF INPUT
  | style="text-align: center; height: 2em;" | 1ng - 50ng
  | style="text-align: center; height: 2em;" | Samples all [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to same concentration in 3µL (330pg/µL - 16.5ng/µL, *higher is better)
  |-
  | style="text-align: center; height: 2em;" | SUBMISSION VOLUME
  | style="text-align: center; height: 2em;" | >10&micro;L 10 mM Tris Buffer
  | style="text-align: center; height: 2em;" | Exactly 3&micro;L 10 mM Tris Buffer
  |-
  | style="text-align: center; height: 2em;" | UNIT
  | colspan="2" style="text-align: center; height: 2em;" | 24 samples <BR> 96 samples
  |-
  | style="text-align: center; height: 2em;" | PLATE SETUP
  | style="text-align: center; height: 2em;" | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)
  | style="text-align: center; height: 2em;" | Samples arrayed by column in [[BioMicroCenter:DNA_HTL|1st quadrant]] of 384-well hard-shell plate (BioRad)
  |-
  | style="text-align: center; height: 2em;" | SEQUENCING RECOMMENDATIONS
  | colspan="2" style="text-align: center; height: 2em;" | All platforms except 40SE HiSeq
  |-
  | style="text-align: center; height: 2em;" | INDEX AVAILABILITY
  | colspan="2" style="text-align: center; height: 2em;" | 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] <br> [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]] ''not available''
  |-
  | style="text-align: center; height: 2em;" | INCLUDED
  | colspan="2" style="text-align: center; height: 2em;" | Library preparation <BR> Spot check of final libraries
  |-
  | style="text-align: center; height: 2em;" | ADDITIONAL SERVICES AVAILABLE
  | style="text-align: center; height: 2em;" | Sample QC <BR> Sample cleaning <BR> Sample arraying <BR> Sample re-prep
  | style="text-align: center; height: 2em;" | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]
  |-
  | style="text-align: center; height: 2em;" | SUBMISSION FORM
  | colspan="2" style="text-align: center; height: 2em;" | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] <BR> External - [[BioMicroCenter:Forms|form]]
  |-
  | style="text-align: center; height: 2em;" | PRICING
  | colspan="2" style="text-align: center; height: 2em;" | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]
  |}
 |
<br>
:Unlike XT, Nextera Flex, also known as Illumina DNA Prep, utilizes bead-linked transposomes (BLT) to tagment and generate libraries from intact DNA samples. These BLTs control sizing during the tagmentation reaction by sterics, producing a much more consistent libraries with larger size distribution which makes it ideal for larger paired-end runs on sequencers.
:Nextera Flex is currently run at a 1/10th miniaturization scale on the Mosquito HV with a broader dynamic range of input (1ng - 50ng) compared to XT. Nextera Flex self-normalizes at a certain input (if sample concentration is 3ng/&micro;L or greater) and submissions do not have to be normalized so long as that threshold is met. Up to 384 libraries can be multiplexed using Nextera unique dual-indexes (UDI) which helps to avoid issues with 'barcode hopping'.
::::[[IMAGE:Flex_Diagram.jpg | 500px]]
::::::[[IMAGE:Flex_Trace.jpg | 300px]]
 |
|}

=== Nextera XT ===
{|
|- style="vertical-align: top;"
| style="width:500px;" |
  {| class="wikitable" border=1
  |-
  ! style="text-align: center; width: 150px;" | Parameter
  ! style="text-align: center; width: 300px" | General requirements
  ! style="text-align: center; width: 300px" | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]
  |-
  | style="text-align: center; height: 2em;" | SAMPLE INPUT
  | colspan="2" style="text-align: center; height: 2em;" | Intact DNA and large amplicons
  |-
  | style="text-align: center; height: 2em;" | RANGE OF INPUT
  | style="text-align: center; height: 2em;" | > 0.2ng/&micro;L
  | style="text-align: center; height: 2em;" | Samples [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to 0.2ng/&micro;L
  |-
  | style="text-align: center; height: 2em;" | SUBMISSION VOLUME
  | style="text-align: center; height: 2em;" | >10&micro;L 10 mM Tris Buffer
  | style="text-align: center; height: 2em;" | Exactly 5&micro;L 10 mM Tris Buffer
  |-
  | style="text-align: center; height: 2em;" | UNIT
  | colspan="2" style="text-align: center; height: 2em;" | 24 samples <BR> 96 samples
  |-
  | style="text-align: center; height: 2em;" | PLATE SETUP
  | style="text-align: center; height: 2em;" | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)
  | style="text-align: center; height: 2em;" | Samples arrayed by column in [[BioMicroCenter:DNA_HTL#Quadrant_Layout|1st quadrant]] of a 384-well LVSD plate (Available at BMC)
  |-
  | style="text-align: center; height: 2em;" | SEQUENCING RECOMMENDATIONS
  | colspan="2" style="text-align: center; height: 2em;" | 40SE HiSeq
  |-
  | style="text-align: center; height: 2em;" | INDEX AVAILABILITY
  | colspan="2" style="text-align: center; height: 2em;" | 16 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] <br> 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]
  |-
  | style="text-align: center; height: 2em;" | INCLUDED
  | colspan="2" style="text-align: center; height: 2em;" | Library preparation <BR> Spot check of final libraries
  |-
  | style="text-align: center; height: 2em;" | ADDITIONAL SERVICES AVAILABLE
  | style="text-align: center; height: 2em;" | Sample QC <BR> Sample cleaning <BR> Sample arraying <BR> Sample re-prep
  | style="text-align: center; height: 2em;" | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]
  |-
  | style="text-align: center; height: 2em;" | SUBMISSION FORM
  | colspan="2" style="text-align: center; height: 2em;" | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] <BR> External - [[BioMicroCenter:Forms|form]]
  |-
  | style="text-align: center; height: 2em;" | PRICING
  | colspan="2" style="text-align: center; height: 2em;" | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]
  |}
 |
<br>
:Nextera XT is a solution-based "tagmentation" chemistry used for the preparation of intact DNA samples to generate libraries with smaller insert sizes which is best suited for 40bp single-end runs on sequencers. Nextera XT has been miniaturized to a 1/12th reaction volume on our Mosquito HV from minimal low sample concentration (0.2ng/&micro;L or greater) and up to 384 libraries can be run on a single sequencing lane using dual indexes.
:The Mosquito HV allows for libraries to be prepared at decreased volumes which results in significantly reduced costs but also lowers library complexity. As such, it is most suitable for single cell and amplicon analysis. De novo work should not be done using Nextera XT preps on the Mosquito HV.

::[[IMAGE:Nextera_Illumina_fig1.jpg | 200px]][[IMAGE:XT_Trace.jpg | 250px]]
 |
|}

== 16S / AMPLICON SEQUENCING ==
{|
|- style="vertical-align: top;"
| style="width:350px;" |
  {| class="wikitable" border=1
  |+ '''16S Metagenomic/Amplicon Library Preparation'''
  |-
  ! style="text-align: center; width: 100px;" | Parameter
  ! style="text-align: center; width: 250px;" | General requirements
  |-
  | style="text-align: center; height: 2em;" | SAMPLE INPUT
  | style="text-align: center; height: 2em;" | Clean DNA
  |-
  | style="text-align: center; height: 2em;" | RANGE OF INPUT
  | style="text-align: center; height: 2em;" | As available
  |-
  | style="text-align: center; height: 2em;" | SUBMISSION VOLUME
  | style="text-align: center; height: 2em;" | >10&micro;L 10 mM Tris Buffer
  |-
  | style="text-align: center; height: 2em;" | UNIT
  | style="text-align: center; height: 2em;" | 48 samples* <br> The BioMicro Center '''strongly''' encourages leaving space for 4 control samples within each batch of 48. 
  |-
  | style="text-align: center; height: 2em;" | PLATE SETUP
  | style="text-align: center; height: 2em;" | Samples should be arrayed by column from left to right in a 96-well full-skirt plate (Axygen)
  |-
  | style="text-align: center; height: 2em;" | SEQUENCING RECOMMENDATIONS
  | style="text-align: center; height: 2em;" | 250PE/300PE MiSeq
  |-
  | style="text-align: center; height: 2em;" | INDEX AVAILABILITY
  | style="text-align: center; height: 2em;" | 16 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] <br> 96 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]
  |-
  | style="text-align: center; height: 2em;" | INCLUDED
  | style="text-align: center; height: 2em;" | Initial qPCR <BR> Library preparation <BR> Spot check of final libraries
  |-
  | style="text-align: center; height: 2em;" | ADDITIONAL SERVICES AVAILABLE
  | style="text-align: center; height: 2em;" | Sample QC <BR> Sample cleaning <BR> Sample arraying 
  |-
  | style="text-align: center; height: 2em;" | SUBMISSION FORM
  | style="text-align: center; height: 2em;" | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=4110 ilabs] <BR> External - [[BioMicroCenter:Forms|form]]
  |-
  | style="text-align: center; height: 2em;" | PRICING
  | style="text-align: center; height: 2em;" | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]
  |}
  |
<br>
[[image:16S_layout.jpg|thumb|200px|(Lopez-Aladid et al Sci. Rep. 2023) 16S v4 region is amplified in standard BioMicro Center preps. Other regions can be substituted by submitting oligos with different variable regions]] 
:The BioMicro Center offers 16S and amplicon sequencing for metagenomics projects. Derived from the [http://be.mit.edu/directory/eric-alm Alm Lab] with support from a pilot grant from [http://cehs.mit.edu/ MIT CEHS], our protocol uses a two step amplification to first expand the 16S population and add defined 3' and 5' sequences which are then used to add Illumina anchors and sequences. This two step method allows easy multiplexing and the ability change the amplicon insert sequence at minimal cost. 
[[image:16S_diagram.jpg|thumb|400px|Standard NGS amplicon design]]
:The same method used for 16S is also applicable to other amplicons as well with minor adaption. Because we use a nested PCR, only the internal sequences need to be modified. The adapter sequences - Green:Blue - are the key element of this method. On the 5' end, they contain a "YRYR" sequence that introduces the complexity required for Illumina sequencing. 
<br>
::FORWARD: <font color=green>ACACGACGCTCTTCCGATCT</font><font color=orange>'''YRYR'''</font><font color=blue>XXXXXXX</font>
::REVERSE: <font color=green>CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT</font><font color=blue>XXXXXXX</font>
::(<font color=blue>X</font> = insert element)
:{| class="wikitable" style="margin-left: auto; margin-right: auto; border: none;"
    |+ '''Regions'''
    |-
    ! style="text-align: center; width: 200px; background: #F2F2F2;" | Target Region
    ! style="text-align: center; width: 200px; background: #F2F2F2" | Forward Primer
    ! style="text-align: center; width: 200px; background: #F2F2F2" | Reverse Primer
    |-
    | colspan="3" style="text-align: center; height: 0.5em; background: #d0e5f5;" |'''Standard Region'''
    |-
    | style="text-align: center; height: 2em; background: #f1f5fc;" |16S V4
    | style="text-align: center; height: 2em; background: #f1f5fc;" |Primer ID: U515F<br>GTGCCAGCMGCCGCGGTAA
    | style="text-align: center; height: 2em; background: #f1f5fc;" |Primer ID: E786R<br>GGACTACHVGGGTWTCTAAT
    |-
    | colspan="3" style="text-align: center; height: 0.5em; background: #d0e5f5;" |'''Alternative Regions'''
    |-
    | style="text-align: center; height: 2em; background: #f1f5fc;" |16S V1-V3
    | style="text-align: center; height: 2em; background: #f1f5fc;" |Primer ID: U24F<br>GAGTTTGATYMTGGCTCAG
    | style="text-align: center; height: 2em; background: #f1f5fc;" |Primer ID: U553R<br>GCGGCTGCTGGCACG
    |-
    | style="text-align: center; height: 2em; background: #f1f5fc;" |18S
    | style="text-align: center; height: 2em; background: #f1f5fc;" |-
    | style="text-align: center; height: 2em; background: #f1f5fc;" |-
    |}
:The most common source of failures for amplicon sequencing are samples that fail to amplify in the initial qPCR. The first step of the process is a qPCR reaction using the forward and reverse primers of the specific target regions to determine the number of cycles to be used in library generation. Libraries that fail to amplify in 20 cycles generally perform poorly enough to be unusable. Removal of PCR inhibitors is critical to success of this protocol. We do attempt to do this by serially diluting the samples and testing dilutions in the initial qPCR.
|
|}