BioMicro Center - Recent changes [en]

MIT:Pricing

Hilo1 — Mon, 27 Apr 2026 17:27:20 GMT

OTHER LAB SERVICES

← Older revision		Revision as of 17:27, 27 April 2026
(5 intermediate revisions by the same user not shown)
Line 75:		Line 75:
	! Length !! Reads !! [[BioMicroCenter:CoreDeps\|CORE LAB]] !! MIT !! unit !! Notes		! Length !! Reads !! [[BioMicroCenter:CoreDeps\|CORE LAB]] !! MIT !! unit !! Notes
	\|-		\|-
	\| 300nt \|\| rowspan="2" \| 5M \|\| $715 \|\| $786.50 \|\| rowspan="9" \| per ~~flowcell~~ \|\| rowspan="9" \| Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year		\| 300nt \|\| rowspan="2" \| 5M \|\| $715 \|\| $786.50 \|\| rowspan="9" \| per kit \|\| rowspan="9" \| Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year
	\|-		\|-
	\| 600nt \|\| $1,040 \|\| $1,144		\| 600nt \|\| $1,040 \|\| $1,144
Line 130:		Line 130:
	! Length !! Reads !! [[BioMicroCenter:CoreDeps\|CORE LAB]] !! MIT !! unit !! Notes		! Length !! Reads !! [[BioMicroCenter:CoreDeps\|CORE LAB]] !! MIT !! unit !! Notes
	\|-		\|-
	\| 70nt \|\| 15M \|\| $1,320 \|\| $1,452 \|\| rowspan="6" \| per ~~lane~~ \|\| rowspan="6" \| Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year		\| 70nt \|\| 15M \|\| $1,320 \|\| $1,452 \|\| rowspan="6" \| per kit \|\| rowspan="6" \| Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year
	\|-		\|-
	\| 150nt \|\| 25M \|\| $1,430 \|\| $1,573		\| 150nt \|\| 25M \|\| $1,430 \|\| $1,573
Line 310:		Line 310:
	{\| class="wikitable"		{\| class="wikitable"
	\|-		\|-
	! TYPE !! Batch Size !! [[BioMicroCenter:CoreDeps\|CORE LAB]] !! MIT ~~!! Notes~~		! TYPE !! Batch Size !! [[BioMicroCenter:CoreDeps\|CORE LAB]] !! MIT
	\|-		\|-
	\| DNA \|\| 96 \|\| $700 \|\| $770 \|\|		\| DNA \|\| 96 \|\| $700 \|\| $770
	\|-		\|-
	\| RNA \|\| 96 \|\| $800 \|\| $880 \|\|		\| RNA \|\| 96 \|\| $800 \|\| $880
	\|-		\|-
	\| RNA/DNA Isolation - Assisted \|\| 12 samples \|\| $300 \|\| $330 \|\|		\| RNA/DNA Isolation - Assisted \|\| 12 samples \|\| $300 \|\| $330
	\|-		\|-
	\| RNA/DNA Isolation - Assisted \|\| 96 samples \|\| $1,000 \|\| $1,100 \|\|		\| RNA/DNA Isolation - Assisted \|\| 96 samples \|\| $1,000 \|\| $1,100
	\|}		\|}

Line 453:		Line 453:
	! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps\|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes		! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps\|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes
	\|-		\|-
	\| Roche LightCycler 480 \|\| $15 \|\| per plate \|\| [https://mit.ilabsolutions.com/schedules/261680#/schedule/ CALENDAR] *available for CORE only \|\| ~~Contact [[BioMicroCenter:People\|Christopher Hallee]]~~ for training		\| Roche LightCycler 480 \|\| $15 \|\| per plate \|\| [https://mit.ilabsolutions.com/schedules/261680#/schedule/ CALENDAR] *available for CORE only \|\| Email biomicro@mit.edu for training
	\|-		\|-
	\| SYBR Green (KAPA/Roche) \|\| $45 \|\| per ml \|\| \|\| Available for MIT only		\| SYBR Green (KAPA/Roche) \|\| $45 \|\| per ml \|\| \|\| Available for MIT only
Line 476:		Line 476:
	\| Gel Isolation \|\| $75 \|\| per gel (5 lanes) \|\| TBA \|\|		\| Gel Isolation \|\| $75 \|\| per gel (5 lanes) \|\| TBA \|\|
	\|-		\|-
	\| Training \|\| $25 \|\| per session \|\| TBA \|\| ~~Contact [[BioMicroCenter:People\|Noelani Kamelamela]]~~ for training.		\| Training \|\| $25 \|\| per session \|\| TBA \|\| Email biomicro@mit.edu for training.
	\|-		\|-
	\| colspan="5" \| '''PLATE READER'''		\| colspan="5" \| '''PLATE READER'''
	\|-		\|-
	\| Varioskan \|\| $18 \|\| per hour \|\| [https://mit.ilabsolutions.com/schedules/262715#/schedule/ CALENDAR] \|\| ~~Contact [[BioMicroCenter:People\|Noelani Kamelamela]]~~ for training		\| Varioskan \|\| $18 \|\| per hour \|\| [https://mit.ilabsolutions.com/schedules/262715#/schedule/ CALENDAR] \|\| Email biomicro@mit.edu for training
	\|-		\|-
	\| colspan="5" \| '''ROBOTICS'''		\| colspan="5" \| '''ROBOTICS'''
Line 490:		Line 490:
	\| Filter tips \|\| $12.00 \|\| per box \|\| \|\|		\| Filter tips \|\| $12.00 \|\| per box \|\| \|\|
	\|-		\|-
	\| Training \|\| $65 \|\| per hour \|\| ~~Contact [[BioMicroCenter:People\|Tatum Murdock]]~~ \|\|		\| Training \|\| $65 \|\| per hour \|\| Email biomicro@mit.edu \|\|
	\|-		\|-
	\| colspan="5" \| '''NANODROP'''		\| colspan="5" \| '''NANODROP'''

BioMicroCenter:Pricing

Hilo1 — Mon, 27 Apr 2026 17:08:31 GMT

CHEMAGIC360

← Older revision		Revision as of 17:08, 27 April 2026
Line 234:		Line 234:
	{\| class="wikitable"		{\| class="wikitable"
	\|-		\|-
	! TYPE !! Batch Size !! [[BioMicroCenter:FAQ#NON_MIT_USERS\|External Academic]] !! External For-Profit ~~!! Notes~~		! TYPE !! Batch Size !! [[BioMicroCenter:FAQ#NON_MIT_USERS\|External Academic]] !! External For-Profit
	\|-		\|-
	\| DNA \|\| 96 \|\| $875 \|\| $980		\| DNA \|\| 96 \|\| $875 \|\| $980

BioMicroCenter

Slevine — Fri, 24 Apr 2026 19:00:14 GMT

← Older revision		Revision as of 19:00, 24 April 2026
Line 10:		Line 10:
	* [[BioMicroCenter:Submission\|Sample Submission]]		* [[BioMicroCenter:Submission\|Sample Submission]]
	* [[BioMicroCenter:Consumables\|Consumables]]		* [[BioMicroCenter:Consumables\|Consumables]]
			* [[BioMicroCenter:Consulting\|Experimental Design]]
	\| valign="top" align="left"\|		\| valign="top" align="left"\|
	* [[BioMicroCenter:AboutBMC\|About the BioMicro Center]]		* [[BioMicroCenter:AboutBMC\|About the BioMicro Center]]

BioMicroCenter:Illumina Library Preparation

Slevine — Thu, 23 Apr 2026 22:55:36 GMT

← Older revision		Revision as of 22:55, 23 April 2026
Line 1:		Line 1:
	{{BioMicroCenter}}		{{BioMicroCenter}}

	Generating high-quality data on any short read sequencing platform requires high-quality libraries. The BMC currently offers library preparation services for a variety of starting materials. Prior to sequencing, all libraries must pass the BioMicro ~~Center’s~~ Sequencing Quality Control process, which verifies selection of inserts of a desired size and correct ligation of short read sequencing adapters.		Generating high-quality data on any short read sequencing platform requires high-quality libraries. The BMC currently offers library preparation services for a variety of starting materials. Prior to sequencing, all libraries must pass the BioMicro Center's Sequencing Quality Control process, which verifies selection of inserts of a desired size and correct ligation of short read sequencing adapters.

	== Short Read Library Prep Services==		== Short Read Library Prep Services==
Line 19:		Line 19:
	\| '''[[BioMicroCenter:RNA_LIB\|Standard RNA Methods include]]'''		\| '''[[BioMicroCenter:RNA_LIB\|Standard RNA Methods include]]'''
	* NEB UltraII <br> polyA stranded method		* NEB UltraII <br> polyA stranded method
	* NEB ribosomal depletion ~~(NEB or Lexogen for Bacteria)~~ <br> stranded rRNA depletion		* NEB ribosomal depletion <br> stranded rRNA depletion
	* ~~SMARTer_Low-Input~~ <br> Low input polyA based		* Clontech SMARTseq <br> Low input polyA based
	* Clontech ZapR <br> Low input rRNA depletion based.		* Clontech ZapR <br> Low input rRNA depletion based
	* ~~smallRNA~~ prep		* Small RNA prep
	\|-		\|-
	\| '''[[BioMicroCenter:DNA_HTL\|High Throughput DNA Methods include]]'''		\| '''[[BioMicroCenter:DNA_HTL\|High Throughput DNA Methods include]]'''
Line 35:		Line 35:
	* SMARTseq v2		* SMARTseq v2
	* ZapR		* ZapR
			\|}

			== Long Read Library Prep Services ==

			The BioMicro Center also supports library preparation for long-read sequencing on two platforms. See the [[BioMicroCenter:LongRead\|Long Read Sequencing page]] for full details on sequencing services and platform comparison.

			{\| style="wikitable" border=1
			!width=300\| Oxford Nanopore Technologies
			!width=300\| PacBio
			\|-
			\| '''[[BioMicroCenter:LongRead#PromethION_Library_Preparation\|Nanopore Library Methods include]]'''
			* LSK114 — Ligation-based dsDNA
			* RBK114 — Tagmentation-based / ultra-long
			* RNA004 — Direct RNA sequencing
			* Native barcoding available (up to 96 samples)

			\| '''[[BioMicroCenter:LongRead#Revio_.E2.80.94_Library_Preparation\|PacBio Library Methods include]]'''
			* SMRTbell Prep Kit v3.0
			* Genomic DNA (HiFi, 10–20 kb reads)
			* Size selection via PippinPrep available
	\|}		\|}

BioMicroCenter:Consulting

Slevine — Thu, 23 Apr 2026 03:06:42 GMT

Created page with "{{BioMicroCenter}} The MIT BioMicro Center encourages researchers to reach out before a project begins. A short conversation at the planning stage can make a significant difference — helping to match the right experimental approach to your scientific question, avoid common design pitfalls, and ensure that data will be interpretable when results come in. Staff are experienced collaborators. Whether you have a fully formed experimental plan or an early-stage idea, we a..."

New page

{{BioMicroCenter}}

The MIT BioMicro Center encourages researchers to reach out before a project begins. A short conversation at the planning stage can make a significant difference — helping to match the right experimental approach to your scientific question, avoid common design pitfalls, and ensure that data will be interpretable when results come in.

Staff are experienced collaborators. Whether you have a fully formed experimental plan or an early-stage idea, we are happy to think through the problem with you. Consultations are free and we work with researchers at every career stage, from first-year graduate students designing their first sequencing experiment to faculty launching new research directions.

Common topics for pre-project consultation include experimental design and controls, choice of sequencing assay, sample and replicate requirements, expected data volumes and compute needs, and data management planning. For projects that will involve bioinformatics support, early consultation with the analysis team helps ensure the computational work is scoped correctly from the start.

If you are unsure who to contact, start with Stuart — his contact information is below.

== WHO TO CONTACT ==

Different staff members have primary responsibility for different areas. Reach out directly to the person whose expertise best matches your question.

=== General and All Areas ===

[[Image:SL_07.jpg|right|100px]]
[[User:Stuart S. Levine|'''Stuart Levine''']], PhD — Director
* Email: [mailto:slevine@mit.edu slevine@mit.edu]
* Phone: 617-452-2949
* Calendar: [https://calendar.app.google/5gYsL6Gyp6GBBSU86 Book time with Stuart]

Stuart is the director of the BioMicro Center and has been leading genomics and bioinformatics core operations at MIT since 2008. He is the appropriate first contact for questions spanning experimental design, informatics, genomics, and data management, or when you are unsure where to start.

=== Informatics ===


[https://ki.mit.edu/people/sbc-leadership/charlie-whittaker '''Charlie Whittaker'''], PhD — Facility Scientific Director
* Email: [mailto:charliew@mit.edu charliew@mit.edu]

Charlie leads the informatics group and is the right contact for questions about bioinformatics project planning, analysis methods, and computational approaches. The informatics team has active experience across transcriptomics, regulatory genomics, variant analysis, metagenomics, and machine learning applications.

=== Genomics ===


[[User:Johan_Gibcus|'''Johan Gibcus''']], PhD — Program Manager
* Email: [mailto:gibcus@mit.edu gibcus@mit.edu]
* Phone: x54533

Johan manages genomics operations and is the appropriate contact for questions about sequencing assays, library preparation strategies, and experimental design for genomics experiments.

=== Data Management ===

[[Image:Charlie_Demurjian_headshot.jpg|right|100px]]
[https://www.linkedin.com/in/cdemurjian/ '''Charlie Demurjian'''] — Lead Data Specialist
* Email: [mailto:cdemu@mit.edu cdemu@mit.edu]
* Phone: x44945

Charlie leads data management efforts and is the right contact for questions about data organization, repository submission, FAIR compliance, and archiving.

== RELATED PAGES ==

* [[BioMicroCenter:Analysis|Bioinformatics & Analysis]]
* [[BioMicroCenter:DataManagement|Data Management]]
* [[BioMicroCenter:Pricing|Pricing]]

[[Category:BioMicroCenter]]

BioMicroCenter

Slevine — Thu, 23 Apr 2026 03:06:10 GMT

← Older revision		Revision as of 03:06, 23 April 2026
Line 13:		Line 13:
	* [[BioMicroCenter:AboutBMC\|About the BioMicro Center]]		* [[BioMicroCenter:AboutBMC\|About the BioMicro Center]]
	* [[BioMicroCenter:People\| Staff]]		* [[BioMicroCenter:People\| Staff]]
			* [[BioMicroCenter:Consulting\| Getting Started]]
	<!-- [[BioMicroCenter:Jobs\|Positions Available]] -->		<!-- [[BioMicroCenter:Jobs\|Positions Available]] -->
	* [[BioMicroCenter:FAQ\|FAQs]]		* [[BioMicroCenter:FAQ\|FAQs]]

BioMicroCenter:Pricing

Slevine — Wed, 22 Apr 2026 20:52:53 GMT

SHORT READ LIBRARY - DNA

Show changes

MIT:Pricing

Slevine — Wed, 22 Apr 2026 19:52:52 GMT

Show changes

BioMicroCenter:Pricing

Slevine — Wed, 22 Apr 2026 14:01:39 GMT

Show changes

MIT:Pricing

Slevine — Tue, 21 Apr 2026 13:02:37 GMT

@@ Line 10: / Line 10: @@
 |-
 ! NOVASEQ SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT
 |-
 | NovaSeqX 10B 150PE <br> Lane^^ || $1,850.00 || $2,000.00

BioMicroCenter:PacBio Library Preparation

Asoberan — Tue, 21 Apr 2026 01:49:36 GMT

Redirect to consolidated BioMicroCenter:LongRead page

← Older revision		Revision as of 01:49, 21 April 2026
Line 1:		Line 1:
	~~{{BioMicroCenter}}~~		#REDIRECT [[BioMicroCenter:LongRead]]
	~~<br><br>~~
	Pacific Biosciences offers a broad variety of methodologies for preparing libraries for sequencing with a primary library prep kit called SMRTBell Prep Kit v3.0. Pricing includes quality control prior to prep.
	~~Large batches will be undertaken on a custom basis; please email biomicro@mit.edu for more information.~~

	~~== dsDNA: Prep Kit v3.0 ==~~
	{\|
	~~\|- style="vertical-align: top;"~~
	~~\|style="width: 350px;"\|~~
	~~{\| class="wikitable" border=1~~
	~~!Parameter~~
	~~!Requirements~~
	\|-
	~~\|INPUT \|\| Clean double-stranded DNA <BR> 150 ng-5 ug <BR> unsheared 50-60 kbp <br> >10uL~~
	\|-
	~~\|INCLUDED \|\| Initial QC by UV-vis and FemtoPulse <BR> Library preparation <BR> Final QC by Qubit~~
	\|-
	~~\|SUBMISSION \|\| MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863&tab=services ilabs] <BR> External - [[BioMicroCenter:Forms\|form]]~~
	\|-
	~~\|UNIT \|\| Per sample~~
	\|-
	~~\|PRICING \|\|~~[[BioMicroCenter:~~Pricing#LONG_READ_LIBRARIES\|LINK]]~~
	\|}
	\|
	~~===Standard Workflow===~~
	The BioMicro Center uses the SMRTBell Prep Kit v3.0 for dsDNA library preparation. This kit is recommended by PacBio for all libraries to be sequenced on the Revio. Single strand overhangs are removed, and DNA Damage repair is performed. End-Repair and A-tailing proceed before SMRTBell A/T Ligation, after which two rounds of SPRI cleans with PacBio approved beads clean the prepared library. Prepared libraries can be quantified via Qubit prior to polymerase binding. If a size selection is necessary, the size will be verified by Fragment Analyzer or by Femto Pulse for sizes larger than 6 kbp.
	~~\|[[IMAGE:PacBioBound.jpg\|500px\|center\|PacBio Library with Enzyme bound to SMRTBell hairpins<br>NOT TO SCALE~~]]
	\|}

	~~== Genomic ==~~
	Typically, a good extraction of genomic DNA that has been stored appropriately should have fragment sizes larger than 100 kbp, even for bacteria. If sizes are smaller, it is likely that the DNA has been sheared somehow. If the average size is determined to be 50-60 kbp, the standard workflow is followed. If the average size is larger than 50-60kbp, the center has Covaris gTubes available for shearing to give a length slightly higher than 40 kbp. For larger average read lengths, other shearing methods can be explored on a case by case basis. After shearing and a potential size selection, the standard workflow proceeds.
	~~<br><br>~~

	~~== IsoSeq ==~~
	The standard IsoSeq protocol uses polyA RNA as input. cDNA template is generated with the NEBNext® Single Cell/Low Input cDNA Synthesis and Amplification Module along with Template Switch Oligo from the PacBio Iso-Seq Express Oligo kit. Template is amplified with the NEBNext® High-Fidelity 2X PCR Master Mix and Forward PCR primer from the PacBio Iso-Seq Express Oligo kit. Enriching for longer transcripts requires longer elongation times for amplification. The normal protocol is then followed.

BioMicroCenter:PacBio

Asoberan — Tue, 21 Apr 2026 01:49:35 GMT

Redirect to consolidated BioMicroCenter:LongRead page

← Older revision		Revision as of 01:49, 21 April 2026
Line 1:		Line 1:
	~~{{BioMicroCenter}}~~		#REDIRECT [[BioMicroCenter:LongRead]]

	~~== PACBIO REVIO==~~
	{\|
	~~\|- style="vertical-align: top;"~~
	~~\|style="width: 400px;"\|~~
	~~{\| class="wikitable" border=1~~
	!
	~~!REVIO SEQUENCING~~
	\|-
	~~\|CHEMISTRY <BR> FLOWCELL~~
	~~\| [https://www.pacb.com/revio/ PacBio Revio] <BR> 10 M wells loaded by poissonian distribution~~
	\|-
	~~\|INPUT \|\| Completed SMRTbell Libraries~~
	* 12uL
	* >1nM
	~~''1nM ~ 0.65ng/ ul/ kb insert''~~
	\|-
	~~\|INCLUDED SERVICES \|\|~~
	* Sample QC on [[BioMicroCenter:QC#AATI_FEMTO_PULSE\|FemtoPulse]]
	* Sequencing
	* Primary analysis
	* Data storage for 1y
	\|-
	~~\|ADDITIONAL SERVICES \|\|~~
	*[[BioMicroCenter:PacBio_Library_Preparation\|PacBio Library Prep]]
	*[[BioMicroCenter:PippinPrep\|Pippin Prep]]
	\|-
	~~\|PRICING \|\| [[BioMicroCenter:Pricing~~#~~PACBIO_SEQUENCING\|LINK]]~~
	\|-
	~~\|SUBMISSION \|\| MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=9912 ilabs] <BR> External -~~ [[BioMicroCenter:~~Forms\|form]]~~
	\|-
	~~\|PROVIDED WITH \|\|~~
	~~Local academic cores~~
	\|}
	\|
	~~[[Image:sequel.jpeg\|right]]~~
	\|}

	~~== [http://www.pacb.com/products/smrt-technology/ HOW SINGLE MOLECULE SEQUENCING WORKS ]==~~
	The Revio works by detecting DNA replication in real time. Fluors are attached to the gamma-phosphate of the nucleotides. Ideally, a PacBio library with a single polymerase is loaded into each well. When a fluorescent nucleotide enters the active site, it can be detected by the sequencer. Basepaired nucleotides have a longer dwell time allowing them to be detected. <BR><BR>
	The Revio is able to monitor ~10 M incorporations occurring simultaneously on a SMRTcell. Each run creates a “movie” of the incorporation of bases, collecting data on the intensity of each fluorophore in each well over time. On board computation converts this movie into basecall files. <BR><br>

	~~[[IMAGE:CCS-demo.jpg\|thumb\|left\|400px\|Diagram of CCS analysis]]~~

	Using an analysis mode called Circular Consensus Sequencing, high fidelity (HiFi) subreads can be assembled when libraries are sequenced end to end in rolling fashion multiple times. In CCS, a 2 kbp amplicon can easily be sequenced over 10 times end to end over the course of a 24 hr movie. Rare lengths of 175 kbp have been seen, but it is more typical to see read lengths 50-70 kbp: the longest reads are typically outliers since the average subread length is typically <50 kbp.

	~~<!-- Commented out related to Sequel~~
	~~== EXPECTED RESULTS ==~~
	~~TYPICAL RESULTS FROM SMRTCELLS:~~
	* 20kb fragments – 50,000 active sites – 400Mbp sequence
	* 2kb fragments – 80,000 active sites – 500Mbp sequence

	~~Typical Read Lengths~~
	~~{\|border=1 align="left"~~
	\|-
	~~!Genomic!!Amplicon (<2 kb)~~
	\|-
	\|[[IMAGE:PacBioSequelTypicalv2.jpg\|thumb\|left\|400px\|Genomic DNA prepared with Template Kit 1.0 and BluePippin on Sequel 2.1 Chemistry]]\|\|[[IMAGE:PacBioSequelTypicalv2-amp.jpg\|thumb\|left\|400px\|PCR Amplicon prepared with Express Template Kit 2.0 on Sequel 3.0 Chemistry]]
	\|-
	~~\|Longest Inserts of around 60 kbp in CLR\|\|Shorter Inserts mean higher Quality Scores in CCS~~
	\|}
	~~<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br> -->~~

	~~== APPLICATIONS ==~~
	~~There are several applications for which PacBio sequencing are well suited (and many it is not!). The major ones are below:~~
	~~=== [http://www.pacb.com/applications/denovo/ DE NOVO ASSEMBLY / LARGE SCALE MAPPING~~] ~~===~~
	Assembly is the biggest strength of PacBio. While the individual base error rate is quite high (~14%), the errors are random and so resequencing rapidly lowers the error rate. Using only PacBio reads, 60x coverage can give very good assembly – typically completing genomes in 1 shot . A 4 Mbp genome can be done on a single SMRT cell. <BR><BR>
	A second strategy is to use PacBio reads to supplement short reads and join scaffolds. Here, standard short reads make up the bulk of the assembly but the separate scaffolds can be spanned by PacBio reads. 7x reads has been the convention for this type of sequencing. 400 Mbp of genomic DNA can be done on a single SMRT cell. Indexing cannot be done easily with PacBio samples - particularly long reads - and so the 'quanta' for SMRTcells should be considered as up to three genomes per SMRTcell.

	~~=== [http://www.pacb.com/applications/target/index.html AMPLICON / RESEQUENCING] ===~~
	~~PacBio reads can also be used to looks for variants in specific regions. The long reads allow for better detection of large rearrangements and understanding repetitive regions of the genome. <BR><BR>~~
	The use of long reads in assembly can also establish phasing of mutations. Short reads will typically not be able to span multiple mutations on a single read. PacBio reads are long enough to enable detection of multiple mutations as coming from the same strand. <BR><BR>
	~~Indexing is possible with resequencing amplicons but indexes should be added during PCR and not during library preparation.~~

	~~=== [https://www.pacb.com/applications/rna-sequencing/ WHOLE TRANSCRIPT] ===~~
	Unlike short read RNAseq, which requires fragmenting of the RNA, full length cDNAs can be sequenced on the PacBio Sequel. This allows direct detection of different splice isoforms. The low number of reads makes using this as a counting method challenging.

	~~=== [http://www.pacb.com/applications/base_modification/index.html BACTERIAL BASE MODIFICATION~~] ~~===~~
	One aspect that makes PacBio sequencing unique is its ability to recognize chemical modifications of bases. Because the instrument works by measuring the time a nucleotide is in the active site, it has an axis of “time”. Basepairing modified bases has different kinetics which allows the sequencer to provide a likelihood score that any given base has been modified. Methylcytosine, Hydroxymethylcytosine, 6-methyl adenosine and many others have been detected utilizing this kinetics mode.

BioMicroCenter:NanoPore Library Prep

Asoberan — Tue, 21 Apr 2026 01:49:35 GMT

Redirect to consolidated BioMicroCenter:LongRead page

← Older revision		Revision as of 01:49, 21 April 2026
Line 1:		Line 1:
	~~{{BioMicroCenter}}~~		#REDIRECT [[BioMicroCenter:LongRead]]
	~~<br><br>~~
	~~Oxford Nanopore Technologies offers a broad variety of methodologies for preparing libraries for sequencing. Pricing includes quality control prior to prep.~~
	~~Large batches will be undertaken on a custom basis; please email biomicro@mit.edu for more information.~~
	~~{\| border=1~~
	~~! Summary~~
	~~! Method~~
	~~! Input~~
	\|-
	~~\| LSK114~~
	~~\| Ligation-based~~
	~~\| 1 ug dsDNA~~
	\|-
	~~\| RBK114~~
	~~\|Tagmentation-based~~
	~~\| 400 ng dsDNA~~
	\|-
	~~\| RNA004~~
	~~\|Ligation-based~~
	~~\| 500 ng polyA+ mRNA (not totalRNA)~~
	\|}
	~~<BR><BR>~~

	~~== dsDNA: SQK-LSK114 ==~~
	{\|
	~~\|- style="vertical-align: top;"~~
	~~\|style="width: 350px;"\|~~
	~~{\| class="wikitable" border=1~~
	~~!Parameter~~
	~~!Requirements~~
	\|-
	~~\|INPUT \|\| Clean double-stranded DNA <BR> 1000 ng+ <BR> >10uL~~
	\|-
	~~\|INCLUDED \|\| Initial QC by UV-vis measurement <BR> Library preparation <BR> Final QC by Qubit~~
	\|-
	~~\|SUBMISSION \|\| MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863&tab=services ilabs] <BR> External - [[BioMicroCenter:Forms\|form]]~~
	\|-
	~~\|UNIT \|\| Per sample~~
	\|-
	~~\|PRICING \|\|[[BioMicroCenter:Pricing#LONG_READ_LIBRARIES\|LINK]]~~
	\|}
	\|
	The BioMicro Center utilizes the SQK-LSK114 kit for most dsDNA library preparation. This kit requires 1 ug of dsDNA and can accommodate a variety of fragment sizes. The enzymes are purchased directly from New England Biolabs or Kapa/Roche. DNA fragments are repaired, A-tailed and ligated to adapters. The ligated products are size-selected using SPRI beads. Prepared libraries can be quantified by Qubit prior to loading. SQK-NBD114 is an extension of this kit which allows for ligation of barcodes prior to pooling and Nanopore adaptor ligation of the pool for sequencing.
	~~<br>~~
	\|}

	~~== dsDNA: SQK-RBK114 ==~~
	{\|
	~~\|- style="vertical-align: top;"~~
	~~\|style="width: 350px;"\|~~
	~~{\| class="wikitable" border=1~~
	~~!Parameter~~
	~~!Requirements~~
	\|-
	~~\|INPUT \|\| Clean double-stranded DNA <BR> 400 ng+ <BR> >30 kbp <br> >10uL~~
	\|-
	~~\|INCLUDED \|\| Initial QC by UV-vis and FemtoPulse <BR> Library preparation <BR> Final QC by Qubit~~
	\|-
	~~\|SUBMISSION \|\| MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863&tab=services ilabs] <BR> External - [[BioMicroCenter:Forms\|form]]~~
	\|-
	~~\|UNIT \|\| Per sample~~
	\|-
	~~\|PRICING \|\|[[BioMicroCenter:Pricing~~#~~LONG_READ_LIBRARIES\|LINK]]~~
	\|}
	\|
	The BioMicro Center utilizes the SQK-RBK114 kit for tagmentation-based library preparation for dsDNA of large size distributions. Oxford recommends sizes greater than 30 kbp with input of at least 400 ng. The enzymes are bought directly from New England Biolabs. Input is tagmented with adapters and the products are size selected using SPRI beads. Prepared library will be quantified by Qubit prior to loading.
	~~<br><br>~~
	This kit can also be used when users are interested in obtaining the longest reads possible. For this protocol, micrograms of clean genomic DNA must be used. No size selection is performed. The PromethION P2S has sequenced reads with lengths of 300 kbp+: however, these long reads are rare outliers and the overall read amount for the flowcell in use will be lowered. Higher Molecular Weight DNA seems to kill the nanopores faster and requires a large amount of computing power from the sequencer, reducing the real time speed of basecalling and delaying data delivery.
	\|}

	~~== RNA: SQK-RNA004 ==~~
	{\|
	~~\|- style="vertical-align: top;"~~
	~~\|style="width: 350px;"\|~~
	~~{\| class="wikitable" border=1~~
	~~!Parameter~~
	~~!Requirements~~
	\|-
	~~\|INPUT \|\| Clean mRNA <BR> 500 ng+ <br> >10uL~~
	\|-
	~~\|INCLUDED \|\| Initial QC by UV-vis and Fragment Analyzer <BR> Library preparation <BR> Final QC by Qubit~~
	\|-
	~~\|SUBMISSION \|\| MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863&tab=services ilabs] <BR> External -~~ [[BioMicroCenter:~~Forms\|form]]~~
	\|-
	~~\|UNIT \|\| Per sample~~
	\|-
	~~\|PRICING \|\|[[BioMicroCenter:Pricing#LONG_READ_LIBRARIES\|LINK~~]]
	\|}
	\|
	The BioMicro Center utilizes the SQK-RNA004 kit for library preparation with RNA. The enzymes are purchased directly from New England Biolabs. The typical workflow uses first strand synthesis to create a site for ligation--this step can be omitted if necessary, but significantly reduces read amount. Input is ligated with adapters and the products are size selected using SPRI beads. Prepared library can be quantified by Qubit prior to loading.
	~~<br><br>~~
	~~SPRI bead cleans, poly-T bead selection, gel separation and other methods can be added to further select the population of RNA prior to library preparation and sequencing.~~
	\|}

BioMicroCenter:Oxford Nanopore Technologies

Asoberan — Tue, 21 Apr 2026 01:49:34 GMT

Redirect to consolidated BioMicroCenter:LongRead page

← Older revision		Revision as of 01:49, 21 April 2026
Line 1:		Line 1:
	~~{{BioMicroCenter}}~~		#REDIRECT [[BioMicroCenter:LongRead]]
	~~<br><br>~~
	The MIT BioMicro Center has two PromethION P2 Solos, each capable of running two concurrent flowcells. The Center supports all current standard ONT library prep protocols including both ligation and tagmentation methods as well as direct RNA measurement. Run protocols such as adaptive sampling are available. Each flowcell is run to completion and not reused - prices are for full flowcells.
	~~<br><br>~~
	~~==Oxford Nanopore Sequencing==~~
	{\|
	~~\|- style="vertical-align: top;"~~
	~~\|style="width: 300px;"\|~~
	~~{\| class="wikitable" border=1~~
	~~!Service~~
	~~!Nanopore Sequencing~~
	\|-
	~~\|INPUT \|\| Nanopore libraries~~
	\|-
	~~\|MIN CONCENTRATION \|\| Dependent on library type, read count not guaranteed~~
	\|-
	~~\|INCLUDED SERVICES~~
	\|
	* Quality Control:UV-vis measurement
	* Nanopore Sequencing
	* Demultiplexing
	\|-
	~~\|ADDITIONAL SERVICES \|\|~~
	* Quality Control
	* [[BioMicroCenter:NanoPore_Library_Prep\|Nanopore library preparation]]
	* Modified basecalling available on request
	* Reference FASTA genome and BED regions file required for adaptive sampling
	\|-
	~~\|DATA FORMATS~~
	\|
	*FASTQ (stored 90 d and archived)
	*FAST5 (stored 30 d and deleted)
	*Assorted Nanopore QC documents
	\|-
	~~\|PRICING \|\| [[BioMicroCenter:Pricing~~#~~LONG_READ_LIBRARIES\|NANOPORE LIBRARIES]] and~~ [[BioMicroCenter:~~Pricing#LONG_READ_SEQUENCING\|NANOPORE SEQUENCING]]~~
	\|-
	~~\|SUBMISSION~~
	\|
	* MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs]
	* External - [[BioMicroCenter:Forms\|form]]
	\|-
	\|}
	\|
	A variety of preparation kits allow DNA or direct RNA to be sequenced. The input amount necessary for each type of sample varies according to the desired result. For the longest reads of genomic DNA, micrograms worth of clean starting material provide the highest quality of data, but not the highest amounts of reads.
	~~<br><br>~~
	Nanopore library contains adaptor with both motor protein and tether. If tether interacts with a nanopore successfully, the motor protein will shift the molecule into and through the protein nanopore. The voltage set across the nanopore shifts as base pairs move through the pore. Nanopores are arranged in an array such that multiple molecules can be sequenced simultaneously. Sequencing and demultiplexing all occur in real time providing fast5 and/or fastq.
	~~<br><br>~~
	~~Contaminants known to cause issues for the nanopores even at low amounts include:~~
	*EDTA
	*Alcohols (EtOH, iPrOH
	*High concentrations of salts (NaCl, guanidinium chloride,guanidinium isothiocyanate
	*phenol
	~~<br><br>~~
	Modified basecalling is available on request. Not all desired basecalled modifications are possible in a single sequencing run with the current chemistries and basecalling software, but trace data (fast5) can be taken and re-basecalled using different basecallers. Re-basecalling can be done as a separate bioinformatic project.
	~~<br><br>~~
	For adaptive sampling, the user must provide at least a FASTA genome file and, optionally a BED file with the region(s) of interest. It is important that for both enrichment and depletion such region(s) only entail 0.1-10% of expected reads
	\|
	~~[[Image:Nanopore.jpg\|300px\|middle\|Ji, CM et al (2024). Viruses, 16(5), 798.]] <br><br>~~
	~~[[Image:Spanreads.jpg\|200px\|middle\|Page Lab assembled ultra long read gDNA data showing a long read spanning Illumina contigs]] <br><br>~~
	~~[[Image:IGV_vimentin.jpg\|300px\|middle\|IGV spanning the Vimentin gene with assembled amplified cDNA]]~~
	\|}

	~~==Oxford Nanopore Sequencer==~~
	~~{\| class="wikitable" border=1~~
	~~!width=100\| SPEC~~
	~~!width=250\| PromethiON P2 Solo~~
	\|-
	~~\|'''SEQUENCER'''~~
	~~\|[[Image:PromethION.jpg\|center\|200px~~]]~~© Oxford Nanopore Technologies~~
	\|-
	~~\| '''AVG OUTPUT/FLOWCELL'''<BR>~~
	~~\| 50 Gb (highly variable)~~
	\|-
	~~\|'''MAX TIME/FLOWCELL'''~~
	~~\| 3 days (adjustable)~~
	\|}

BioMicroCenter:Oxford Nanopore

Asoberan — Tue, 21 Apr 2026 01:49:33 GMT

Redirect to consolidated BioMicroCenter:LongRead page

← Older revision		Revision as of 01:49, 21 April 2026
Line 1:		Line 1:
	Oxford Nanopore sequencing is still a new technology in the core but we are developing expertise that may be useful to researchers on campus. ONT MinION and PromethION runs are done on a custom basis only.		#REDIRECT [[BioMicroCenter:LongRead]]

	~~Contaminants known to cause issues on the Nanopores so far include~~: ~~EDTA, ethanol, isopropanol, NaCl, guanidinium chloride, guanidinium isothiocyanate, and phenol~~

	~~Please email biomicro@mit.edu if you are interested in using the nanopore platform.~~

BioMicroCenter:LongRead

Asoberan — Tue, 21 Apr 2026 01:49:33 GMT

Create consolidated long read sequencing page (ONT PromethION, PacBio Revio)

New page

{{BioMicroCenter}}

The MIT BioMicro Center offers long-read sequencing on two platforms: Oxford Nanopore Technologies PromethION P2 Solo and PacBio Revio. Both platforms excel at applications where read length matters — de novo assembly, structural variant detection, full-length isoform sequencing, and epigenetic base modification — but differ significantly in chemistry, accuracy profile, throughput, and library requirements.

<div style="background:#f8f9fa; border:1px solid #ccc; padding:12px 16px; margin:12px 0;">
'''Choosing a platform?''' Jump to [[#PLATFORM_COMPARISON|platform comparison]] below, or contact [mailto:biomicro@mit.edu biomicro@mit.edu].
</div>

== OVERVIEW ==

{| class="wikitable" style="width:100%; text-align:center;"
|-
! style="width:18%; background:#dce8f5;" | PLATFORM
! style="width:22%; background:#dce8f5;" | OUTPUT / FLOWCELL
! style="width:20%; background:#dce8f5;" | TYPICAL READ LENGTH
! style="width:20%; background:#dce8f5;" | AVAILABILITY
|-
| [[Image:PromethION.jpg|center|120px]] '''PromethION P2 Solo'''
| ~50–150 Gb (up to 290 Gb theoretical max)
| Variable; N50 typically 10–50 kb Ultra-long reads >100 kb possible
| In-house; MIT and external users
|-
| [[Image:Sequel.jpeg|center|120px]] '''PacBio Revio'''
| ~80 Gb HiFi per SMRTcell
| HiFi: typically 8-16kb kb 
| style="font-size:90%; color:#555;" | Via collaboration with nearby academic cores.
|}

== SEQUENCING PLATFORMS ==



== Oxford Nanopore Technologies ==


The BioMicro Center operates two [https://nanoporetech.com/products/sequence/promethion-2-solo PromethION P2 Solo] instruments from [https://nanoporetech.com Oxford Nanopore Technologies], each capable of running two flowcells concurrently. Nanopore sequencing passes DNA or RNA through a protein pore under voltage; current fluctuations as bases traverse the pore are decoded in real time into sequence and base modification calls. Unlike optical platforms, there is no theoretical read-length limit — the BMC has seen reads exceeding 300 kbp. The platform natively detects base modifications (methylation, hydroxymethylation, and others) without bisulfite conversion or additional chemistry. BMC runs each flowcell is run to completion and not reused.

=== PromethION P2 Solo — Sequencing ===

{|
|- style="vertical-align:top;"
| style="width:370px;" |
{| class="wikitable" border=1
! Service
! Nanopore Sequencing
|-
| INPUT || Completed Nanopore libraries
|-
| MIN CONCENTRATION || Library-type dependent; read count not guaranteed
|-
| INCLUDED SERVICES
|
* Quality Control: UV-vis measurement
* Nanopore Sequencing
* Demultiplexing
* Modified basecalling available on request
* Adaptive sampling (FASTA + optional BED file required)
|-
| ADDITIONAL SERVICES ||
* [[BioMicroCenter:NanoPore_Library_Prep|Nanopore library preparation]]
|-
| DATA FORMATS
|
* FASTQ (stored 90 days, then archived)
* FAST5 / POD5 (stored 30 days, then deleted)
* Assorted Nanopore QC
|-
| PRICING || [[MIT:Pricing]] · [[BioMicroCenter:Pricing]]
|-
| SUBMISSION
|
* MIT – [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 iLabs]
* External – [[BioMicroCenter:Forms|form]]
|-
|}
|

'''Typical output:''' ~50 Gb for standard genomic DNA (sheared and size-selected); up to ~150 Gb for metagenomic or short-fragment libraries; theoretical maximum ~290 Gb per flowcell. Output is highly variable and depends on library quality and input DNA integrity. Read count is not guaranteed. 

'''Run duration:''' Up to 72 hours per flowcell (adjustable). Adaptive sampling and real-time basecalling occur during the run. 

'''Modified basecalling:''' Native DNA or RNA sequencing captures base modification information (5mC, 5hmC, 6mA, and others) without additional sample preparation. Not all modifications can be called in a single run with current chemistry; trace data (FAST5/POD5) can be re-basecalled with different models. Re-basecalling can be arranged as a separate bioinformatics project. 

'''Adaptive sampling:''' Enriches or depletes specific genomic regions in real time without physical selection steps. Users must supply at least a FASTA reference genome and optionally a BED file of target regions. Target regions should represent 0.1–10% of expected reads for enrichment or depletion to be effective. 

'''Contaminants:''' The following are known to damage or inhibit nanopores even at low concentrations and must be removed prior to submission:
* EDTA
* Alcohols (ethanol, isopropanol)
* High concentrations of salts (NaCl, guanidinium chloride, guanidinium isothiocyanate)
* Phenol
|}

=== PromethION Library Preparation ===

The BioMicro Center supports three standard library preparation kits for Nanopore sequencing.

{| class="wikitable" style="width:100%; text-align:left;"
|-
! style="background:#dce8f5; width:15%;" | Kit
! style="background:#dce8f5; width:20%;" | Method
! style="background:#dce8f5; width:65%;" | Details
|-
| '''LSK114''' (SQK-LSK114)
| Ligation-based dsDNA
|
* '''Input:''' 1 µg clean dsDNA, >10 µL (50-100fmol)
* '''QC:''' UV-vis measurement; Final QC by Qubit
* '''Best for:''' Standard genomic DNA, flexible fragment sizes
* End repair → A-tail → adapter ligation → SPRI size selection
* Barcoding extension (SQK-NBD114) available for multiplexing up to 96 samples
|-
| '''RBK114''' (SQK-RBK114)
| Tagmentation-based dsDNA
|
* '''Input:''' 400 ng clean dsDNA, >30 kbp preferred, >10 µL
* '''QC:''' UV-vis and FemtoPulse; Final QC by Qubit
* '''Best for:''' Ultra-long read applications; largest fragment sizes
* Tagmentation with adapters
* For ultra-long reads: microgram input, no size selection; reads >300 kbp observed but rare; overall yield is lower.
|-
| '''RNA004''' (SQK-RNA004)
| Direct RNA sequencing
|
* '''Input:''' 1ug total RNA or 350 ng clean polyA+ mRNA (not total RNA), >10 µL
* '''QC:''' UV-vis and Fragment Analyzer; Final QC by Qubit
* '''Best for:''' Full-length transcript sequencing, isoform detection, RNA base modifications
* First-strand cDNA synthesis (optional but improves yield) → adapter ligation
|}



== PacBio ==


PacBio Revio sequencing is available through BMC's collaboration with local academic core facilities. The Revio uses [https://www.pacb.com/technology/hifi-sequencing/ HiFi (CCS) sequencing]: a single SMRTbell library molecule is sequenced multiple times end-to-end in a rolling fashion, and the resulting subreads are assembled into a high-fidelity consensus read with very high accuracy. This error correction is built into the sequencing run itself — unlike Nanopore, which achieves high accuracy through consensus polishing after sequencing. Library preparation is performed at the BMC; sequencing is performed at a partner core.

=== Revio — Sequencing ===

{|
|- style="vertical-align:top;"
| style="width:370px;" |
{| class="wikitable" border=1
! Service
! Revio Sequencing
|-
| INPUT || Completed SMRTbell libraries
|-
| MIN VOLUME || 12 µL
|-
| MIN CONCENTRATION || >1 nM ''(1 nM ≈ 0.65 ng/µL/kb insert)''
|-
| INCLUDED SERVICES
|
* Sample QC on [[BioMicroCenter:QC#AATI_FEMTO_PULSE|FemtoPulse]]
* Sequencing
* Primary analysis (CCS/HiFi)
* Data storage for 1 year
|-
| ADDITIONAL SERVICES ||
* [[BioMicroCenter:PacBio_Library_Preparation|PacBio library preparation]]
* [[BioMicroCenter:PippinPrep|Pippin Prep]] for size selection
|-
| PRICING || [[MIT:Pricing]] · [[BioMicroCenter:Pricing]]
|-
| SUBMISSION
|
* MIT – [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=9912 iLabs]
* External – [[BioMicroCenter:Forms|form]]
|-
| PROVIDED THROUGH || Local academic core collaboration
|-
|}
|

'''How it works:''' The Revio loads ~10 M SMRTbell molecules into an array of zero-mode waveguides (ZMWs) by Poissonian distribution. Fluorescently labeled nucleotides are incorporated by a single polymerase tethered in each ZMW; incorporation events are detected in real time. Because the SMRTbell is circular, the polymerase reads the same molecule multiple times, generating subreads that are collapsed into a HiFi read with >>Q20 accuracy. Typical HiFi read lengths are 10–20 kb. 

'''Output:''' ~80 Gb HiFi per SMRTcell. 

'''Base modifications:''' Because the Revio measures polymerase kinetics (dwell time per base), it can detect base modifications that alter incorporation kinetics — including bacterial methylation (6mA, 4mC) and mammalian 5mC in CpG context. CpG methylation calling is included in standard HiFi analysis.
|}

=== Revio — Library Preparation ===

PacBio library preparation is performed at the BioMicro Center using the SMRTbell Prep Kit v3.0. Pricing includes quality control prior to prep.

{| class="wikitable" style="width:100%; text-align:left;"
|-
! style="background:#dce8f5; width:15%;" | Application
! style="background:#dce8f5; width:20%;" | Method
! style="background:#dce8f5; width:65%;" | Details
|-
| '''Genomic DNA'''
| SMRTbell Prep Kit v3.0
|
* '''Input:''' 150 ng–5 µg clean dsDNA, unsheared preferred at 50–60 kbp, >10 µL
* '''QC:''' UV-vis and FemtoPulse; Final QC by Qubit
* Single-strand overhang removal → damage repair → end repair → A-tailing → SMRTbell A/T ligation → two rounds of SPRI clean
* If average fragment size >50–60 kbp, Covaris gTube shearing available to target ~8-12 kbp
* Size selection verified by Fragment Analyzer or FemtoPulse
|}

== PLATFORM COMPARISON ==


{| class="wikitable" style="width:100%; text-align:center;"
|-
! style="background:#dce8f5;" | SPEC
! style="background:#e6f4ea;" | ONT PromethION P2
! style="background:#e8f0fe;" | PacBio Revio
|-
| '''Sequencing principle'''
| Ionic current through protein nanopore
| Real-time fluorescent SBS (ZMW array)
|-
| '''Read accuracy'''
| Raw reads: ~Q20; consensus polished: >Q30 (99.9%)
| HiFi reads: ~Q40 on-instrument; no post-run polishing required
|-
| '''Typical read length'''
| N50: 10–50 kb for standard gDNA; ultra-long reads >100 kb achievable
| HiFi: 10-20 kb typical
|-
| '''Output / flowcell'''
| 50–150 Gb typical (290 Gb theoretical max)
| ~80 Gb HiFi per SMRTcell
|-
| '''Run duration'''
| Up to 72 hours (adjustable)
| ~24 hours
|-
| '''Native base modification'''
| Yes — broad (5mC, 5hmC, 6mA, and more) no additional prep required
| Yes — kinetics-based (6mA, 4mC, 5mC CpG) included in standard HiFi analysis
|-
| '''Direct RNA sequencing'''
| Yes (SQK-RNA004)
| No
|-
| '''Adaptive sampling'''
| Yes — real-time enrichment/depletion
| No
|-
| '''Multiplexing'''
| Up to 96 barcodes/flowcell (NBD114)
| Limited — indexing practical mainly for amplicons
|-
| '''Instrument link'''
| [https://nanoporetech.com/products/sequence/promethion-2-solo PromethION P2 Solo]
| [https://www.pacb.com/revio/ PacBio Revio]
|}

=== Strengths and best use cases ===

'''Choose ONT PromethION when:'''
* Ultra-long reads are needed (>50 kb, e.g. spanning repeats or structural variants)
* Native base modification profiling beyond CpG (6mA, 5hmC, etc.)
* Direct RNA sequencing without cDNA conversion
* Adaptive sampling / real-time target enrichment or depletion
* High multiplexing (up to 96 samples/flowcell)
* Rapid turnaround is needed (real-time data during run)

'''Choose PacBio Revio when:'''
* High single-read accuracy is required without post-run polishing
* Full-length isoform sequencing (IsoSeq) with highly accurate reads
* De novo assembly of moderate-complexity genomes with accurate long reads
* CpG methylation calling is needed alongside variant calling

== FAQ ==

=== Can I get my base modification data? ===
Yes for both platforms. ONT detects a broad range of modifications natively; modified basecalling is available on request and can be applied to archived FAST5/POD5 data. PacBio CpG methylation calling is included in standard HiFi primary analysis.

=== What is adaptive sampling and do I need to do anything special? ===
Adaptive sampling is an ONT-only feature that uses the sequencer to eject molecules in real time based on a reference sequence, enriching or depleting specific genomic regions without physical library manipulation. To use it, provide at least a FASTA reference genome (and optionally a BED file of target regions) at submission. Target regions should represent 0.1–10% of expected reads.

=== What contaminants should I avoid for ONT? ===
EDTA, alcohols (ethanol, isopropanol), high-salt buffers (NaCl, guanidinium chloride, guanidinium isothiocyanate), and phenol will damage nanopores even at low concentrations and must be removed before submitting libraries. Contact [mailto:biomicro@mit.edu biomicro@mit.edu] if you are unsure about your elution buffer.

== SUBMISSION ==

All sequencing and library prep is submitted through [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 iLabs] (MIT users) or via the [[BioMicroCenter:Forms|external submission form]]. Contact [mailto:biomicro@mit.edu biomicro@mit.edu] before submitting non-standard samples or to discuss project design.

BioMicroCenter

Slevine — Tue, 21 Apr 2026 00:53:58 GMT

← Older revision		Revision as of 00:53, 21 April 2026
Line 63:		Line 63:
	{\|		{\|
	\|width="10%" align="left"\|<BIG><B> [[BioMicroCenter:Sequencing\|Sequencing Technologies]] </B></BIG>		\|width="10%" align="left"\|<BIG><B> [[BioMicroCenter:Sequencing\|Sequencing Technologies]] </B></BIG>
	* High Yield (>1b reads) ~~<small>~~		* [[BioMicroCenter:ShortRead\|Short Read]]
	**[[BioMicroCenter:~~Illumina_Sequencing\|~~Illumina NovaSeqX (25b,10b)]]†~~</small>~~		** High Yield (>1b reads): Illumina NovaSeqX (25b,10b)†
	* Mid Yield (250m-1b reads) ~~<small>~~		** Mid Yield (250m-1b reads): Element AVITI24
	**[[BioMicroCenter:~~Element Sequencing\|~~Element AVITI24~~]] </small>~~		** Low Yield (1m-150m reads): SingularG4, Illumina MiSeq i100
	* Low Yield (1m-150m reads) ~~<small>~~
	**[[BioMicroCenter:~~Singular Sequencing\|~~SingularG4]]
	**[[BioMicroCenter:Illumina_Sequencing\|Illumina MiSeq i100~~]]</small>~~
	* Long Read (1kb+) <small>		* Long Read (1kb+) <small>
	**[[BioMicroCenter:Oxford Nanopore Technologies\|ONT PromethION]]		**[[BioMicroCenter:Oxford Nanopore Technologies\|ONT PromethION]]

BioMicroCenter:Sequencing

Asoberan — Tue, 21 Apr 2026 00:52:02 GMT

Redirect to consolidated BioMicroCenter:ShortRead page

← Older revision		Revision as of 00:52, 21 April 2026
Line 1:		Line 1:
	~~{{BioMicroCenter}}~~		#REDIRECT [[BioMicroCenter:ShortRead]]

	~~== SHORT READ SEQUENCING ==~~
	Short read sequencing is performed on a lane-by-lane basis for a specific number of reads or entire flowcells. This enables us to support a very broad spectrum of [[BioMicroCenter:Illumina_Library_Preparation\|Short Read Library]] types as well as handle custom sequencing applications. As a general rule we do not combine projects or provide fractions of lanes.

	~~=== [[BioMicroCenter:Illumina_Sequencing\|ILLUMINA]] ===~~
	The [[BioMicroCenter\|BioMicro Center]] provides limited support for [[BioMicroCenter:Illumina_Sequencing\|Illumina sequencing]] with broader support for competitors. The Center has one MiSeq i100 and access to various NovaSeq X+ units. We support a wide variety of applications, such as ChIP-Seq, miRNA sequencing and RNA-seq. Each lane can potentially accommodate dozens of indexed samples (depending on sequence complexity and desired coverage). Read lengths vary, depending on users, between 20nt and 325nt per end.

	~~=== [[BioMicroCenter:Singular_Sequencing\|SINGULAR GENOMICS]] ===~~
	The [[BioMicroCenter\|BioMicro Center]] provides support for sequencing on the Singular G4. This short read sequencer uses four color sequencing-by-synthesis chemistry on a patterned flowcell. Critically, the G4 allows addressable lanes at very competitive [[BioMicroCenter:Pricing\|pricing]].

	~~=== [[BioMicroCenter:Element_Sequencing\|ELEMENT BIOSCIENCES]] ===~~
	The [[BioMicroCenter\|BioMicro Center]] provides support for the Element AVITI24, which utilizes both standard avidity sequencing on a random flowcell and direct in situ sequencing with Teton Cytoprofiling.

	~~== LONG READ SEQUENCING / [[BioMicroCenter:PacBio\|PACBIO]] and [[BioMicroCenter:Oxford_Nanopore_Technologies\|OXFORD NANOPORE]] ==~~

	~~=== PACIFIC BIOSCIENCES ===~~
	~~Pacific BioSciences sequencing is provided through outsourcing to sister facilities on the Revio platform. Libraries are produced by the Center.~~

	~~===[[BioMicroCenter:Oxford Nanopore Technologies\|OXFORD NANOPORE]]===~~
	~~ONT based sequencing is provided through two Oxford Nanopore PromethION P2 Solos.~~

	~~Beyond the sequencers, the [[BioMicroCenter\|BioMicro Center]] has additional tools that are critical to long read sequencing. These include an [[BioMicroCenter:QC~~#~~AATI_FEMTO_PULSE\|AATI FemtoPulse]] and a~~ [[BioMicroCenter:~~PippinPrep\|Sage BluePippin.~~]~~] <BR><BR>~~

	~~== SANGER SEQUENCING ==~~
	The MIT BioMicro Center does not support Sanger sequencing. Many third party providers exist for this method. For those who prefer to utilize core facilities instead of commercial providers, Sanger sequencing is available through the [https://dnaseq.med.harvard.edu/SeqServices.html DF/HCC DNA Resource at the Dana-Farber Cancer Institute]

BioMicroCenter:Singular Sequencing

Asoberan — Tue, 21 Apr 2026 00:52:01 GMT

Redirect to consolidated BioMicroCenter:ShortRead page

← Older revision		Revision as of 00:52, 21 April 2026
Line 1:		Line 1:
	~~== Singular Sequencing ==~~		#REDIRECT [[BioMicroCenter:ShortRead]]
	The Center currently hosts a G4 platform by [https://singulargenomics.com/\| Singular Genomics]. Singular’s G4 platform is a short-read mid-throughput sequencing platform delivering adequate sequencing data through its proprietary sequencing-by-synthesis chemistry at a significantly competitive price point.
	{\|
	~~\| valign="top" \|~~
	~~{\| class="wikitable" border=1~~
	~~!width=150\| Service~~
	~~!width=300\| Singular Sequencing~~
	\|-
	~~\|INPUT \|\| Singular libraries~~
	\|-
	~~\|MIN VOLUME \|\| 12 uL~~
	\|-
	~~\|MIN CONCENTRATION \|\| 4 nM~~
	\|-
	~~\|INCLUDED SERVICES~~
	\|
	* Quality Control:Fragment Analyzer and qPCR
	* Singular Sequencing
	* Demultiplexing
	\|-
	~~\|ADDITIONAL SERVICES \|\|~~
	* Quality Control
	* Singular library preparation
	\|-
	~~\|DATA FORMATS~~
	\|
	*FASTQ (stored 1 year)
	\|-
	~~\|QUALITY CONTROL~~
	\|
	* [https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ FASTQC]
	* Basic run metrics (alignment rate, complexity)
	* Basic RNAseq metrics (where applicable)
	* Basic paired end metrics (where applicable)
	* Contamination checks
	\|-
	~~\|PRICING \|\|~~ [[BioMicroCenter:~~Pricing#SINGULAR_G4\|LINK]]~~
	\|-
	~~\|SUBMISSION~~
	\|
	* MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs]
	\|-
	\|}
	~~\| valign="top" \|~~

	~~=== ANCHORS ===~~
	~~Singular requires S1/S2 anchors in place of Illumina P5/P7 anchors. These can be replaced 1:1 in most oligo designs:~~
	*s1:ACAAAGGCAGCCACGCACTCCTTCCCTGT
	*s2:CTCCAGCGAGATGACCCTCACCAACCACT

	~~=== INDEXING ===~~
	~~Singular indexes are read from the Anchor sequences in all cases and custom primers for indexes are not allowed. <BR>~~
	~~Indexes are read from the S1 primer first (index1) followed by S2 (index2) <BR>~~
	~~Index reads are the SAME SEQUENCE as ordered in most classical library preps. <BR>~~
	~~Indexes are REQUIRED and should be 8 nucleotides in all lane by lane sequencing.~~
	*Min custom primer submission: 20 µL at 100 µM

	~~===LANE BY LANE===~~
	*Must be 50 or 150 paired-end dual indexed
	*Pool must be compatible with TruSeq, Nextera, TruSeq, smRNA and Solexa sequencing primers

	~~=== MINIMUM READS ===~~
	*the BMC has performed quality control.
	* No custom primers.
	*submitted libraries are at least 2 nM.

	~~All other requests, including use of custom sequencing primers require a full flowcell. Illumina libraries which have been converted in the Center will also require a full flowcell.~~



	\|}

	{\|
	\|
	~~== The G4 Platform ==~~
	~~{\| class="wikitable" border=1~~
	~~!width=100\| SPEC~~
	~~!width=250\| G4~~
	\|-
	~~\|'''SEQUENCER'''\|\|[[Image:2023_Singular_G4.jpg\|center\|200px]]~~
	\|-
	~~\| '''READS/LANE'''<BR> Low number is minimum per lane for standard libraries\|\|~~
	* F3 per Lane: 50-100 M
	\|-
	~~\|'''RUN TIME'''\|\|~~
	* 50 PE 11 hours
	* 150 PE 24 hours
	\|-
	~~\|'''KITS AVAILABLE'''\|\|~~
	* 100nt
	* 300nt
	\|-
	~~\|'''KEY NOTES'''\|\|~~
	* 4-color chemistry
	* Patterned flow cell
	* 4-lanes per flow cell
	* 4-flow cells per run
	* Anchor replacement or anchor expansion of Illumina libraries
	\|-
	~~\|'''THANKS TO'''\|\|~~
	* Singular Genomics
	\|}
	~~\| valign='top' \|~~
	{\|
	~~! INDEX HOPPING~~
	~~! ACCURACY~~
	\|-
	\|
	~~[[IMAGE:IndexhopF3.jpeg\|left\|250px\|Index hopping for a standard set of Singular libraries~~]]
	\|
	~~[[IMAGE:PPPPF3.jpeg\|right\|200px\|Percent Perfect Plot for Singular libraries 150PE]]~~
	\|-
	~~\| Index hopping on Singular runs is on par with GAIIx and HiSeq. High levels of index hopping as observed on Illumina X-AMP chemistry is not observed.~~
	~~\| Percent perfect plot for phiX on current Singular chemistry ([https://pmc.ncbi.nlm.nih.gov/articles/pmid/27672352/ Manley et al., 2016])~~
	\|}
	\|}

BioMicroCenter:Element Sequencing

Asoberan — Tue, 21 Apr 2026 00:52:00 GMT

Redirect to consolidated BioMicroCenter:ShortRead page

← Older revision		Revision as of 00:52, 21 April 2026
Line 1:		Line 1:
	~~== Element Sequencing ==~~		#REDIRECT [[BioMicroCenter:ShortRead]]
	~~The Center currently hosts an AVITI24 platform from [https://www.elementbiosciences.com/ Element Biosciences].~~
	~~AVITI24 platform supports both sequencing and cytoprofiling. For most sequencing needs, the Center will use Element's Freestyle chemistry kits.~~
	{\|
	\|
	~~{\| class="wikitable" border=1~~
	~~!width=100\|Service~~
	~~!width=250\|Element Sequencing~~
	\|-
	~~\|SUBMISSION \|\| Illumina OR Element libraries~~
	\|-
	~~\|MIN VOLUME \|\| 15 uL~~
	\|-
	~~\|MIN CONCENTRATION \|\| 2 nM~~
	\|-
	~~\|INCLUDED SERVICES~~
	\|
	* Quality Control:Fragment Analyzer and qPCR
	* Element Sequencing
	* Demultiplexing
	\|-
	~~\|ADDITIONAL SERVICES \|\|~~
	* Quality Control
	* Element library preperation
	\|-
	~~\|DATA FORMATS~~
	\|
	*FASTQ (stored 1 year)
	\|-
	~~\|QUALITY CONTROL~~
	\|
	* [https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ FASTQC]
	* Basic run metrics (alignment rate, complexity)
	* Basic RNAseq metrics (where applicable)
	* Basic paired end metrics (where applicable)
	* Contamination checks
	\|-
	~~\|PRICING \|\|~~ [[BioMicroCenter:~~Pricing#SINGULAR_G4\|LINK~~]]
	\|-
	~~\|SUBMISSION~~
	\|
	* MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs]
	\|-
	\|}
	~~\| valign='top' \|~~
	{\|
	~~=== ANCHORS ===~~
	Element supports both Illumina anchors (P5/P7) using 'Freestyle' chemistry and and Element Anchors (SP5/SP27) for 'Adept' chemistry. For runs in the BMC, P5/P7 anchored library (Illumina) are preferred. Element Adept libraries (SP5/SP27) require a 5'-phosphate on the forward end in order to circularize and sequence. <BR><BR>
	~~=== INDEXING ===~~
	Compared to an Illumina platform, AVITI24 reads are similar in read direction to Illumina's Forward Strand workflow for Dual Indexed Libraries. Indexes are read from antisense primers to the forward and reverse reads with the P7 side read first (index 1). Indexes are therefore antisense to the ordered oligos in traditional chemistry. Index sequences should be provided AS READ and not as ordered. <BR>
	* Custom primer submission: 70 uL at 100 uM for Read 1, all other reads require 40 uL at 100 uM.
	* Custom primers must be compatible with TruSeq, Nextera, TruSeq, smRNA and Element sequencing primers
	~~===SINGLE LANE ===~~
	~~Each lane of the AVITI24 can be loaded independently. Flowcells require both lanes to be filled to be run.~~
	~~Custom primers must be designed to not interfere with other user's samples.~~
	~~All other requests require a full flowcell. 300PE kits only have a single lane.~~

	~~=== MINIMUM READS ===~~
	~~Minimum reads per lane are guaranteed if:~~
	*the BMC has performed quality control,
	*the samples have high diversity, especially within the first 5 bases of read 1, and
	*submitted libraries are at least 2 nM.

	\|}
	\|}

	~~== The AVITI24 Platform ==~~
	~~{\| class="wikitable" border=1~~
	~~!width=100\|~~
	~~!width=250\| AVITI24~~
	~~!width=150\| NOTES~~
	\|-
	~~\|'''SEQUENCER'''\|\|[[Image:Element_AVITI.jpg\|center\|200px]]\|\|~~
	\|-
	~~\| '''READS/FLOWCELL'''<BR> Low number is minimum per lane for standard P5/P7 libraries.\|\|~~
	* 250M HQ read pairs (150 for PE300)
	\|-
	~~\|'''RUN TIME'''\|\|~~
	* 75 PE 24 hours
	* 150 PE 38 hours
	* 300 PE 60 hours
	\|-
	~~\|'''KITS AVAILABLE'''\|\|~~
	* 2x75 Cloudbreak FS High
	* 2x150 Cloudbreak FS High
	* 2x300 Cloudbreak FS High
	~~\|\| - Single end supported <br> - each kit comes with 34 additional cycles~~
	\|-
	~~\|'''KEY NOTES'''\|\|~~
	* 4-color chemistry
	* Random flow cell
	* 2-lanes per flow cell (1 for 300PE)
	* Q40+ > 80%
	* Low-binding surface chemistry
	\|-
	~~\|'''THANKS TO'''\|\|~~
	* Element Biosciences / Scott Ritterbush
	\|}


	The AVITI24 can run 2 flow cells per run, each hosting 2 independently-addressable lanes. Both lanes are washed with the same reagents. Element currently offers kits with 150 and 300 cycles, both supporting 2 lanes, as well as a 600 cycle kit that supports a single lane. Index hopping rates are similar to non-patterned Illumina, limiting the need for UDI's. The AVITI24 can also perform direct in sample sequencing which includes spatial imaging of RNA, proteins, phospho-proteins, and cell morphology using [https://www.elementbiosciences.com/products/aviti24/cytoprofiling/ Teton chemistry] for cytoprofiling.


	~~<!-- hidden~~
	~~== Cytoprofiling with AVITI24 ==~~

	~~[[Image:DISS_example.jpg\|thumb\|right\|200px\|Example of Teton imaging from Element Biosciences website]]~~

	A user can optimize the assay before attempting a Teton Run. This test will require an optimization kit. Optimization is similar to creating a slide for a Teton run. The standard steps of coating (or not) that slide, loading and culturing cells prior to fixing are all similar. Instead of running the optimization slide on the AVITI24, the optimization slide should be inspected with a fluorescence objective. This process requires a separate kit from the actual slide kits.

	~~[[Image:OptimizationSlide.jpg\|thumb\|middle\|Lamason Lab Slide provided from Element Biosciences]]~~

	Users can pick up a 1- or 12-well Teton Slide kit from the Center. Currently, Poly-L-Lysine-coated and uncoated slide kits are available. Uncoated slides must be coated as laid out in the protocol and users should ensure that cell fixation is ideal for one of the possible coatings which are not PLL (currently: Collagen, Fibronectin, Gelatin, Laminin, Matrigel). Cells are loaded and cultured for the desired amount of time on coated slides. Cells are fixed and the Teton Slide may be stored at 2-8C for up to 30 days or may be run immediately on the AVITI24.

	For a Teton Run, cells are washed in the appropriate Cell Paint reagents for a fixed panel or custom panel cytoprofiling assay. A single Teton slide can be used to infer Morphology, RNA within the cells, Protein and also direct in situ sequencing up to 100nt which is not robust enough for transcriptomics, but is sufficient for investigating CRISPR or TCR or other short sequences of interest.

	~~-->~~

BioMicroCenter:Illumina Sequencing

Asoberan — Tue, 21 Apr 2026 00:51:59 GMT

Redirect to consolidated BioMicroCenter:ShortRead page

Show changes

BioMicroCenter:ShortRead

Asoberan — Tue, 21 Apr 2026 00:00:00 GMT

Revise platform detail sections: add manufacturer intros, run times, custom oligo requirements, external links

← Older revision		Revision as of 00:00, 21 April 2026
Line 54:		Line 54:
	== Illumina ==		== Illumina ==
	<span id="ILLUMINA"></span>		<span id="ILLUMINA"></span>

			The BioMicro Center operates the [https://www.illumina.com/systems/sequencing-platforms/miseq-i100.html MiSeq i100] and provides access to [https://www.illumina.com/systems/sequencing-platforms/novaseq-x-plus.html NovaSeqX Plus] through collaboration with nearby academic core facilities. Both instruments use Illumina's two-color XLEAP-SBS chemistry (G bases are inferred from signal absence) and are best suited to high-complexity libraries. UDIs are strongly recommended on both platforms.

	=== NovaSeqX Plus ===		=== NovaSeqX Plus ===
Line 61:		Line 63:
	* See [[MIT:Pricing\|Pricing]] for rates.		* See [[MIT:Pricing\|Pricing]] for rates.
	* Full flowcells (8 lanes, 10B or 25B) have priority over individual lanes; wait times for single lanes can vary.		* Full flowcells (8 lanes, 10B or 25B) have priority over individual lanes; wait times for single lanes can vary.
			* Minimum 2 nM; 110 µL per lane.
			* Custom sequencing primers: at least 30 µL at 100 µM of each primer type per flowcell. Contact [mailto:biomicro@mit.edu biomicro@mit.edu] before planning a custom library prep.

	=== MiSeq i100 ===		=== MiSeq i100 ===
Line 98:		Line 102:
	\|		\|

	The MiSeq i100 uses ~~Illumina's~~ XLEAP-SBS chemistry on a patterned (CMOS nanowell) flowcell~~. It~~ is the BMC's walkup-capable instrument, ~~suited to~~ amplicon panels, 16S rRNA surveys, validation runs, and applications ~~requiring long reads (up to 1000 nt)~~.		The MiSeq i100 uses XLEAP-SBS chemistry on a patterned (CMOS nanowell) flowcell and is the BMC's walkup-capable instrument. It supports the longest read lengths of any instrument in the center (up to 1000 nt), making it ideal for amplicon panels, 16S rRNA surveys, validation runs, and other applications where read length matters more than throughput.

	'''Kits available:''' 100 nt (25M, 100M), 300 nt (5M, 25M, 100M), 600 nt (5M, 25M, 50M), 1000 nt (25M).<BR><BR>		'''Kits available:''' 100 nt (25M, 100M), 300 nt (5M, 25M, 100M), 600 nt (5M, 25M, 50M), 1000 nt (25M). Run times range from under 4 hours (25M 100 nt) to ~24 hours (100M 300 nt).<BR><BR>

	'''Walkup service''' is not available to external users. Runs must be scheduled in the [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar].		'''Walkup service''' is not available to external users. Runs must be scheduled in the [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar]. Server training and storage access on BMC servers is required.<BR><BR>

			'''Custom sequencing primers:''' At least 15 µL of each primer type at 100 µM must be provided per flowcell. Contact [mailto:biomicro@mit.edu biomicro@mit.edu] before planning a custom library prep.

	'''Thanks to:''' MIT VPR, Drs. Gene Li, Michael Birnbaum, Dept. of Biology, Scott Ritterbush '89 SM '92		'''Thanks to:''' MIT VPR, Drs. Gene Li, Michael Birnbaum, Dept. of Biology, Scott Ritterbush '89 SM '92
Line 129:		Line 135:
	\|}		\|}

	See [[MIT:Pricing]] · [[BioMicroCenter:Pricing]] for kit pricing.		See [[MIT:Pricing]] · [[BioMicroCenter:Pricing]] for kit pricing. Custom sequencing primers follow the same submission guidelines as the MiSeq i100: at least 15 µL at 100 µM per primer type.

	<!-- Donor information for MiSeq classic is not recorded in current source pages. Please update if known. -->		<!-- Donor information for MiSeq classic is not recorded in current source pages. Please update if known. -->
Line 137:		Line 143:
	== Element Biosciences ==		== Element Biosciences ==
	<span id="ELEMENT"></span>		<span id="ELEMENT"></span>

			The BioMicro Center operates an [https://www.elementbiosciences.com/products/aviti24 AVITI24] from Element Biosciences. The AVITI24 uses Element's proprietary [https://www.elementbiosciences.com/resources/avidity-sequencing Avidity Base Chemistry (ABC)], a 4-color sequencing approach that achieves high base-call accuracy (>80% of reads Q40+) by leveraging multivalent binding of avidites rather than single-nucleotide incorporation. The random flowcell and rolling-circle amplification approach produce low levels of index hopping and optical duplicates compared to patterned-flowcell instruments. Beyond standard NGS, the AVITI24 supports [https://www.elementbiosciences.com/products/aviti24/cytoprofiling Teton CytoProfiling] for direct in-cell co-detection of RNA, protein, and morphology — see [[BioMicroCenter:Spatial\|Spatial Services]] for details.

	=== AVITI24 ===		=== AVITI24 ===
Line 183:		Line 191:
	\|}		\|}
	\|		\|
	~~=== ANCHORS ===~~
	Element supports both Illumina anchors (P5/P7) using Freestyle chemistry and Element anchors (SP5/SP27) for Adept chemistry. For standard runs at the BMC, P5/P7-anchored (Illumina) libraries are preferred. Element Adept libraries (SP5/SP27) require a 5′-phosphate on the forward end to circularize.<BR><BR>

	~~=== INDEXING ===~~		'''Kits and run times:'''
	~~Compared to Illumina, AVITI24 read direction is similar to Illumina~~'~~s Forward Strand workflow for Dual Indexed Libraries. Indexes are read from antisense primers — P7 side first (index 1). Index sequences should be provided~~ ''~~'as read~~''', ~~not as ordered.<BR>~~		* 75 PE (150 nt total): ~24 hours, ~400M reads/lane
	* ~~Custom primer submission~~: ~~70 µL at 100 µM for Read 1; all other~~ reads ~~require 40 µL at 100 µM.~~		* 150 PE (300 nt total): ~38 hours, ~400M reads/lane
			* 300 PE (600 nt total): ~60 hours, ~200M reads (single lane only)

	~~=== SINGLE LANE ===~~		Each flowcell has two independently-addressable lanes. Both lanes must be loaded to run a flowcell, but each can carry a different library pool. 300PE kits are single-lane only.<BR><BR>
	Each ~~lane of the AVITI24 can be loaded~~ independently~~; both~~ lanes must be ~~filled~~ to run a flowcell. 300PE kits ~~support only a~~ single lane. ~~Custom primers must not interfere with other users' samples. All non-standard requests require a full flowcell.~~

	~~=== MINIMUM READ GUARANTEE ===~~		'''Anchors:''' The BMC runs P5/P7-anchored (Illumina Freestyle) libraries as standard. Element Adept (SP5/SP27) libraries are also supported but require a 5′-phosphate on the forward strand for circularization — contact [mailto:biomicro@mit.edu biomicro@mit.edu] before preparing Adept libraries.<BR><BR>
	Guaranteed if: (a) BMC performed QC, (b) library diversity is high (especially in the first 5 bases of Read 1), and (c) concentration ≥ 2 nM.
			'''Indexing:''' Index orientation differs from standard Illumina: indexes are read from antisense primers with the P7-side first (index 1). Provide index sequences '''as read''' on the instrument, not as ordered. For dual-indexed libraries this is typically antisense to the ordered oligo sequence.<BR><BR>

			'''Custom primers:''' 70 µL at 100 µM for Read 1; 40 µL at 100 µM for all other reads. Custom primers must not interfere with other users' samples in the same lane.<BR><BR>

			'''Minimum read guarantee:''' Guaranteed if (a) BMC performed QC, (b) library diversity is high especially in the first 5 bases of Read 1, and (c) concentration ≥ 2 nM.

	'''Thanks to:''' Element Biosciences; Scott Ritterbush		'''Thanks to:''' Element Biosciences; Scott Ritterbush
Line 203:		Line 214:
	== Singular Genomics ==		== Singular Genomics ==
	<span id="SINGULAR"></span>		<span id="SINGULAR"></span>

			The BioMicro Center operates a [https://www.singulargenomics.com G4] from Singular Genomics. The G4 uses a 4-color SBS chemistry on a patterned flowcell and delivers index-hopping rates comparable to non-patterned Illumina instruments (HiSeq/GAIIx level) — substantially lower than X-Amp patterned flowcells. This makes it a practical choice for experiments that do not require UDIs. The G4 supports four independently-addressable lanes per flowcell and up to four flowcells per run, offering per-lane flexibility at competitive per-lane cost.

	=== G4 ===		=== G4 ===
Line 249:		Line 262:
	\|}		\|}
	\|		\|
	~~=== LIBRARY SUBMISSION ===~~
	~~Submit standard Illumina (P5/P7) libraries. The BMC will convert the pool to S1/S2 anchors by PCR prior to sequencing — do '''not''' submit S1/S2-anchored libraries directly.<BR><BR>~~

	~~=== INDEXING ===~~		'''Kits and run times:'''
	~~Indexes are read from~~ the S1/S2 ~~anchor sequences after~~ conversion~~. Index 1 is~~ read from S1, index 2 ~~from S2. Index sequences are~~ the '''same orientation''' as ordered in classical Illumina library preps. Dual ~~indexes (~~8 nt) are required for all lane-by-lane sequencing. Custom index primers are not permitted.		* 50 PE (100 nt total): ~11 hours, ~100M reads/lane
			* 150 PE (300 nt total): ~24 hours, ~100M reads/lane

			'''Library submission:''' Submit standard Illumina (P5/P7) libraries. The BMC converts the pool to S1/S2 anchors by PCR prior to sequencing — do '''not''' submit S1/S2-anchored libraries directly.<BR><BR>

			'''Indexing:''' After conversion, indexes are read from S1 (index 1) then S2 (index 2), in the '''same orientation''' as ordered in classical Illumina library preps. Dual 8-nt indexes are required for all lane-by-lane sequencing. Custom index primers are not permitted.<BR><BR>

	~~=== LANE BY LANE ===~~		'''Lane by lane:'''
	* Must be 50 PE or 150 PE dual-indexed.		* Must be 50 PE or 150 PE dual-indexed.
	* Pool must be compatible with TruSeq, Nextera, smRNA, or Solexa sequencing primers.		* Pool must be compatible with TruSeq, Nextera, smRNA, or Solexa sequencing primers.
	* 4 lanes per flowcell; up to 4 flowcells per run.		* 4 lanes per flowcell; up to 4 flowcells per run.

	~~=== MINIMUM READ GUARANTEE ===~~		'''Minimum read guarantee:''' Guaranteed if (a) BMC performed QC, (b) no custom primers, and (c) concentration ≥ 4 nM.
	Guaranteed if: (a) BMC performed QC, (b) no custom primers, and (c) concentration ≥ 4 nM.

	'''Thanks to:''' Singular Genomics		'''Thanks to:''' Singular Genomics

BioMicroCenter:ShortRead

Slevine — Mon, 20 Apr 2026 23:54:21 GMT

PLATFORM COMPARISON

← Older revision		Revision as of 23:54, 20 April 2026
(5 intermediate revisions by the same user not shown)
Line 42:		Line 42:
	\|-		\|-
	\| <!-- no image yet: replace with [[Image:filename.ext\|center\|120px]] --> <br> '''MiSeq classic'''		\| <!-- no image yet: replace with [[Image:filename.ext\|center\|120px]] --> <br> '''MiSeq classic'''
	\| 5M – 25M reads/flowcell		\| 1M – 25M reads/flowcell
	\| 40 µL at 2 nM		\| 40 µL at 2 nM
	\|-		\|-
Line 57:		Line 57:
	=== NovaSeqX Plus ===		=== NovaSeqX Plus ===

	NovaSeqX Plus sequencing is available through BMC's collaboration with local academic core facilities, and is well suited to projects requiring the deepest coverage or largest sample counts.		NovaSeqX Plus sequencing is available through BMC's collaboration with local academic core facilities, and is well suited to projects requiring the deepest coverage or largest sample counts. It is only available for MIT users. These collaborations provide advantaged pricing to MIT users.

	* Contact [mailto:biomicro@mit.edu biomicro@mit.edu] to request access and discuss flowcell sharing.		* See [[MIT:Pricing\|Pricing]] for rates.
	* See [[MIT:Pricing~~]] or [[BioMicroCenter:~~Pricing]] for ~~current lane and flowcell pricing~~.
	* Full flowcells (8 lanes, 10B or 25B) have priority over individual lanes; wait times for single lanes can vary.		* Full flowcells (8 lanes, 10B or 25B) have priority over individual lanes; wait times for single lanes can vary.
	* Minimum 2 nM concentration; 110 µL per lane. BMC QC required for read guarantees.

	=== MiSeq i100 ===		=== MiSeq i100 ===
Line 111:		Line 109:
	=== MiSeq classic ===		=== MiSeq classic ===

	The MiSeq classic uses 4-color SBS chemistry on a non-patterned (random cluster) flowcell. It is available for users with established protocols on v2/v3 chemistry~~, but is off contract and will be retired upon instrument failure~~.		The MiSeq classic uses 4-color SBS chemistry on a non-patterned (random cluster) flowcell. It is available for users with established protocols on v2/v3 chemistry. We maintain minimal reagent stocks so turn around times may vary.

	{\| class="wikitable" border=1		{\| class="wikitable" border=1
Line 118:		Line 116:
	! Notes		! Notes
	\|-		\|-
	\| 70 nt (V2) \|\| ~5M \|\| 30 or 70 SE		\| 70 nt (V2) \|\| ~15M \|\| 30 or 70 SE
	\|-		\|-
	\| 150 nt (V3) \|\| ~5M \|\| 75 PE		\| 150 nt (V3) \|\| ~25M \|\| 75 PE
	\|-		\|-
	\| 300 nt (V2) \|\| ~5M \|\| 150 PE		\| 300 nt (V2) \|\| ~15M \|\| 150 PE
	\|-		\|-
	\| 500 nt (V2) \|\| ~~~10M~~ \|\| 250 PE		\| 500 nt (V2) \|\| ~15M \|\| 250 PE
	\|-		\|-
	\| 600 nt (V3) \|\| ~~~15M~~ \|\| 300 PE		\| 600 nt (V3) \|\| ~25M \|\| 300 PE
	\|-		\|-
	\| 500 nt NANO \|\| ~1M \|\| Reduced output run		\| 500 nt NANO \|\| ~1M \|\| Reduced output run
Line 292:		Line 290:
	\| Patterned		\| Patterned
	\| Patterned (CMOS nanowell)		\| Patterned (CMOS nanowell)
	\| ~~Non-patterned (random cluster)~~		\| Random
	\|-		\|-
	\| '''Chemistry'''		\| '''Chemistry'''
Line 346:		Line 344:
	== FAQ ==		== FAQ ==
	<span id="FAQ"></span>		<span id="FAQ"></span>

	~~=== How do I choose the right platform? ===~~
	~~Start with your '''read count requirement''' and '''library type''':~~
	* '''Millions of reads or fewer''' → MiSeq i100 (amplicons, long reads up to 1000 nt) or Singular G4 (most cost-effective for standard 50/150 PE).
	* '''Hundreds of millions of reads''' → Element AVITI24 (lane-by-lane flexibility, low index hopping, tolerates low-complexity libraries).
	* '''Billions of reads''' → NovaSeqX Plus (contact BMC to coordinate flowcell sharing).

	~~=== Can I use my existing Illumina libraries? ===~~
	* '''AVITI24''' – Yes. P5/P7 libraries run natively using Freestyle chemistry.
	* '''MiSeq i100 / classic''' – Yes. Standard Illumina libraries run natively.
	* '''Singular G4''' – Yes. Submit standard P5/P7 libraries; the BMC converts the pool to S1/S2 anchors by PCR. Do not submit S1/S2 libraries directly.
	* '''NovaSeqX Plus''' – Yes. Standard Illumina libraries run natively.

	~~=== What are the minimum submission requirements? ===~~
	* AVITI24: 15 µL at 2 nM
	* MiSeq i100 / classic: 40 µL at 2 nM
	* Singular G4: 12 µL at 4 nM
	* NovaSeqX Plus: 110 µL per lane at 2 nM (contact BMC)

	=== My library has low complexity. Which platform should I use? ===		=== My library has low complexity. Which platform should I use? ===
Line 374:		Line 354:
	* '''Singular G4''' – Not required; patterned but does not use X-Amp chemistry; hopping is on par with HiSeq/GAIIx.		* '''Singular G4''' – Not required; patterned but does not use X-Amp chemistry; hopping is on par with HiSeq/GAIIx.
	* '''MiSeq classic''' – Not required; non-patterned flowcell has low hopping.		* '''MiSeq classic''' – Not required; non-patterned flowcell has low hopping.

	~~=== How long until my data is delivered? ===~~
	Queue times are typically short — most samples run within a few days. Full flowcells have sequencing priority over individual lanes. Contact [mailto:biomicro@mit.edu biomicro@mit.edu] for current wait times.

	=== How long is my data stored? ===		=== How long is my data stored? ===
Line 392:		Line 369:

	All sequencing is submitted through [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 iLabs]. External users should contact [mailto:biomicro@mit.edu biomicro@mit.edu] directly. Samples must meet the minimum volume and concentration requirements listed above; coordinate with BMC staff before sending non-standard submissions.		All sequencing is submitted through [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 iLabs]. External users should contact [mailto:biomicro@mit.edu biomicro@mit.edu] directly. Samples must meet the minimum volume and concentration requirements listed above; coordinate with BMC staff before sending non-standard submissions.

	~~Additional services:~~
	* [[BioMicroCenter:Illumina_Library_Preparation\|Short read library preparation]]
	* [[BioMicroCenter:BioInformaticsStaff\|Bioinformatics support]]
	* [[BioMicroCenter:Servers\|Data storage and computation]]
	* [[BioMicroCenter:Sequencing_Quality_Control\|Sequencing quality control]]

BioMicroCenter:ShortRead

Asoberan — Mon, 20 Apr 2026 23:28:44 GMT

Create consolidated short read sequencing page (Illumina, Element, Singular)

New page

{{BioMicroCenter}}

The MIT BioMicro Center offers short-read sequencing on five platforms from three manufacturers, spanning low to high output. All sequencing includes library quality control (RT-PCR and Fragment Analyzer), demultiplexing, and FASTQ delivery. Pricing is available to MIT users at [[MIT:Pricing]] and to all users at [[BioMicroCenter:Pricing]].

<div style="background:#f8f9fa; border:1px solid #ccc; padding:12px 16px; margin:12px 0;">
'''Choosing a platform?''' Jump to [[#PLATFORM_COMPARISON|platform comparison]] and [[#FAQ|FAQ]] below, or contact [mailto:biomicro@mit.edu biomicro@mit.edu].
</div>

== OUTPUT TIERS ==

{| class="wikitable" style="width:100%; text-align:center;"
|-
! style="width:8%; background:#dce8f5;" | OUTPUT
! style="width:18%; background:#dce8f5;" | PLATFORM
! style="width:22%; background:#dce8f5;" | READS / UNIT
! style="width:20%; background:#dce8f5;" | MIN SUBMISSION
! style="width:32%; background:#dce8f5;" | TYPICAL USE
|-
| style="background:#e8f0fe; font-weight:bold; vertical-align:middle;" rowspan="2" | HIGH
| [[Image:BMC_NovaXplus.jpg|center|120px]] '''NovaSeqX Plus'''
| 1.2B reads/lane (10B FC) 3.0B reads/lane (25B FC)
| 110 µL at 2 nM per lane
| rowspan="2" style="text-align:left; font-size:92%;" | Largest experiments requiring billions of reads: cohort-scale WGS, ultra-deep sequencing, high-replicate RNA-seq studies
|-
| colspan="3" style="font-size:90%; color:#555; text-align:left; padding:4px 10px;" | ''Available through collaboration with nearby academic shared resources. Contact [mailto:biomicro@mit.edu BMC staff] to inquire.''
|-
| style="background:#e6f4ea; font-weight:bold; vertical-align:middle;" | MID
| [[Image:Element_AVITI.jpg|center|120px]] '''Element AVITI24'''
| ~400M reads/lane (~800M per 2-lane flowcell)
| 15 µL at 2 nM
| style="text-align:left; font-size:92%;" | Standard depth experiments: RNA-seq, ChIP-seq, ATAC-seq, WGS at moderate coverage; tolerates low-complexity libraries well
|-
| style="background:#fff3e0; font-weight:bold; vertical-align:middle;" rowspan="4" | LOW
| [[Image:2023_Singular_G4.jpg|center|120px]] '''Singular G4'''
| ~100M reads/lane (4 lanes/flowcell)
| 12 µL at 4 nM
| rowspan="4" style="text-align:left; font-size:92%;" | Smaller experiments, amplicons, validation, pilot studies, and applications where cost-per-lane is the primary driver
|-
| [[Image:BMC_i100.jpg|center|120px]] '''MiSeq i100'''
| 5M – 100M reads/flowcell
| 40 µL at 2 nM
|-
|  '''MiSeq classic'''
| 5M – 25M reads/flowcell
| 40 µL at 2 nM
|-
| colspan="3" style="font-size:90%; color:#555; text-align:left; padding:4px 10px;" | ''MiSeq classic is off contract and will be retired upon instrument failure. MiSeq i100 offers walkup service (MIT only, training required).''
|}

== SEQUENCING PLATFORMS ==



== Illumina ==


=== NovaSeqX Plus ===

NovaSeqX Plus sequencing is available through BMC's collaboration with local academic core facilities, and is well suited to projects requiring the deepest coverage or largest sample counts.

* Contact [mailto:biomicro@mit.edu biomicro@mit.edu] to request access and discuss flowcell sharing.
* See [[MIT:Pricing]] or [[BioMicroCenter:Pricing]] for current lane and flowcell pricing.
* Full flowcells (8 lanes, 10B or 25B) have priority over individual lanes; wait times for single lanes can vary.
* Minimum 2 nM concentration; 110 µL per lane. BMC QC required for read guarantees.

=== MiSeq i100 ===

{|
|- style="vertical-align:top;"
| style="width:370px;" |
{| class="wikitable" border=1
! Service
! MiSeq i100 Sequencing
|-
| INPUT || Illumina libraries
|-
| MIN VOLUME || 40 µL
|-
| MIN CONCENTRATION || 2 nM (~0.4 ng/µL for 300 bp library)
|-
| INCLUDED SERVICES
|
* Quality Control: Fragment Analyzer and qPCR
* Illumina Sequencing
* Demultiplexing
|-
| DATA FORMATS
|
* FASTQ
* BCL (stored 30 days)
|-
| PRICING || [[MIT:Pricing]] · [[BioMicroCenter:Pricing]]
|-
| SUBMISSION
|
* MIT (Assisted) – [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 iLabs]
* MIT (Walkup) – [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar] (training required)
|-
|}
|

The MiSeq i100 uses Illumina's XLEAP-SBS chemistry on a patterned (CMOS nanowell) flowcell. It is the BMC's walkup-capable instrument, suited to amplicon panels, 16S rRNA surveys, validation runs, and applications requiring long reads (up to 1000 nt).

'''Kits available:''' 100 nt (25M, 100M), 300 nt (5M, 25M, 100M), 600 nt (5M, 25M, 50M), 1000 nt (25M). 

'''Walkup service''' is not available to external users. Runs must be scheduled in the [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar].

'''Thanks to:''' MIT VPR, Drs. Gene Li, Michael Birnbaum, Dept. of Biology, Scott Ritterbush '89 SM '92
|}

=== MiSeq classic ===

The MiSeq classic uses 4-color SBS chemistry on a non-patterned (random cluster) flowcell. It is available for users with established protocols on v2/v3 chemistry, but is off contract and will be retired upon instrument failure.

{| class="wikitable" border=1
! Kit
! Approx. reads
! Notes
|-
| 70 nt (V2) || ~5M || 30 or 70 SE
|-
| 150 nt (V3) || ~5M || 75 PE
|-
| 300 nt (V2) || ~5M || 150 PE
|-
| 500 nt (V2) || ~10M || 250 PE
|-
| 600 nt (V3) || ~15M || 300 PE
|-
| 500 nt NANO || ~1M || Reduced output run
|}

See [[MIT:Pricing]] · [[BioMicroCenter:Pricing]] for kit pricing.





== Element Biosciences ==


=== AVITI24 ===

{|
|- style="vertical-align:top;"
| style="width:370px;" |
{| class="wikitable" border=1
! Service
! Element Sequencing
|-
| SUBMISSION || Illumina (P5/P7) libraries
|-
| MIN VOLUME || 15 µL
|-
| MIN CONCENTRATION || 2 nM
|-
| INCLUDED SERVICES
|
* Quality Control: Fragment Analyzer and qPCR
* Element Sequencing
* Demultiplexing
|-
| ADDITIONAL SERVICES ||
* Quality Control
* Element library preparation
|-
| DATA FORMATS
|
* FASTQ (stored 1 year)
|-
| QUALITY CONTROL
|
* [https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ FASTQC]
* Basic run metrics (alignment rate, complexity)
* Basic RNAseq metrics (where applicable)
* Basic paired end metrics (where applicable)
* Contamination checks
|-
| PRICING || [[MIT:Pricing]] · [[BioMicroCenter:Pricing]]
|-
| SUBMISSION
|
* MIT – [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 iLabs]
|-
|}
|
=== ANCHORS ===
Element supports both Illumina anchors (P5/P7) using Freestyle chemistry and Element anchors (SP5/SP27) for Adept chemistry. For standard runs at the BMC, P5/P7-anchored (Illumina) libraries are preferred. Element Adept libraries (SP5/SP27) require a 5′-phosphate on the forward end to circularize. 

=== INDEXING ===
Compared to Illumina, AVITI24 read direction is similar to Illumina's Forward Strand workflow for Dual Indexed Libraries. Indexes are read from antisense primers — P7 side first (index 1). Index sequences should be provided '''as read''', not as ordered. 
* Custom primer submission: 70 µL at 100 µM for Read 1; all other reads require 40 µL at 100 µM.

=== SINGLE LANE ===
Each lane of the AVITI24 can be loaded independently; both lanes must be filled to run a flowcell. 300PE kits support only a single lane. Custom primers must not interfere with other users' samples. All non-standard requests require a full flowcell.

=== MINIMUM READ GUARANTEE ===
Guaranteed if: (a) BMC performed QC, (b) library diversity is high (especially in the first 5 bases of Read 1), and (c) concentration ≥ 2 nM.

'''Thanks to:''' Element Biosciences; Scott Ritterbush
|}



== Singular Genomics ==


=== G4 ===

{|
|- style="vertical-align:top;"
| style="width:370px;" |
{| class="wikitable" border=1
! Service
! Singular G4 Sequencing
|-
| INPUT || Illumina (P5/P7) libraries
|-
| MIN VOLUME || 12 µL
|-
| MIN CONCENTRATION || 4 nM
|-
| INCLUDED SERVICES
|
* Quality Control: Fragment Analyzer and qPCR
* Pool conversion: P5/P7 → S1/S2 by PCR
* Singular Sequencing
* Demultiplexing
|-
| ADDITIONAL SERVICES ||
* Quality Control
* Singular library preparation
|-
| DATA FORMATS
|
* FASTQ (stored 1 year)
|-
| QUALITY CONTROL
|
* [https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ FASTQC]
* Basic run metrics (alignment rate, complexity)
* Basic RNAseq metrics (where applicable)
* Contamination checks
|-
| PRICING || [[MIT:Pricing]] · [[BioMicroCenter:Pricing]]
|-
| SUBMISSION
|
* MIT – [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 iLabs]
|-
|}
|
=== LIBRARY SUBMISSION ===
Submit standard Illumina (P5/P7) libraries. The BMC will convert the pool to S1/S2 anchors by PCR prior to sequencing — do '''not''' submit S1/S2-anchored libraries directly. 

=== INDEXING ===
Indexes are read from the S1/S2 anchor sequences after conversion. Index 1 is read from S1, index 2 from S2. Index sequences are the '''same orientation''' as ordered in classical Illumina library preps. Dual indexes (8 nt) are required for all lane-by-lane sequencing. Custom index primers are not permitted.

=== LANE BY LANE ===
* Must be 50 PE or 150 PE dual-indexed.
* Pool must be compatible with TruSeq, Nextera, smRNA, or Solexa sequencing primers.
* 4 lanes per flowcell; up to 4 flowcells per run.

=== MINIMUM READ GUARANTEE ===
Guaranteed if: (a) BMC performed QC, (b) no custom primers, and (c) concentration ≥ 4 nM.

'''Thanks to:''' Singular Genomics
|}

== PLATFORM COMPARISON ==


{| class="wikitable" style="width:100%; text-align:center;"
|-
! style="background:#dce8f5;" | SPEC
! style="background:#e8f0fe;" | NovaSeqX Plus
! style="background:#e6f4ea;" | Element AVITI24
! style="background:#fff3e0;" | Singular G4
! style="background:#fff3e0;" | MiSeq i100
! style="background:#fff3e0;" | MiSeq classic
|-
| '''Read lengths'''
| 100 nt, 300 nt
| 75 PE, 150 PE, 300 PE
| 50 PE, 150 PE
| 100–1000 nt
| 70–600 nt
|-
| '''Flowcell type'''
| Patterned (X-Amp)
| Random
| Patterned
| Patterned (CMOS nanowell)
| Non-patterned (random cluster)
|-
| '''Chemistry'''
| 2-color XLEAP-SBS (G=dark)
| 4-color avidity SBS
| 4-color SBS
| 2-color XLEAP-SBS (G=dark)
| 4-color SBS
|-
| '''Index hopping'''
| High — UDIs required
| Low — UDIs not needed
| Low (patterned, non-XLEAP)
| Present — UDIs recommended
| Low (non-patterned)
|-
| '''Low-complexity libraries'''
| Struggles
| Handles well
| Handles well
| Struggles
| Handles well
|-
| '''Lane flexibility'''
| Lane-by-lane (full FC priority)
| Lane-by-lane
| Lane-by-lane
| Full flowcell only
| Full flowcell only
|-
| '''Walkup'''
| No (collaboration)
| No
| No
| Yes (training required)
| No
|-
| '''Illumina lib compatible'''
| Yes (native)
| Yes (P5/P7 Freestyle)
| Yes — BMC converts pool by PCR
| Yes (native)
| Yes (native)
|-
| '''Donated / supported by'''
| Local core collaboration
| Element Biosciences; Scott Ritterbush
| Singular Genomics
| MIT VPR; Drs. Gene Li, Michael Birnbaum; Dept. of Biology; Scott Ritterbush '89 SM '92
| 
|}

== FAQ ==


=== How do I choose the right platform? ===
Start with your '''read count requirement''' and '''library type''':
* '''Millions of reads or fewer''' → MiSeq i100 (amplicons, long reads up to 1000 nt) or Singular G4 (most cost-effective for standard 50/150 PE).
* '''Hundreds of millions of reads''' → Element AVITI24 (lane-by-lane flexibility, low index hopping, tolerates low-complexity libraries).
* '''Billions of reads''' → NovaSeqX Plus (contact BMC to coordinate flowcell sharing).

=== Can I use my existing Illumina libraries? ===
* '''AVITI24''' – Yes. P5/P7 libraries run natively using Freestyle chemistry.
* '''MiSeq i100 / classic''' – Yes. Standard Illumina libraries run natively.
* '''Singular G4''' – Yes. Submit standard P5/P7 libraries; the BMC converts the pool to S1/S2 anchors by PCR. Do not submit S1/S2 libraries directly.
* '''NovaSeqX Plus''' – Yes. Standard Illumina libraries run natively.

=== What are the minimum submission requirements? ===
* AVITI24: 15 µL at 2 nM
* MiSeq i100 / classic: 40 µL at 2 nM
* Singular G4: 12 µL at 4 nM
* NovaSeqX Plus: 110 µL per lane at 2 nM (contact BMC)

=== My library has low complexity. Which platform should I use? ===
Avoid the NovaSeqX Plus and MiSeq i100 — both use 2-color XLEAP-SBS chemistry where G bases are inferred from signal absence, making low-diversity early cycles prone to run failure. The AVITI24, Singular G4, and MiSeq classic all use 4-color chemistry and handle low-complexity libraries well. Always contact [mailto:biomicro@mit.edu biomicro@mit.edu] before submitting unconventional libraries.

=== Do I need unique dual indexes (UDIs)? ===
* '''NovaSeqX Plus''' – Yes, required (patterned X-Amp flowcell).
* '''MiSeq i100''' – Recommended (patterned CMOS flowcell).
* '''AVITI24''' – Not required; index hopping is low on random flowcells.
* '''Singular G4''' – Not required; patterned but does not use X-Amp chemistry; hopping is on par with HiSeq/GAIIx.
* '''MiSeq classic''' – Not required; non-patterned flowcell has low hopping.

=== How long until my data is delivered? ===
Queue times are typically short — most samples run within a few days. Full flowcells have sequencing priority over individual lanes. Contact [mailto:biomicro@mit.edu biomicro@mit.edu] for current wait times.

=== How long is my data stored? ===
* FASTQ files: 1 year for AVITI24, Singular G4, MiSeq i100.
* BCL files (MiSeq): 30 days.
* Long-term storage is available; see [[BioMicroCenter:Pricing]] for active storage and tape archive options.

=== What quality control is included? ===
All runs include a final pool QC (RT-PCR and Fragment Analyzer) and post-sequencing QC (FastQC, run metrics, alignment rate, complexity, RNAseq metrics where applicable, contamination checks). Users who opt out of pre-sequencing QC by providing their own concentration forfeit read guarantees.

=== Can I pool samples from multiple labs? ===
Yes, but users are responsible for minimizing index cross-contamination and [https://www.illumina.com/science/education/minimizing-index-hopping.html index crosstalk]. The BMC does not combine projects within a lane.

== SUBMISSION ==

All sequencing is submitted through [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 iLabs]. External users should contact [mailto:biomicro@mit.edu biomicro@mit.edu] directly. Samples must meet the minimum volume and concentration requirements listed above; coordinate with BMC staff before sending non-standard submissions.

Additional services:
* [[BioMicroCenter:Illumina_Library_Preparation|Short read library preparation]]
* [[BioMicroCenter:BioInformaticsStaff|Bioinformatics support]]
* [[BioMicroCenter:Servers|Data storage and computation]]
* [[BioMicroCenter:Sequencing_Quality_Control|Sequencing quality control]]

BioMicroCenter:Pricing

Slevine — Mon, 20 Apr 2026 16:38:09 GMT

@@ Line 1: / Line 1: @@
 == SEQUENCING - HIGH OUTPUT ==
-Please note that samples submitted from [[BioMicroCenter:CoreDeps|'''CORE LAB'''s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.
+* not available for non-MIT users.
 == SEQUENCING - MID OUTPUT ==
@@ Line 312: / Line 268: @@
 |-
 ! 10X USAGE !! Batch Size !! [[BioMicroCenter:FAQ#NON_MIT_USERS|Ext. Non-Profit]] !! [[BioMicroCenter:FAQ#NON_MIT_USERS|Ext. For-Profit]] !! Notes
 |-
 | rowspan="2" style="vertical-align:middle; text-align:left;" | 5' RNA / 3' RNA || setup || $1,268.75 || $1,421.00 || style="text-align:left;" | charge per submission

BioMicroCenter:FAQ

Slevine — Mon, 20 Apr 2026 16:30:30 GMT

CORE LABS

← Older revision		Revision as of 16:30, 20 April 2026
Line 10:		Line 10:
	=== CORE LABS ===		=== CORE LABS ===
	The BioMicro Center is NOT an MIT institutional core, but a departmental resource. Departments that fund the operation of the BioMicro Center are given priority for all resources within the Center. Several labs that have provided major equipment donations to the BioMicro Center are also considered to be CORE. The BioMicro Center is funded by:		The BioMicro Center is NOT an MIT institutional core, but a departmental resource. Departments that fund the operation of the BioMicro Center are given priority for all resources within the Center. Several labs that have provided major equipment donations to the BioMicro Center are also considered to be CORE. The BioMicro Center is funded by:
	* The Department of Biology		* The Department of Biology (course 7)
	* The Department of ~~BioEngineering~~		* The Department of Biological Engineering (course 20)
	* The David H. Koch Institute for Integrative Cancer Research		* The David H. Koch Institute for Integrative Cancer Research

BioMicroCenter:SpTx

Asoberan — Fri, 17 Apr 2026 18:21:23 GMT

Add Singular G4X in situ spatial sequencing section (beta stub)

@@ Line 231: / Line 231: @@
 '''Service Status'''<BR>
 <div style="background:#fff8e6; border-left:4px solid #c8960c; padding:8px 12px; margin-top:8px;">This service is in '''beta'''. The instrument is operational and BMC has completed initial runs, but experimental parameters are still being validated. We welcome early users willing to work collaboratively with BMC staff to establish protocols.</div>
 |}

BioMicroCenter:Pricing

Cstjohn — Fri, 17 Apr 2026 15:41:06 GMT

10X CHROMIUM

Show changes

BioMicroCenter:Pricing

Slevine — Fri, 17 Apr 2026 13:25:04 GMT

SEQUENCING - LOW OUTPUT

← Older revision		Revision as of 13:25, 17 April 2026
(One intermediate revision by the same user not shown)
Line 31:		Line 31:
	\|-		\|-
	\| 50 PE: F3 Lane (~100M reads) \|\| $375.00 \|\| $420.00		\| 50 PE: F3 Lane (~100M reads) \|\| $375.00 \|\| $420.00
	\|-
	~~\| Rapid 300nt: F3 flowcell* \|\| $2,250.00 \|\| $2,520.00~~
	\|-		\|-
	\| 150 PE: F3 Lane (~100M reads) \|\| $562.50 \|\| $630.00		\| 150 PE: F3 Lane (~100M reads) \|\| $562.50 \|\| $630.00
Line 38:		Line 36:

	<pre>		<pre>
	* ~~Rapid~~ flowcells are required for ~~adapted Illumina~~ libraries.		* 4 lane flowcells are required for S1/S2 anchored libraries.
	</pre>		</pre>

Line 114:		Line 112:
	\| 72 hour Flowcell \|\| $1,500.00 \|\| $1,680.00 \|\| Fastq stored for 1y. Trace data stored only 30d.		\| 72 hour Flowcell \|\| $1,500.00 \|\| $1,680.00 \|\| Fastq stored for 1y. Trace data stored only 30d.
	\|}		\|}

	~~{\| class="wikitable"~~
	\|-
	~~! PACBIO REVIO SEQUENCING^^ !! [[BioMicroCenter:FAQ#NON_MIT_USERS\|Ext. Non-Profit]] !! [[BioMicroCenter:FAQ#NON_MIT_USERS\|Ext. For-Profit]] !! Notes~~
	\|-
	~~\| 72 hour Flowcell \|\| colspan="2" \| pricing in ilabs \|\| Fastq stored for 1y. Trace data stored only 30d.~~
	\|}

	~~<pre>~~
	~~^^ - through collaboration with nearby academic shared resources~~
	~~</pre>~~

	== LIBRARY GENERATION ==		== LIBRARY GENERATION ==

← Older revision		Revision as of 19:00, 24 April 2026
Line 10:		Line 10:
	* [[BioMicroCenter:Submission\|Sample Submission]]		* [[BioMicroCenter:Submission\|Sample Submission]]
	* [[BioMicroCenter:Consumables\|Consumables]]		* [[BioMicroCenter:Consumables\|Consumables]]
			* [[BioMicroCenter:Consulting\|Experimental Design]]
	\| valign="top" align="left"\|		\| valign="top" align="left"\|
	* [[BioMicroCenter:AboutBMC\|About the BioMicro Center]]		* [[BioMicroCenter:AboutBMC\|About the BioMicro Center]]

← Older revision		Revision as of 03:06, 23 April 2026
Line 13:		Line 13:
	* [[BioMicroCenter:AboutBMC\|About the BioMicro Center]]		* [[BioMicroCenter:AboutBMC\|About the BioMicro Center]]
	* [[BioMicroCenter:People\| Staff]]		* [[BioMicroCenter:People\| Staff]]
			* [[BioMicroCenter:Consulting\| Getting Started]]
	<!-- [[BioMicroCenter:Jobs\|Positions Available]] -->		<!-- [[BioMicroCenter:Jobs\|Positions Available]] -->
	* [[BioMicroCenter:FAQ\|FAQs]]		* [[BioMicroCenter:FAQ\|FAQs]]