<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
	<id>http://bmcwiki.mit.edu/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Hilo1</id>
	<title>BioMicro Center - User contributions [en]</title>
	<link rel="self" type="application/atom+xml" href="http://bmcwiki.mit.edu/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Hilo1"/>
	<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php/Special:Contributions/Hilo1"/>
	<updated>2026-09-13T15:28:44Z</updated>
	<subtitle>User contributions</subtitle>
	<generator>MediaWiki 1.43.1</generator>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:SingleCell&amp;diff=131761</id>
		<title>BioMicroCenter:SingleCell</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:SingleCell&amp;diff=131761"/>
		<updated>2026-07-28T16:50:23Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* scRNAseq / snRNAseq */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
 &lt;br /&gt;
[[File:SingleCellOptions.png|thumb|right|400px]]&lt;br /&gt;
The BioMicro Center supports a broad range of methods for single cell sequencing. The choice of method depends heavily on the type of question being asked and the source material. The methods break down into those supporting individual cells characterized in single wells and methods that use droplet isolation and library preparation. These cell requirements for each method vary significantly so reviewing each method is valuable and we strongly encourage consultation with BMC staff prior to beginning the experiment.&lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;.&lt;br /&gt;
 &lt;br /&gt;
 &lt;br /&gt;
== 10x CHROMIUM X ==&lt;br /&gt;
[[File:25_10xAssays.png|thumb|left|400px]]&lt;br /&gt;
The BioMicro Center provides access to 10x Genomics library preparation as an assisted or a walk-up service. Added in 2023, The 10x Chromium X can handle a broad variety of methodologies now including [https://www.10xgenomics.com/solutions/single-cell/ 3&#039;, 5&#039;  and fixed RNA sequencing], [https://www.10xgenomics.com/solutions/single-cell-atac/ ATAC and multiome] &amp;lt;!-- [https://www.10xgenomics.com/solutions/single-cell-cnv/ CNV]. --&amp;gt; Dropoff for assisted service is coordinated with Center staff with at least one week&#039;s lead time. Users should bring their single cell/nuclei suspension(s) in 1.5 mL microfuge tubes in the standard buffer at or around that time. Staff works with the user to intake the initial samples and proceed through the protocol with quality control checks at the appropriate steps. &lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
Chromium X usage is also offered as a walkup service. Usage may be scheduled on the iLabs calendar after training by BMC staff. This still requires at least a week&#039;s lead time before usage. You will not have permission to schedule the equipment until you have been approved by BMC staff. Reagents are stocked in the BioMicro Center and we ask that you use our reagents. This allows us to get larger bulk discounts we can pass on to our users. Please note that we do include a fraction of the instrument usage cost in the cost of the chips and will charge this cost if you use your own chips.&lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
The full 10x suite of software is installed on LURIA and is integrated into our analysis package. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
{|&lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;width: 450px;&amp;quot;|&lt;br /&gt;
=== scRNAseq / snRNAseq ===&lt;br /&gt;
&amp;lt;!-- A &amp;quot;setup&amp;quot; covers the chip, labor, and service contract. For Flex it also includes the GEMs. Samples per setup differ by assay - see Samples per setup row. --&amp;gt;&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !   &lt;br /&gt;
  ! 3&#039;RNA/5&#039;RNA &amp;lt;BR&amp;gt; (GEM-X)&lt;br /&gt;
  ! 3&#039;/5&#039; OnChipMultiplexing &amp;lt;BR&amp;gt; (OCM)&lt;br /&gt;
  ! Fixed RNA &amp;lt;BR&amp;gt; (Flex v2 / Apex)&lt;br /&gt;
  |-&lt;br /&gt;
  !INPUT &lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot;|&lt;br /&gt;
[https://www.10xgenomics.com/support/universal-three-prime-gene-expression/documentation/steps/sample-prep Freshly counted cells/nuclei in suspension.]&lt;br /&gt;
  |&lt;br /&gt;
[https://www.10xgenomics.com/support/flex-gene-expression/documentation/steps/sample-prep Fixed cells in suspension.] Also supports frozen, FFPE, fixed whole blood, and flow-sorted cells.&lt;br /&gt;
  |-&lt;br /&gt;
  !Cell Concentration &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; cells|nuclei/uL &amp;lt;/small&amp;gt;&lt;br /&gt;
  |100-2,000&lt;br /&gt;
  |100-2,000&lt;br /&gt;
  |25,000-300,000 total&lt;br /&gt;
  |-&lt;br /&gt;
  ! Fraction Recovered &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; est. percent of input cells captured &amp;lt;/small&amp;gt;&lt;br /&gt;
  | ~65%&lt;br /&gt;
  | ~60%&lt;br /&gt;
  | ~50%&lt;br /&gt;
  |-&lt;br /&gt;
  ! Target recovery &amp;lt;BR&amp;gt; &amp;lt;small&amp;gt; multiply by recovery for input &amp;lt;/small&amp;gt;&lt;br /&gt;
  | 500-20,000/lane&lt;br /&gt;
  | 500-5,000/lane &lt;br /&gt;
  | up to 20,000/sample&lt;br /&gt;
  |-&lt;br /&gt;
  ! Expected doublet rate @ Max load&lt;br /&gt;
  | 8%&lt;br /&gt;
  | 7.5%&lt;br /&gt;
  | 8% doublet @ 20k&lt;br /&gt;
  |-&lt;br /&gt;
  ! Samples per setup &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; A setup covers chip, labor, and service contract. Flex also includes GEMs. &amp;lt;/small&amp;gt;&lt;br /&gt;
  | 1-8 samples &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; 8 GEMs per chip &amp;lt;/small&amp;gt;&lt;br /&gt;
  | 1-8 samples &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; 4 lanes/batch → 2 GEMs per chip &amp;lt;/small&amp;gt;&lt;br /&gt;
  | up to ~48 samples &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; 1 GEM; ~1M cells captured; ~20k cells/index &amp;lt;/small&amp;gt;&lt;br /&gt;
  |-&lt;br /&gt;
  !ADD&#039;L AMPLICONS&lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot; |&lt;br /&gt;
Custom priming for CITEseq, CRISPRs (perturb-seq), TCR (5&#039;), BCR (5&#039;). &amp;lt;BR&amp;gt; Please provide custom oligos and protocols to core. &lt;br /&gt;
  |&lt;br /&gt;
Additional genes [https://www.10xgenomics.com/support/flex-gene-expression/documentation/steps/experimental-design-and-planning/custom-probe-design-for-visium-spatial-gene-expression-and-chromium-single-cell-gene-expression-flex require new probes.]&lt;br /&gt;
  |-&lt;br /&gt;
  ! KEY NOTES&lt;br /&gt;
  |&lt;br /&gt;
  | Batches of 4 samples&lt;br /&gt;
  | Human/Mouse only. &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; Probe-based: exogenous sequences (GFP, reporters, etc.) not captured without custom probes. &amp;lt;/small&amp;gt;&lt;br /&gt;
  |-&lt;br /&gt;
  !SUBMISSION FORMS&lt;br /&gt;
  |colspan=&amp;quot;3&amp;quot;| ASSISTED - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=12903 ilabs]  WALKUP - [https://mit.ilabsolutions.com/equipment/380963 Calendar]&lt;br /&gt;
  |-&lt;br /&gt;
  !DELIVERY &lt;br /&gt;
  |colspan=&amp;quot;3&amp;quot;| FASTQ, SAM, BAM, 10X QC, loupe file&lt;br /&gt;
  |-&lt;br /&gt;
  !DONATED BY &lt;br /&gt;
  |colspan=&amp;quot;3&amp;quot;| [http://mit.edu/manoli/ Prof. Manolis Kellis]&lt;br /&gt;
 |}&lt;br /&gt;
&lt;br /&gt;
=== CHROMATIN ===&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !   &lt;br /&gt;
  ! snATACseq&lt;br /&gt;
  ! multiome&lt;br /&gt;
  |-&lt;br /&gt;
  ! Input&lt;br /&gt;
  | colspan=2 |&lt;br /&gt;
* 160-8,000 nuclei/uL&lt;br /&gt;
* 50% estimated recovery&lt;br /&gt;
* 7.5% doublets @ 10k cells recovered&lt;br /&gt;
* 10uL minimum volume&lt;br /&gt;
 |-&lt;br /&gt;
 ! Multiplexing&lt;br /&gt;
 | colspan =2 | Not available&lt;br /&gt;
 |-&lt;br /&gt;
  !SUBMISSION FORMS&lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot;| ASSISTED - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=12903 ilabs]  WALKUP - [https://mit.ilabsolutions.com/equipment/380963 Calendar]&lt;br /&gt;
  |-&lt;br /&gt;
  !DELIVERY &lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot;| FASTQ, BAM, 10X QC, loupe file&lt;br /&gt;
 |}&lt;br /&gt;
 &lt;br /&gt;
|&lt;br /&gt;
 &lt;br /&gt;
=== 10X Genomics ===&lt;br /&gt;
[[image:10xX.jpg|thumb|right|500px|10x Chromium X]]&lt;br /&gt;
 &lt;br /&gt;
 &lt;br /&gt;
FAQs for Users &amp;lt;BR&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;1) What buffers in the final suspension are compatible with 10X applications?&#039;&#039;&#039; &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://kb.10xgenomics.com/s/article/115001937123-What-buffers-can-be-used-for-washing-and-cell-resuspension Buffers/media] for the submitted single cell/nuclei suspension should not contain excessive amounts of EDTA (&amp;gt;0.1 mM) or magnesium (&amp;gt;3 mM) and should be free of surfactants (i.e. Tween-20, SDS etc) and any RNases or DNases.&lt;br /&gt;
*1xPBS (calcium free and magnesium free) containing 0.04%  weight/volume BSA (400 µg/ml) is recommended for most general protocols and is considered the standard buffer&lt;br /&gt;
*Cell culture media with up to 1% BSA or up to 10% FBS if cells are not viable in standard buffer&lt;br /&gt;
*1xPBS (calcium free and magnesium free) containing up to 10% FBS for CMO labelling&lt;br /&gt;
*Nuclei also require addition of RNase Inhibitor along with 10X Genomics 1X nuclei buffer before chip loading, instructions for which are included in 10x user guides. If needed, users can collect buffer aliquots from the BMC after submitting a project. Please coordinate with BMC staff for pick-up. &amp;lt;br&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;2) How many cells are captured in the Assay?&#039;&#039;&#039;&lt;br /&gt;
&amp;lt;br&amp;gt;Up to 20,000 cells per GEM can be uniquely barcoded with GEM-X, but this highly depends on cell counts and viability. Dying cells will leak RNA, hence may not be captured efficiently leading to sample failures. We recommend to count cells at the BMC to avoid discrepancies, but can work with users&#039; counts as well. &amp;lt;BR&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;3) What are the best practices for flow sorting cells?&#039;&#039;&#039; &amp;lt;br&amp;gt; &lt;br /&gt;
10x provides guidance with their tested protocols about pre-sort buffer, collection buffer and FACS best practices [https://kb.10xgenomics.com/s/article/360048826911-What-are-the-best-practices-for-flow-sorting-cells-for-10x-Genomics-assays here.] &amp;lt;br&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;4) What is the expected size distribution for cDNA?&#039;&#039;&#039; &amp;lt;br&amp;gt;&lt;br /&gt;
cDNA for 3&#039; and 5&#039; libraries will span between 400 to 9000 base pairs, depending on sample type.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;5) How much sequencing per sample is recommended?&#039;&#039;&#039; &amp;lt;br&amp;gt;&lt;br /&gt;
10x makes several recommendations in their [https://www.10xgenomics.com/support/epi-atac/documentation/steps/sequencing/sequencing-handbook sequencing handbook]. Recommendation numbers vary by sample type, expected CNPs per sample, assay type and general sample quality. The higher the CNPs, the higher the quality, the more likely increased read depth is required. &amp;lt;br&amp;gt;&lt;br /&gt;
For more resources, please visit https://kb.10xgenomics.com/s/ &amp;lt;br&amp;gt;&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
 &lt;br /&gt;
== NAMOCELL SINGLE CELL SORTER ==&lt;br /&gt;
 &lt;br /&gt;
{| align=left &lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;width: 300px;&amp;quot;|&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  ! INSTRUMENT|| NAMOCELL SINGLE CELL SORTER&lt;br /&gt;
  |-&lt;br /&gt;
  | TYPE || WALKUP - MIT only &amp;lt;BR&amp;gt; FACS&lt;br /&gt;
  |-&lt;br /&gt;
  | UNIT || Per Cartridge&lt;br /&gt;
  |-&lt;br /&gt;
  | LASER WAVELENGTH	||  488 nm&lt;br /&gt;
  |-&lt;br /&gt;
  | DETECTION CHANNELS&lt;br /&gt;
  |&lt;br /&gt;
* FL1 533 nm (FITC/GFP)&lt;br /&gt;
* FL2 585 nm (PE/PI)&lt;br /&gt;
* FL3 676 nm (PerCP)&lt;br /&gt;
  |-&lt;br /&gt;
  | DISPENSE VOLUME || 1 ul&lt;br /&gt;
  |-&lt;br /&gt;
  | SAMPLE VOLUME || 100-750 ul&lt;br /&gt;
  |-&lt;br /&gt;
  | CELL INPUT || single cell mode: 100-10,000 cells &lt;br /&gt;
  |-&lt;br /&gt;
  | FORMAT || 96w/384w&lt;br /&gt;
  |-&lt;br /&gt;
  | SIGNUP || [https://mit.ilabsolutions.com/equipment/show/370751/?tab=schedule ILABS]&lt;br /&gt;
  |-&lt;br /&gt;
  | NEW USERS ||  New users should request training by emailing biomicro@mit.edu&lt;br /&gt;
  |-&lt;br /&gt;
  | DONATED BY || Prof Linda Griffith&lt;br /&gt;
 |}&lt;br /&gt;
 |&lt;br /&gt;
[[image:Namo.jpg|thumb|right|Namo (Namocell) Bio-Techne]]&lt;br /&gt;
The [https://www.bio-techne.com/brands/namocell Namocell Single Cell Sorter] allows users to sort cells into plates. The sorter uses microfluidics to sort single cells in 1uL of sheath fluid into a well. The instrument uses disposable cartridges to minimize contamination. The instrument integrates well with the [[BioMicroCenter:Tecan_Freedom_Evo#SPT_LABTECH_MOSQUITO_HV|SPT Labtech Mosquito HV]] which handles small reaction volumes. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
|} &lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;.&lt;br /&gt;
 &lt;br /&gt;
&amp;lt;!-- AVITI24 high-output DISS (whole transcriptome single cell) section pending - not yet released --&amp;gt;&lt;br /&gt;
 &lt;br /&gt;
&amp;lt;!-- commenting out Seq-Well &lt;br /&gt;
== SEQ-WELL ==&lt;br /&gt;
{|&lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;width: 300px;&amp;quot;|&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !   &lt;br /&gt;
  !SEQ-WELL &lt;br /&gt;
  |-&lt;br /&gt;
  |INPUT&lt;br /&gt;
  |&lt;br /&gt;
* FULL PREP: &amp;lt;BR&amp;gt;50,000 single free cells. 90% viability&lt;br /&gt;
* EXO1 and AMP &amp;lt;BR&amp;gt; Tubes with cDNA attached to beads&lt;br /&gt;
* LIBRARY ONLY &amp;lt;BR&amp;gt; Amplified cDNA&lt;br /&gt;
  |-&lt;br /&gt;
  |THROUGHPUT &lt;br /&gt;
  |&lt;br /&gt;
* FULL PREP/EXO: 4 samples/day&lt;br /&gt;
* LIBRARY: 24 samples/day&lt;br /&gt;
  |-&lt;br /&gt;
  |INCLUDED || QC at cDNA stage, library generation.&lt;br /&gt;
  |-&lt;br /&gt;
  |RECOMMENDED SEQUENCING || NextSeq500 - 75nt kit - 2-4 samples/flowcell&lt;br /&gt;
  |-&lt;br /&gt;
  |SUBMISSION || MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=12903 ilabs] &amp;lt;BR&amp;gt; External contact biomicro@mit.edu&lt;br /&gt;
  |-&lt;br /&gt;
  |DELIVERY || FASTQ, SAM, BAM, Cell:Gene matrix&lt;br /&gt;
  |-&lt;br /&gt;
  |UNIT || PER ARRAY&lt;br /&gt;
 |}&lt;br /&gt;
 |&lt;br /&gt;
The BioMicro Center collaborates closely with the Nanowell Core in the Koch Institute to provide support for the [https://shaleklab.com/resources/seq-well/ Seq-Well] protocol developed by Drs. Alex Shalek and Chris Love&#039;s groups. Seq-Well is based on the isolation of individual cells into microwells where cells are lysed and the associated mRNA is attached to polydT containing beads.  &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
Seq-Well projects can be brought in two ways. For full service, please use the ilabs form linked on the left. At the end of the form it asks you to select several days on which the experiment can be done. The Nanowell Core will review the possible dates with you to fit it in the schedule. On that date, the core will confirm the quality of your cells prior to beginning the experiment. While 10,000 cells are typically used in a Seq-Well experiment, the core requests you plan to bring more cells - often counts from flow cytometers and other instruments are incorrect. Planning to bring more cells ensures you have the 10,000 desired. The BioMicro Center becomes involved in these projects at the exonuclease treatment step, where we take over the preparation of the library and quality control, as well as sequencing and analysis.&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
Many laboratories are also using reagents from the Nanowell core to begin doing Seq-Well on their own. For these labs, we strongly recommend at least confirming the quality of the cDNA on our Advanced Analytical before continuing through library preparation. The library preparation can also be done in the BioMicro Center. Please use the standard Illumina library preparation form and note that the samples are Seq-Well. We do have all the custom primers needed for preparation and the pricing is identical to other NexteraXT preps. &lt;br /&gt;
|}&lt;br /&gt;
--&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:SingleCell&amp;diff=131760</id>
		<title>BioMicroCenter:SingleCell</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:SingleCell&amp;diff=131760"/>
		<updated>2026-07-28T16:48:49Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* scRNAseq / snRNAseq */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
 &lt;br /&gt;
[[File:SingleCellOptions.png|thumb|right|400px]]&lt;br /&gt;
The BioMicro Center supports a broad range of methods for single cell sequencing. The choice of method depends heavily on the type of question being asked and the source material. The methods break down into those supporting individual cells characterized in single wells and methods that use droplet isolation and library preparation. These cell requirements for each method vary significantly so reviewing each method is valuable and we strongly encourage consultation with BMC staff prior to beginning the experiment.&lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;.&lt;br /&gt;
 &lt;br /&gt;
 &lt;br /&gt;
== 10x CHROMIUM X ==&lt;br /&gt;
[[File:25_10xAssays.png|thumb|left|400px]]&lt;br /&gt;
The BioMicro Center provides access to 10x Genomics library preparation as an assisted or a walk-up service. Added in 2023, The 10x Chromium X can handle a broad variety of methodologies now including [https://www.10xgenomics.com/solutions/single-cell/ 3&#039;, 5&#039;  and fixed RNA sequencing], [https://www.10xgenomics.com/solutions/single-cell-atac/ ATAC and multiome] &amp;lt;!-- [https://www.10xgenomics.com/solutions/single-cell-cnv/ CNV]. --&amp;gt; Dropoff for assisted service is coordinated with Center staff with at least one week&#039;s lead time. Users should bring their single cell/nuclei suspension(s) in 1.5 mL microfuge tubes in the standard buffer at or around that time. Staff works with the user to intake the initial samples and proceed through the protocol with quality control checks at the appropriate steps. &lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
Chromium X usage is also offered as a walkup service. Usage may be scheduled on the iLabs calendar after training by BMC staff. This still requires at least a week&#039;s lead time before usage. You will not have permission to schedule the equipment until you have been approved by BMC staff. Reagents are stocked in the BioMicro Center and we ask that you use our reagents. This allows us to get larger bulk discounts we can pass on to our users. Please note that we do include a fraction of the instrument usage cost in the cost of the chips and will charge this cost if you use your own chips.&lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
The full 10x suite of software is installed on LURIA and is integrated into our analysis package. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
{|&lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;width: 450px;&amp;quot;|&lt;br /&gt;
=== scRNAseq / snRNAseq ===&lt;br /&gt;
&amp;lt;!-- A &amp;quot;setup&amp;quot; covers the chip, labor, and service contract. For Flex it also includes the GEMs. Samples per setup differ by assay - see Samples per setup row. --&amp;gt;&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !   &lt;br /&gt;
  ! 3&#039;RNA/5&#039;RNA &amp;lt;BR&amp;gt; (GEM-X)&lt;br /&gt;
  ! 3&#039;/5&#039; OnChipMultiplexing &amp;lt;BR&amp;gt; (OCM)&lt;br /&gt;
  ! Fixed RNA &amp;lt;BR&amp;gt; (Flex v2 / Apex)&lt;br /&gt;
  |-&lt;br /&gt;
  !INPUT &lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot;|&lt;br /&gt;
[https://www.10xgenomics.com/support/universal-three-prime-gene-expression/documentation/steps/sample-prep Freshly counted cells/nuclei in suspension.]&lt;br /&gt;
  |&lt;br /&gt;
[https://www.10xgenomics.com/support/flex-gene-expression/documentation/steps/sample-prep Fixed cells in suspension.] Also supports fresh, frozen, FFPE, fixed whole blood, and flow-sorted cells.&lt;br /&gt;
  |-&lt;br /&gt;
  !Cell Concentration &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; cells|nuclei/uL &amp;lt;/small&amp;gt;&lt;br /&gt;
  |100-2,000&lt;br /&gt;
  |100-2,000&lt;br /&gt;
  |25,000-300,000 total&lt;br /&gt;
  |-&lt;br /&gt;
  ! Fraction Recovered &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; est. percent of input cells captured &amp;lt;/small&amp;gt;&lt;br /&gt;
  | ~65%&lt;br /&gt;
  | ~60%&lt;br /&gt;
  | ~50%&lt;br /&gt;
  |-&lt;br /&gt;
  ! Target recovery &amp;lt;BR&amp;gt; &amp;lt;small&amp;gt; multiply by recovery for input &amp;lt;/small&amp;gt;&lt;br /&gt;
  | 500-20,000/lane&lt;br /&gt;
  | 500-5,000/lane &lt;br /&gt;
  | up to 20,000/sample&lt;br /&gt;
  |-&lt;br /&gt;
  ! Expected doublet rate @ Max load&lt;br /&gt;
  | 8%&lt;br /&gt;
  | 7.5%&lt;br /&gt;
  | 8% doublet @ 20k&lt;br /&gt;
  |-&lt;br /&gt;
  ! Samples per setup &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; A setup covers chip, labor, and service contract. Flex also includes GEMs. &amp;lt;/small&amp;gt;&lt;br /&gt;
  | 1-8 samples &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; 8 GEMs per chip &amp;lt;/small&amp;gt;&lt;br /&gt;
  | 1-8 samples &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; 4 lanes/batch → 2 GEMs per chip &amp;lt;/small&amp;gt;&lt;br /&gt;
  | up to ~48 samples &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; 1 GEM; ~1M cells captured; ~20k cells/index &amp;lt;/small&amp;gt;&lt;br /&gt;
  |-&lt;br /&gt;
  !ADD&#039;L AMPLICONS&lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot; |&lt;br /&gt;
Custom priming for CITEseq, CRISPRs (perturb-seq), TCR (5&#039;), BCR (5&#039;). &amp;lt;BR&amp;gt; Please provide custom oligos and protocols to core. &lt;br /&gt;
  |&lt;br /&gt;
Additional genes [https://www.10xgenomics.com/support/flex-gene-expression/documentation/steps/experimental-design-and-planning/custom-probe-design-for-visium-spatial-gene-expression-and-chromium-single-cell-gene-expression-flex require new probes.]&lt;br /&gt;
  |-&lt;br /&gt;
  ! KEY NOTES&lt;br /&gt;
  |&lt;br /&gt;
  | Batches of 4 samples&lt;br /&gt;
  | Human/Mouse only. &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; Probe-based: exogenous sequences (GFP, reporters, etc.) not captured without custom probes. &amp;lt;/small&amp;gt;&lt;br /&gt;
  |-&lt;br /&gt;
  !SUBMISSION FORMS&lt;br /&gt;
  |colspan=&amp;quot;3&amp;quot;| ASSISTED - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=12903 ilabs]  WALKUP - [https://mit.ilabsolutions.com/equipment/380963 Calendar]&lt;br /&gt;
  |-&lt;br /&gt;
  !DELIVERY &lt;br /&gt;
  |colspan=&amp;quot;3&amp;quot;| FASTQ, SAM, BAM, 10X QC, loupe file&lt;br /&gt;
  |-&lt;br /&gt;
  !DONATED BY &lt;br /&gt;
  |colspan=&amp;quot;3&amp;quot;| [http://mit.edu/manoli/ Prof. Manolis Kellis]&lt;br /&gt;
 |}&lt;br /&gt;
&lt;br /&gt;
=== CHROMATIN ===&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !   &lt;br /&gt;
  ! snATACseq&lt;br /&gt;
  ! multiome&lt;br /&gt;
  |-&lt;br /&gt;
  ! Input&lt;br /&gt;
  | colspan=2 |&lt;br /&gt;
* 160-8,000 nuclei/uL&lt;br /&gt;
* 50% estimated recovery&lt;br /&gt;
* 7.5% doublets @ 10k cells recovered&lt;br /&gt;
* 10uL minimum volume&lt;br /&gt;
 |-&lt;br /&gt;
 ! Multiplexing&lt;br /&gt;
 | colspan =2 | Not available&lt;br /&gt;
 |-&lt;br /&gt;
  !SUBMISSION FORMS&lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot;| ASSISTED - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=12903 ilabs]  WALKUP - [https://mit.ilabsolutions.com/equipment/380963 Calendar]&lt;br /&gt;
  |-&lt;br /&gt;
  !DELIVERY &lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot;| FASTQ, BAM, 10X QC, loupe file&lt;br /&gt;
 |}&lt;br /&gt;
 &lt;br /&gt;
|&lt;br /&gt;
 &lt;br /&gt;
=== 10X Genomics ===&lt;br /&gt;
[[image:10xX.jpg|thumb|right|500px|10x Chromium X]]&lt;br /&gt;
 &lt;br /&gt;
 &lt;br /&gt;
FAQs for Users &amp;lt;BR&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;1) What buffers in the final suspension are compatible with 10X applications?&#039;&#039;&#039; &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://kb.10xgenomics.com/s/article/115001937123-What-buffers-can-be-used-for-washing-and-cell-resuspension Buffers/media] for the submitted single cell/nuclei suspension should not contain excessive amounts of EDTA (&amp;gt;0.1 mM) or magnesium (&amp;gt;3 mM) and should be free of surfactants (i.e. Tween-20, SDS etc) and any RNases or DNases.&lt;br /&gt;
*1xPBS (calcium free and magnesium free) containing 0.04%  weight/volume BSA (400 µg/ml) is recommended for most general protocols and is considered the standard buffer&lt;br /&gt;
*Cell culture media with up to 1% BSA or up to 10% FBS if cells are not viable in standard buffer&lt;br /&gt;
*1xPBS (calcium free and magnesium free) containing up to 10% FBS for CMO labelling&lt;br /&gt;
*Nuclei also require addition of RNase Inhibitor along with 10X Genomics 1X nuclei buffer before chip loading, instructions for which are included in 10x user guides. If needed, users can collect buffer aliquots from the BMC after submitting a project. Please coordinate with BMC staff for pick-up. &amp;lt;br&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;2) How many cells are captured in the Assay?&#039;&#039;&#039;&lt;br /&gt;
&amp;lt;br&amp;gt;Up to 20,000 cells per GEM can be uniquely barcoded with GEM-X, but this highly depends on cell counts and viability. Dying cells will leak RNA, hence may not be captured efficiently leading to sample failures. We recommend to count cells at the BMC to avoid discrepancies, but can work with users&#039; counts as well. &amp;lt;BR&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;3) What are the best practices for flow sorting cells?&#039;&#039;&#039; &amp;lt;br&amp;gt; &lt;br /&gt;
10x provides guidance with their tested protocols about pre-sort buffer, collection buffer and FACS best practices [https://kb.10xgenomics.com/s/article/360048826911-What-are-the-best-practices-for-flow-sorting-cells-for-10x-Genomics-assays here.] &amp;lt;br&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;4) What is the expected size distribution for cDNA?&#039;&#039;&#039; &amp;lt;br&amp;gt;&lt;br /&gt;
cDNA for 3&#039; and 5&#039; libraries will span between 400 to 9000 base pairs, depending on sample type.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;5) How much sequencing per sample is recommended?&#039;&#039;&#039; &amp;lt;br&amp;gt;&lt;br /&gt;
10x makes several recommendations in their [https://www.10xgenomics.com/support/epi-atac/documentation/steps/sequencing/sequencing-handbook sequencing handbook]. Recommendation numbers vary by sample type, expected CNPs per sample, assay type and general sample quality. The higher the CNPs, the higher the quality, the more likely increased read depth is required. &amp;lt;br&amp;gt;&lt;br /&gt;
For more resources, please visit https://kb.10xgenomics.com/s/ &amp;lt;br&amp;gt;&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
 &lt;br /&gt;
== NAMOCELL SINGLE CELL SORTER ==&lt;br /&gt;
 &lt;br /&gt;
{| align=left &lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;width: 300px;&amp;quot;|&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  ! INSTRUMENT|| NAMOCELL SINGLE CELL SORTER&lt;br /&gt;
  |-&lt;br /&gt;
  | TYPE || WALKUP - MIT only &amp;lt;BR&amp;gt; FACS&lt;br /&gt;
  |-&lt;br /&gt;
  | UNIT || Per Cartridge&lt;br /&gt;
  |-&lt;br /&gt;
  | LASER WAVELENGTH	||  488 nm&lt;br /&gt;
  |-&lt;br /&gt;
  | DETECTION CHANNELS&lt;br /&gt;
  |&lt;br /&gt;
* FL1 533 nm (FITC/GFP)&lt;br /&gt;
* FL2 585 nm (PE/PI)&lt;br /&gt;
* FL3 676 nm (PerCP)&lt;br /&gt;
  |-&lt;br /&gt;
  | DISPENSE VOLUME || 1 ul&lt;br /&gt;
  |-&lt;br /&gt;
  | SAMPLE VOLUME || 100-750 ul&lt;br /&gt;
  |-&lt;br /&gt;
  | CELL INPUT || single cell mode: 100-10,000 cells &lt;br /&gt;
  |-&lt;br /&gt;
  | FORMAT || 96w/384w&lt;br /&gt;
  |-&lt;br /&gt;
  | SIGNUP || [https://mit.ilabsolutions.com/equipment/show/370751/?tab=schedule ILABS]&lt;br /&gt;
  |-&lt;br /&gt;
  | NEW USERS ||  New users should request training by emailing biomicro@mit.edu&lt;br /&gt;
  |-&lt;br /&gt;
  | DONATED BY || Prof Linda Griffith&lt;br /&gt;
 |}&lt;br /&gt;
 |&lt;br /&gt;
[[image:Namo.jpg|thumb|right|Namo (Namocell) Bio-Techne]]&lt;br /&gt;
The [https://www.bio-techne.com/brands/namocell Namocell Single Cell Sorter] allows users to sort cells into plates. The sorter uses microfluidics to sort single cells in 1uL of sheath fluid into a well. The instrument uses disposable cartridges to minimize contamination. The instrument integrates well with the [[BioMicroCenter:Tecan_Freedom_Evo#SPT_LABTECH_MOSQUITO_HV|SPT Labtech Mosquito HV]] which handles small reaction volumes. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
|} &lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;.&lt;br /&gt;
 &lt;br /&gt;
&amp;lt;!-- AVITI24 high-output DISS (whole transcriptome single cell) section pending - not yet released --&amp;gt;&lt;br /&gt;
 &lt;br /&gt;
&amp;lt;!-- commenting out Seq-Well &lt;br /&gt;
== SEQ-WELL ==&lt;br /&gt;
{|&lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;width: 300px;&amp;quot;|&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !   &lt;br /&gt;
  !SEQ-WELL &lt;br /&gt;
  |-&lt;br /&gt;
  |INPUT&lt;br /&gt;
  |&lt;br /&gt;
* FULL PREP: &amp;lt;BR&amp;gt;50,000 single free cells. 90% viability&lt;br /&gt;
* EXO1 and AMP &amp;lt;BR&amp;gt; Tubes with cDNA attached to beads&lt;br /&gt;
* LIBRARY ONLY &amp;lt;BR&amp;gt; Amplified cDNA&lt;br /&gt;
  |-&lt;br /&gt;
  |THROUGHPUT &lt;br /&gt;
  |&lt;br /&gt;
* FULL PREP/EXO: 4 samples/day&lt;br /&gt;
* LIBRARY: 24 samples/day&lt;br /&gt;
  |-&lt;br /&gt;
  |INCLUDED || QC at cDNA stage, library generation.&lt;br /&gt;
  |-&lt;br /&gt;
  |RECOMMENDED SEQUENCING || NextSeq500 - 75nt kit - 2-4 samples/flowcell&lt;br /&gt;
  |-&lt;br /&gt;
  |SUBMISSION || MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=12903 ilabs] &amp;lt;BR&amp;gt; External contact biomicro@mit.edu&lt;br /&gt;
  |-&lt;br /&gt;
  |DELIVERY || FASTQ, SAM, BAM, Cell:Gene matrix&lt;br /&gt;
  |-&lt;br /&gt;
  |UNIT || PER ARRAY&lt;br /&gt;
 |}&lt;br /&gt;
 |&lt;br /&gt;
The BioMicro Center collaborates closely with the Nanowell Core in the Koch Institute to provide support for the [https://shaleklab.com/resources/seq-well/ Seq-Well] protocol developed by Drs. Alex Shalek and Chris Love&#039;s groups. Seq-Well is based on the isolation of individual cells into microwells where cells are lysed and the associated mRNA is attached to polydT containing beads.  &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
Seq-Well projects can be brought in two ways. For full service, please use the ilabs form linked on the left. At the end of the form it asks you to select several days on which the experiment can be done. The Nanowell Core will review the possible dates with you to fit it in the schedule. On that date, the core will confirm the quality of your cells prior to beginning the experiment. While 10,000 cells are typically used in a Seq-Well experiment, the core requests you plan to bring more cells - often counts from flow cytometers and other instruments are incorrect. Planning to bring more cells ensures you have the 10,000 desired. The BioMicro Center becomes involved in these projects at the exonuclease treatment step, where we take over the preparation of the library and quality control, as well as sequencing and analysis.&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
Many laboratories are also using reagents from the Nanowell core to begin doing Seq-Well on their own. For these labs, we strongly recommend at least confirming the quality of the cDNA on our Advanced Analytical before continuing through library preparation. The library preparation can also be done in the BioMicro Center. Please use the standard Illumina library preparation form and note that the samples are Seq-Well. We do have all the custom primers needed for preparation and the pricing is identical to other NexteraXT preps. &lt;br /&gt;
|}&lt;br /&gt;
--&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:SingleCell&amp;diff=131759</id>
		<title>BioMicroCenter:SingleCell</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:SingleCell&amp;diff=131759"/>
		<updated>2026-07-28T16:47:31Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* scRNAseq / snRNAseq */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
 &lt;br /&gt;
[[File:SingleCellOptions.png|thumb|right|400px]]&lt;br /&gt;
The BioMicro Center supports a broad range of methods for single cell sequencing. The choice of method depends heavily on the type of question being asked and the source material. The methods break down into those supporting individual cells characterized in single wells and methods that use droplet isolation and library preparation. These cell requirements for each method vary significantly so reviewing each method is valuable and we strongly encourage consultation with BMC staff prior to beginning the experiment.&lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;.&lt;br /&gt;
 &lt;br /&gt;
 &lt;br /&gt;
== 10x CHROMIUM X ==&lt;br /&gt;
[[File:25_10xAssays.png|thumb|left|400px]]&lt;br /&gt;
The BioMicro Center provides access to 10x Genomics library preparation as an assisted or a walk-up service. Added in 2023, The 10x Chromium X can handle a broad variety of methodologies now including [https://www.10xgenomics.com/solutions/single-cell/ 3&#039;, 5&#039;  and fixed RNA sequencing], [https://www.10xgenomics.com/solutions/single-cell-atac/ ATAC and multiome] &amp;lt;!-- [https://www.10xgenomics.com/solutions/single-cell-cnv/ CNV]. --&amp;gt; Dropoff for assisted service is coordinated with Center staff with at least one week&#039;s lead time. Users should bring their single cell/nuclei suspension(s) in 1.5 mL microfuge tubes in the standard buffer at or around that time. Staff works with the user to intake the initial samples and proceed through the protocol with quality control checks at the appropriate steps. &lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
Chromium X usage is also offered as a walkup service. Usage may be scheduled on the iLabs calendar after training by BMC staff. This still requires at least a week&#039;s lead time before usage. You will not have permission to schedule the equipment until you have been approved by BMC staff. Reagents are stocked in the BioMicro Center and we ask that you use our reagents. This allows us to get larger bulk discounts we can pass on to our users. Please note that we do include a fraction of the instrument usage cost in the cost of the chips and will charge this cost if you use your own chips.&lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
The full 10x suite of software is installed on LURIA and is integrated into our analysis package. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
{|&lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;width: 450px;&amp;quot;|&lt;br /&gt;
=== scRNAseq / snRNAseq ===&lt;br /&gt;
&amp;lt;!-- A &amp;quot;setup&amp;quot; covers the chip, labor, and service contract. For Flex it also includes the GEMs. Samples per setup differ by assay - see Samples per setup row. --&amp;gt;&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !   &lt;br /&gt;
  ! 3&#039;RNA/5&#039;RNA &amp;lt;BR&amp;gt; (GEM-X)&lt;br /&gt;
  ! 3&#039;/5&#039; OnChipMultiplexing &amp;lt;BR&amp;gt; (OCM)&lt;br /&gt;
  ! Fixed RNA &amp;lt;BR&amp;gt; (Flex v2 / Apex)&lt;br /&gt;
  |-&lt;br /&gt;
  !INPUT &lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot;|&lt;br /&gt;
[https://www.10xgenomics.com/support/universal-three-prime-gene-expression/documentation/steps/sample-prep Freshly counted cells/nuclei in suspension.]&lt;br /&gt;
  |&lt;br /&gt;
[https://www.10xgenomics.com/support/flex-gene-expression/documentation/steps/sample-prep Fixed cells in suspension.] Also supports fresh, frozen, FFPE, fixed whole blood, and flow-sorted cells.&lt;br /&gt;
  |-&lt;br /&gt;
  !Cell Concentration &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; cells|nuclei/uL &amp;lt;/small&amp;gt;&lt;br /&gt;
  |100-2,000&lt;br /&gt;
  |100-2,000&lt;br /&gt;
  |25,000-300,000&lt;br /&gt;
  |-&lt;br /&gt;
  ! Fraction Recovered &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; est. percent of input cells captured &amp;lt;/small&amp;gt;&lt;br /&gt;
  | ~65%&lt;br /&gt;
  | ~60%&lt;br /&gt;
  | ~50%&lt;br /&gt;
  |-&lt;br /&gt;
  ! Target recovery &amp;lt;BR&amp;gt; &amp;lt;small&amp;gt; multiply by recovery for input &amp;lt;/small&amp;gt;&lt;br /&gt;
  | 500-20,000/lane&lt;br /&gt;
  | 500-5,000/lane &lt;br /&gt;
  | up to 20,000/sample&lt;br /&gt;
  |-&lt;br /&gt;
  ! Expected doublet rate @ Max load&lt;br /&gt;
  | 8%&lt;br /&gt;
  | 7.5%&lt;br /&gt;
  | 8% doublet @ 20k&lt;br /&gt;
  |-&lt;br /&gt;
  ! Samples per setup &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; A setup covers chip, labor, and service contract. Flex also includes GEMs. &amp;lt;/small&amp;gt;&lt;br /&gt;
  | 1-8 samples &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; 8 GEMs per chip &amp;lt;/small&amp;gt;&lt;br /&gt;
  | 1-8 samples &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; 4 lanes/batch → 2 GEMs per chip &amp;lt;/small&amp;gt;&lt;br /&gt;
  | up to ~48 samples &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; 1 GEM; ~1M cells captured; ~20k cells/index &amp;lt;/small&amp;gt;&lt;br /&gt;
  |-&lt;br /&gt;
  !ADD&#039;L AMPLICONS&lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot; |&lt;br /&gt;
Custom priming for CITEseq, CRISPRs (perturb-seq), TCR (5&#039;), BCR (5&#039;). &amp;lt;BR&amp;gt; Please provide custom oligos and protocols to core. &lt;br /&gt;
  |&lt;br /&gt;
Additional genes [https://www.10xgenomics.com/support/flex-gene-expression/documentation/steps/experimental-design-and-planning/custom-probe-design-for-visium-spatial-gene-expression-and-chromium-single-cell-gene-expression-flex require new probes.]&lt;br /&gt;
  |-&lt;br /&gt;
  ! KEY NOTES&lt;br /&gt;
  |&lt;br /&gt;
  | Batches of 4 samples&lt;br /&gt;
  | Human/Mouse only. &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; Probe-based: exogenous sequences (GFP, reporters, etc.) not captured without custom probes. &amp;lt;/small&amp;gt;&lt;br /&gt;
  |-&lt;br /&gt;
  !SUBMISSION FORMS&lt;br /&gt;
  |colspan=&amp;quot;3&amp;quot;| ASSISTED - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=12903 ilabs]  WALKUP - [https://mit.ilabsolutions.com/equipment/380963 Calendar]&lt;br /&gt;
  |-&lt;br /&gt;
  !DELIVERY &lt;br /&gt;
  |colspan=&amp;quot;3&amp;quot;| FASTQ, SAM, BAM, 10X QC, loupe file&lt;br /&gt;
  |-&lt;br /&gt;
  !DONATED BY &lt;br /&gt;
  |colspan=&amp;quot;3&amp;quot;| [http://mit.edu/manoli/ Prof. Manolis Kellis]&lt;br /&gt;
 |}&lt;br /&gt;
&lt;br /&gt;
=== CHROMATIN ===&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !   &lt;br /&gt;
  ! snATACseq&lt;br /&gt;
  ! multiome&lt;br /&gt;
  |-&lt;br /&gt;
  ! Input&lt;br /&gt;
  | colspan=2 |&lt;br /&gt;
* 160-8,000 nuclei/uL&lt;br /&gt;
* 50% estimated recovery&lt;br /&gt;
* 7.5% doublets @ 10k cells recovered&lt;br /&gt;
* 10uL minimum volume&lt;br /&gt;
 |-&lt;br /&gt;
 ! Multiplexing&lt;br /&gt;
 | colspan =2 | Not available&lt;br /&gt;
 |-&lt;br /&gt;
  !SUBMISSION FORMS&lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot;| ASSISTED - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=12903 ilabs]  WALKUP - [https://mit.ilabsolutions.com/equipment/380963 Calendar]&lt;br /&gt;
  |-&lt;br /&gt;
  !DELIVERY &lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot;| FASTQ, BAM, 10X QC, loupe file&lt;br /&gt;
 |}&lt;br /&gt;
 &lt;br /&gt;
|&lt;br /&gt;
 &lt;br /&gt;
=== 10X Genomics ===&lt;br /&gt;
[[image:10xX.jpg|thumb|right|500px|10x Chromium X]]&lt;br /&gt;
 &lt;br /&gt;
 &lt;br /&gt;
FAQs for Users &amp;lt;BR&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;1) What buffers in the final suspension are compatible with 10X applications?&#039;&#039;&#039; &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://kb.10xgenomics.com/s/article/115001937123-What-buffers-can-be-used-for-washing-and-cell-resuspension Buffers/media] for the submitted single cell/nuclei suspension should not contain excessive amounts of EDTA (&amp;gt;0.1 mM) or magnesium (&amp;gt;3 mM) and should be free of surfactants (i.e. Tween-20, SDS etc) and any RNases or DNases.&lt;br /&gt;
*1xPBS (calcium free and magnesium free) containing 0.04%  weight/volume BSA (400 µg/ml) is recommended for most general protocols and is considered the standard buffer&lt;br /&gt;
*Cell culture media with up to 1% BSA or up to 10% FBS if cells are not viable in standard buffer&lt;br /&gt;
*1xPBS (calcium free and magnesium free) containing up to 10% FBS for CMO labelling&lt;br /&gt;
*Nuclei also require addition of RNase Inhibitor along with 10X Genomics 1X nuclei buffer before chip loading, instructions for which are included in 10x user guides. If needed, users can collect buffer aliquots from the BMC after submitting a project. Please coordinate with BMC staff for pick-up. &amp;lt;br&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;2) How many cells are captured in the Assay?&#039;&#039;&#039;&lt;br /&gt;
&amp;lt;br&amp;gt;Up to 20,000 cells per GEM can be uniquely barcoded with GEM-X, but this highly depends on cell counts and viability. Dying cells will leak RNA, hence may not be captured efficiently leading to sample failures. We recommend to count cells at the BMC to avoid discrepancies, but can work with users&#039; counts as well. &amp;lt;BR&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;3) What are the best practices for flow sorting cells?&#039;&#039;&#039; &amp;lt;br&amp;gt; &lt;br /&gt;
10x provides guidance with their tested protocols about pre-sort buffer, collection buffer and FACS best practices [https://kb.10xgenomics.com/s/article/360048826911-What-are-the-best-practices-for-flow-sorting-cells-for-10x-Genomics-assays here.] &amp;lt;br&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;4) What is the expected size distribution for cDNA?&#039;&#039;&#039; &amp;lt;br&amp;gt;&lt;br /&gt;
cDNA for 3&#039; and 5&#039; libraries will span between 400 to 9000 base pairs, depending on sample type.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;5) How much sequencing per sample is recommended?&#039;&#039;&#039; &amp;lt;br&amp;gt;&lt;br /&gt;
10x makes several recommendations in their [https://www.10xgenomics.com/support/epi-atac/documentation/steps/sequencing/sequencing-handbook sequencing handbook]. Recommendation numbers vary by sample type, expected CNPs per sample, assay type and general sample quality. The higher the CNPs, the higher the quality, the more likely increased read depth is required. &amp;lt;br&amp;gt;&lt;br /&gt;
For more resources, please visit https://kb.10xgenomics.com/s/ &amp;lt;br&amp;gt;&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
 &lt;br /&gt;
== NAMOCELL SINGLE CELL SORTER ==&lt;br /&gt;
 &lt;br /&gt;
{| align=left &lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;width: 300px;&amp;quot;|&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  ! INSTRUMENT|| NAMOCELL SINGLE CELL SORTER&lt;br /&gt;
  |-&lt;br /&gt;
  | TYPE || WALKUP - MIT only &amp;lt;BR&amp;gt; FACS&lt;br /&gt;
  |-&lt;br /&gt;
  | UNIT || Per Cartridge&lt;br /&gt;
  |-&lt;br /&gt;
  | LASER WAVELENGTH	||  488 nm&lt;br /&gt;
  |-&lt;br /&gt;
  | DETECTION CHANNELS&lt;br /&gt;
  |&lt;br /&gt;
* FL1 533 nm (FITC/GFP)&lt;br /&gt;
* FL2 585 nm (PE/PI)&lt;br /&gt;
* FL3 676 nm (PerCP)&lt;br /&gt;
  |-&lt;br /&gt;
  | DISPENSE VOLUME || 1 ul&lt;br /&gt;
  |-&lt;br /&gt;
  | SAMPLE VOLUME || 100-750 ul&lt;br /&gt;
  |-&lt;br /&gt;
  | CELL INPUT || single cell mode: 100-10,000 cells &lt;br /&gt;
  |-&lt;br /&gt;
  | FORMAT || 96w/384w&lt;br /&gt;
  |-&lt;br /&gt;
  | SIGNUP || [https://mit.ilabsolutions.com/equipment/show/370751/?tab=schedule ILABS]&lt;br /&gt;
  |-&lt;br /&gt;
  | NEW USERS ||  New users should request training by emailing biomicro@mit.edu&lt;br /&gt;
  |-&lt;br /&gt;
  | DONATED BY || Prof Linda Griffith&lt;br /&gt;
 |}&lt;br /&gt;
 |&lt;br /&gt;
[[image:Namo.jpg|thumb|right|Namo (Namocell) Bio-Techne]]&lt;br /&gt;
The [https://www.bio-techne.com/brands/namocell Namocell Single Cell Sorter] allows users to sort cells into plates. The sorter uses microfluidics to sort single cells in 1uL of sheath fluid into a well. The instrument uses disposable cartridges to minimize contamination. The instrument integrates well with the [[BioMicroCenter:Tecan_Freedom_Evo#SPT_LABTECH_MOSQUITO_HV|SPT Labtech Mosquito HV]] which handles small reaction volumes. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
|} &lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;.&lt;br /&gt;
 &lt;br /&gt;
&amp;lt;!-- AVITI24 high-output DISS (whole transcriptome single cell) section pending - not yet released --&amp;gt;&lt;br /&gt;
 &lt;br /&gt;
&amp;lt;!-- commenting out Seq-Well &lt;br /&gt;
== SEQ-WELL ==&lt;br /&gt;
{|&lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;width: 300px;&amp;quot;|&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !   &lt;br /&gt;
  !SEQ-WELL &lt;br /&gt;
  |-&lt;br /&gt;
  |INPUT&lt;br /&gt;
  |&lt;br /&gt;
* FULL PREP: &amp;lt;BR&amp;gt;50,000 single free cells. 90% viability&lt;br /&gt;
* EXO1 and AMP &amp;lt;BR&amp;gt; Tubes with cDNA attached to beads&lt;br /&gt;
* LIBRARY ONLY &amp;lt;BR&amp;gt; Amplified cDNA&lt;br /&gt;
  |-&lt;br /&gt;
  |THROUGHPUT &lt;br /&gt;
  |&lt;br /&gt;
* FULL PREP/EXO: 4 samples/day&lt;br /&gt;
* LIBRARY: 24 samples/day&lt;br /&gt;
  |-&lt;br /&gt;
  |INCLUDED || QC at cDNA stage, library generation.&lt;br /&gt;
  |-&lt;br /&gt;
  |RECOMMENDED SEQUENCING || NextSeq500 - 75nt kit - 2-4 samples/flowcell&lt;br /&gt;
  |-&lt;br /&gt;
  |SUBMISSION || MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=12903 ilabs] &amp;lt;BR&amp;gt; External contact biomicro@mit.edu&lt;br /&gt;
  |-&lt;br /&gt;
  |DELIVERY || FASTQ, SAM, BAM, Cell:Gene matrix&lt;br /&gt;
  |-&lt;br /&gt;
  |UNIT || PER ARRAY&lt;br /&gt;
 |}&lt;br /&gt;
 |&lt;br /&gt;
The BioMicro Center collaborates closely with the Nanowell Core in the Koch Institute to provide support for the [https://shaleklab.com/resources/seq-well/ Seq-Well] protocol developed by Drs. Alex Shalek and Chris Love&#039;s groups. Seq-Well is based on the isolation of individual cells into microwells where cells are lysed and the associated mRNA is attached to polydT containing beads.  &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
Seq-Well projects can be brought in two ways. For full service, please use the ilabs form linked on the left. At the end of the form it asks you to select several days on which the experiment can be done. The Nanowell Core will review the possible dates with you to fit it in the schedule. On that date, the core will confirm the quality of your cells prior to beginning the experiment. While 10,000 cells are typically used in a Seq-Well experiment, the core requests you plan to bring more cells - often counts from flow cytometers and other instruments are incorrect. Planning to bring more cells ensures you have the 10,000 desired. The BioMicro Center becomes involved in these projects at the exonuclease treatment step, where we take over the preparation of the library and quality control, as well as sequencing and analysis.&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
Many laboratories are also using reagents from the Nanowell core to begin doing Seq-Well on their own. For these labs, we strongly recommend at least confirming the quality of the cDNA on our Advanced Analytical before continuing through library preparation. The library preparation can also be done in the BioMicro Center. Please use the standard Illumina library preparation form and note that the samples are Seq-Well. We do have all the custom primers needed for preparation and the pricing is identical to other NexteraXT preps. &lt;br /&gt;
|}&lt;br /&gt;
--&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:SingleCell&amp;diff=131758</id>
		<title>BioMicroCenter:SingleCell</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:SingleCell&amp;diff=131758"/>
		<updated>2026-07-28T16:46:56Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* scRNAseq / snRNAseq */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
 &lt;br /&gt;
[[File:SingleCellOptions.png|thumb|right|400px]]&lt;br /&gt;
The BioMicro Center supports a broad range of methods for single cell sequencing. The choice of method depends heavily on the type of question being asked and the source material. The methods break down into those supporting individual cells characterized in single wells and methods that use droplet isolation and library preparation. These cell requirements for each method vary significantly so reviewing each method is valuable and we strongly encourage consultation with BMC staff prior to beginning the experiment.&lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;.&lt;br /&gt;
 &lt;br /&gt;
 &lt;br /&gt;
== 10x CHROMIUM X ==&lt;br /&gt;
[[File:25_10xAssays.png|thumb|left|400px]]&lt;br /&gt;
The BioMicro Center provides access to 10x Genomics library preparation as an assisted or a walk-up service. Added in 2023, The 10x Chromium X can handle a broad variety of methodologies now including [https://www.10xgenomics.com/solutions/single-cell/ 3&#039;, 5&#039;  and fixed RNA sequencing], [https://www.10xgenomics.com/solutions/single-cell-atac/ ATAC and multiome] &amp;lt;!-- [https://www.10xgenomics.com/solutions/single-cell-cnv/ CNV]. --&amp;gt; Dropoff for assisted service is coordinated with Center staff with at least one week&#039;s lead time. Users should bring their single cell/nuclei suspension(s) in 1.5 mL microfuge tubes in the standard buffer at or around that time. Staff works with the user to intake the initial samples and proceed through the protocol with quality control checks at the appropriate steps. &lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
Chromium X usage is also offered as a walkup service. Usage may be scheduled on the iLabs calendar after training by BMC staff. This still requires at least a week&#039;s lead time before usage. You will not have permission to schedule the equipment until you have been approved by BMC staff. Reagents are stocked in the BioMicro Center and we ask that you use our reagents. This allows us to get larger bulk discounts we can pass on to our users. Please note that we do include a fraction of the instrument usage cost in the cost of the chips and will charge this cost if you use your own chips.&lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
The full 10x suite of software is installed on LURIA and is integrated into our analysis package. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
{|&lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;width: 450px;&amp;quot;|&lt;br /&gt;
=== scRNAseq / snRNAseq ===&lt;br /&gt;
&amp;lt;!-- A &amp;quot;setup&amp;quot; covers the chip, labor, and service contract. For Flex it also includes the GEMs. Samples per setup differ by assay - see Samples per setup row. --&amp;gt;&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !   &lt;br /&gt;
  ! 3&#039;RNA/5&#039;RNA &amp;lt;BR&amp;gt; (GEM-X)&lt;br /&gt;
  ! 3&#039;/5&#039; OnChipMultiplexing &amp;lt;BR&amp;gt; (OCM)&lt;br /&gt;
  ! Fixed RNA &amp;lt;BR&amp;gt; (Flex v2 / Apex)&lt;br /&gt;
  |-&lt;br /&gt;
  !INPUT &lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot;|&lt;br /&gt;
[https://www.10xgenomics.com/support/universal-three-prime-gene-expression/documentation/steps/sample-prep Freshly counted cells/nuclei in suspension.]&lt;br /&gt;
  |&lt;br /&gt;
[https://www.10xgenomics.com/support/flex-gene-expression/documentation/steps/sample-prep Fixed cells in suspension.] Also supports fresh, frozen, FFPE, fixed whole blood, and flow-sorted cells.&lt;br /&gt;
  |-&lt;br /&gt;
  !Cell Concentration &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; cells|nuclei/uL &amp;lt;/small&amp;gt;&lt;br /&gt;
  |500-2,000&lt;br /&gt;
  |500-2,000&lt;br /&gt;
  |25,000-300,000&lt;br /&gt;
  |-&lt;br /&gt;
  ! Fraction Recovered &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; est. percent of input cells captured &amp;lt;/small&amp;gt;&lt;br /&gt;
  | ~65%&lt;br /&gt;
  | ~60%&lt;br /&gt;
  | ~50%&lt;br /&gt;
  |-&lt;br /&gt;
  ! Target recovery &amp;lt;BR&amp;gt; &amp;lt;small&amp;gt; multiply by recovery for input &amp;lt;/small&amp;gt;&lt;br /&gt;
  | 500-20,000/lane&lt;br /&gt;
  | 500-5,000/lane &lt;br /&gt;
  | up to 20,000/sample&lt;br /&gt;
  |-&lt;br /&gt;
  ! Expected doublet rate @ Max load&lt;br /&gt;
  | 8%&lt;br /&gt;
  | 7.5%&lt;br /&gt;
  | 8% doublet @ 20k&lt;br /&gt;
  |-&lt;br /&gt;
  ! Samples per setup &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; A setup covers chip, labor, and service contract. Flex also includes GEMs. &amp;lt;/small&amp;gt;&lt;br /&gt;
  | 1-8 samples &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; 8 GEMs per chip &amp;lt;/small&amp;gt;&lt;br /&gt;
  | 1-8 samples &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; 4 lanes/batch → 2 GEMs per chip &amp;lt;/small&amp;gt;&lt;br /&gt;
  | up to ~48 samples &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; 1 GEM; ~1M cells captured; ~20k cells/index &amp;lt;/small&amp;gt;&lt;br /&gt;
  |-&lt;br /&gt;
  !ADD&#039;L AMPLICONS&lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot; |&lt;br /&gt;
Custom priming for CITEseq, CRISPRs (perturb-seq), TCR (5&#039;), BCR (5&#039;). &amp;lt;BR&amp;gt; Please provide custom oligos and protocols to core. &lt;br /&gt;
  |&lt;br /&gt;
Additional genes [https://www.10xgenomics.com/support/flex-gene-expression/documentation/steps/experimental-design-and-planning/custom-probe-design-for-visium-spatial-gene-expression-and-chromium-single-cell-gene-expression-flex require new probes.]&lt;br /&gt;
  |-&lt;br /&gt;
  ! KEY NOTES&lt;br /&gt;
  |&lt;br /&gt;
  | Batches of 4 samples&lt;br /&gt;
  | Human/Mouse only. &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; Probe-based: exogenous sequences (GFP, reporters, etc.) not captured without custom probes. &amp;lt;/small&amp;gt;&lt;br /&gt;
  |-&lt;br /&gt;
  !SUBMISSION FORMS&lt;br /&gt;
  |colspan=&amp;quot;3&amp;quot;| ASSISTED - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=12903 ilabs]  WALKUP - [https://mit.ilabsolutions.com/equipment/380963 Calendar]&lt;br /&gt;
  |-&lt;br /&gt;
  !DELIVERY &lt;br /&gt;
  |colspan=&amp;quot;3&amp;quot;| FASTQ, SAM, BAM, 10X QC, loupe file&lt;br /&gt;
  |-&lt;br /&gt;
  !DONATED BY &lt;br /&gt;
  |colspan=&amp;quot;3&amp;quot;| [http://mit.edu/manoli/ Prof. Manolis Kellis]&lt;br /&gt;
 |}&lt;br /&gt;
&lt;br /&gt;
=== CHROMATIN ===&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !   &lt;br /&gt;
  ! snATACseq&lt;br /&gt;
  ! multiome&lt;br /&gt;
  |-&lt;br /&gt;
  ! Input&lt;br /&gt;
  | colspan=2 |&lt;br /&gt;
* 160-8,000 nuclei/uL&lt;br /&gt;
* 50% estimated recovery&lt;br /&gt;
* 7.5% doublets @ 10k cells recovered&lt;br /&gt;
* 10uL minimum volume&lt;br /&gt;
 |-&lt;br /&gt;
 ! Multiplexing&lt;br /&gt;
 | colspan =2 | Not available&lt;br /&gt;
 |-&lt;br /&gt;
  !SUBMISSION FORMS&lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot;| ASSISTED - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=12903 ilabs]  WALKUP - [https://mit.ilabsolutions.com/equipment/380963 Calendar]&lt;br /&gt;
  |-&lt;br /&gt;
  !DELIVERY &lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot;| FASTQ, BAM, 10X QC, loupe file&lt;br /&gt;
 |}&lt;br /&gt;
 &lt;br /&gt;
|&lt;br /&gt;
 &lt;br /&gt;
=== 10X Genomics ===&lt;br /&gt;
[[image:10xX.jpg|thumb|right|500px|10x Chromium X]]&lt;br /&gt;
 &lt;br /&gt;
 &lt;br /&gt;
FAQs for Users &amp;lt;BR&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;1) What buffers in the final suspension are compatible with 10X applications?&#039;&#039;&#039; &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://kb.10xgenomics.com/s/article/115001937123-What-buffers-can-be-used-for-washing-and-cell-resuspension Buffers/media] for the submitted single cell/nuclei suspension should not contain excessive amounts of EDTA (&amp;gt;0.1 mM) or magnesium (&amp;gt;3 mM) and should be free of surfactants (i.e. Tween-20, SDS etc) and any RNases or DNases.&lt;br /&gt;
*1xPBS (calcium free and magnesium free) containing 0.04%  weight/volume BSA (400 µg/ml) is recommended for most general protocols and is considered the standard buffer&lt;br /&gt;
*Cell culture media with up to 1% BSA or up to 10% FBS if cells are not viable in standard buffer&lt;br /&gt;
*1xPBS (calcium free and magnesium free) containing up to 10% FBS for CMO labelling&lt;br /&gt;
*Nuclei also require addition of RNase Inhibitor along with 10X Genomics 1X nuclei buffer before chip loading, instructions for which are included in 10x user guides. If needed, users can collect buffer aliquots from the BMC after submitting a project. Please coordinate with BMC staff for pick-up. &amp;lt;br&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;2) How many cells are captured in the Assay?&#039;&#039;&#039;&lt;br /&gt;
&amp;lt;br&amp;gt;Up to 20,000 cells per GEM can be uniquely barcoded with GEM-X, but this highly depends on cell counts and viability. Dying cells will leak RNA, hence may not be captured efficiently leading to sample failures. We recommend to count cells at the BMC to avoid discrepancies, but can work with users&#039; counts as well. &amp;lt;BR&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;3) What are the best practices for flow sorting cells?&#039;&#039;&#039; &amp;lt;br&amp;gt; &lt;br /&gt;
10x provides guidance with their tested protocols about pre-sort buffer, collection buffer and FACS best practices [https://kb.10xgenomics.com/s/article/360048826911-What-are-the-best-practices-for-flow-sorting-cells-for-10x-Genomics-assays here.] &amp;lt;br&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;4) What is the expected size distribution for cDNA?&#039;&#039;&#039; &amp;lt;br&amp;gt;&lt;br /&gt;
cDNA for 3&#039; and 5&#039; libraries will span between 400 to 9000 base pairs, depending on sample type.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;5) How much sequencing per sample is recommended?&#039;&#039;&#039; &amp;lt;br&amp;gt;&lt;br /&gt;
10x makes several recommendations in their [https://www.10xgenomics.com/support/epi-atac/documentation/steps/sequencing/sequencing-handbook sequencing handbook]. Recommendation numbers vary by sample type, expected CNPs per sample, assay type and general sample quality. The higher the CNPs, the higher the quality, the more likely increased read depth is required. &amp;lt;br&amp;gt;&lt;br /&gt;
For more resources, please visit https://kb.10xgenomics.com/s/ &amp;lt;br&amp;gt;&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
 &lt;br /&gt;
== NAMOCELL SINGLE CELL SORTER ==&lt;br /&gt;
 &lt;br /&gt;
{| align=left &lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;width: 300px;&amp;quot;|&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  ! INSTRUMENT|| NAMOCELL SINGLE CELL SORTER&lt;br /&gt;
  |-&lt;br /&gt;
  | TYPE || WALKUP - MIT only &amp;lt;BR&amp;gt; FACS&lt;br /&gt;
  |-&lt;br /&gt;
  | UNIT || Per Cartridge&lt;br /&gt;
  |-&lt;br /&gt;
  | LASER WAVELENGTH	||  488 nm&lt;br /&gt;
  |-&lt;br /&gt;
  | DETECTION CHANNELS&lt;br /&gt;
  |&lt;br /&gt;
* FL1 533 nm (FITC/GFP)&lt;br /&gt;
* FL2 585 nm (PE/PI)&lt;br /&gt;
* FL3 676 nm (PerCP)&lt;br /&gt;
  |-&lt;br /&gt;
  | DISPENSE VOLUME || 1 ul&lt;br /&gt;
  |-&lt;br /&gt;
  | SAMPLE VOLUME || 100-750 ul&lt;br /&gt;
  |-&lt;br /&gt;
  | CELL INPUT || single cell mode: 100-10,000 cells &lt;br /&gt;
  |-&lt;br /&gt;
  | FORMAT || 96w/384w&lt;br /&gt;
  |-&lt;br /&gt;
  | SIGNUP || [https://mit.ilabsolutions.com/equipment/show/370751/?tab=schedule ILABS]&lt;br /&gt;
  |-&lt;br /&gt;
  | NEW USERS ||  New users should request training by emailing biomicro@mit.edu&lt;br /&gt;
  |-&lt;br /&gt;
  | DONATED BY || Prof Linda Griffith&lt;br /&gt;
 |}&lt;br /&gt;
 |&lt;br /&gt;
[[image:Namo.jpg|thumb|right|Namo (Namocell) Bio-Techne]]&lt;br /&gt;
The [https://www.bio-techne.com/brands/namocell Namocell Single Cell Sorter] allows users to sort cells into plates. The sorter uses microfluidics to sort single cells in 1uL of sheath fluid into a well. The instrument uses disposable cartridges to minimize contamination. The instrument integrates well with the [[BioMicroCenter:Tecan_Freedom_Evo#SPT_LABTECH_MOSQUITO_HV|SPT Labtech Mosquito HV]] which handles small reaction volumes. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
|} &lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;.&lt;br /&gt;
 &lt;br /&gt;
&amp;lt;!-- AVITI24 high-output DISS (whole transcriptome single cell) section pending - not yet released --&amp;gt;&lt;br /&gt;
 &lt;br /&gt;
&amp;lt;!-- commenting out Seq-Well &lt;br /&gt;
== SEQ-WELL ==&lt;br /&gt;
{|&lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;width: 300px;&amp;quot;|&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !   &lt;br /&gt;
  !SEQ-WELL &lt;br /&gt;
  |-&lt;br /&gt;
  |INPUT&lt;br /&gt;
  |&lt;br /&gt;
* FULL PREP: &amp;lt;BR&amp;gt;50,000 single free cells. 90% viability&lt;br /&gt;
* EXO1 and AMP &amp;lt;BR&amp;gt; Tubes with cDNA attached to beads&lt;br /&gt;
* LIBRARY ONLY &amp;lt;BR&amp;gt; Amplified cDNA&lt;br /&gt;
  |-&lt;br /&gt;
  |THROUGHPUT &lt;br /&gt;
  |&lt;br /&gt;
* FULL PREP/EXO: 4 samples/day&lt;br /&gt;
* LIBRARY: 24 samples/day&lt;br /&gt;
  |-&lt;br /&gt;
  |INCLUDED || QC at cDNA stage, library generation.&lt;br /&gt;
  |-&lt;br /&gt;
  |RECOMMENDED SEQUENCING || NextSeq500 - 75nt kit - 2-4 samples/flowcell&lt;br /&gt;
  |-&lt;br /&gt;
  |SUBMISSION || MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=12903 ilabs] &amp;lt;BR&amp;gt; External contact biomicro@mit.edu&lt;br /&gt;
  |-&lt;br /&gt;
  |DELIVERY || FASTQ, SAM, BAM, Cell:Gene matrix&lt;br /&gt;
  |-&lt;br /&gt;
  |UNIT || PER ARRAY&lt;br /&gt;
 |}&lt;br /&gt;
 |&lt;br /&gt;
The BioMicro Center collaborates closely with the Nanowell Core in the Koch Institute to provide support for the [https://shaleklab.com/resources/seq-well/ Seq-Well] protocol developed by Drs. Alex Shalek and Chris Love&#039;s groups. Seq-Well is based on the isolation of individual cells into microwells where cells are lysed and the associated mRNA is attached to polydT containing beads.  &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
Seq-Well projects can be brought in two ways. For full service, please use the ilabs form linked on the left. At the end of the form it asks you to select several days on which the experiment can be done. The Nanowell Core will review the possible dates with you to fit it in the schedule. On that date, the core will confirm the quality of your cells prior to beginning the experiment. While 10,000 cells are typically used in a Seq-Well experiment, the core requests you plan to bring more cells - often counts from flow cytometers and other instruments are incorrect. Planning to bring more cells ensures you have the 10,000 desired. The BioMicro Center becomes involved in these projects at the exonuclease treatment step, where we take over the preparation of the library and quality control, as well as sequencing and analysis.&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
Many laboratories are also using reagents from the Nanowell core to begin doing Seq-Well on their own. For these labs, we strongly recommend at least confirming the quality of the cDNA on our Advanced Analytical before continuing through library preparation. The library preparation can also be done in the BioMicro Center. Please use the standard Illumina library preparation form and note that the samples are Seq-Well. We do have all the custom primers needed for preparation and the pricing is identical to other NexteraXT preps. &lt;br /&gt;
|}&lt;br /&gt;
--&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:SingleCell&amp;diff=131757</id>
		<title>BioMicroCenter:SingleCell</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:SingleCell&amp;diff=131757"/>
		<updated>2026-07-28T16:46:04Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* scRNAseq / snRNAseq */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
 &lt;br /&gt;
[[File:SingleCellOptions.png|thumb|right|400px]]&lt;br /&gt;
The BioMicro Center supports a broad range of methods for single cell sequencing. The choice of method depends heavily on the type of question being asked and the source material. The methods break down into those supporting individual cells characterized in single wells and methods that use droplet isolation and library preparation. These cell requirements for each method vary significantly so reviewing each method is valuable and we strongly encourage consultation with BMC staff prior to beginning the experiment.&lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;.&lt;br /&gt;
 &lt;br /&gt;
 &lt;br /&gt;
== 10x CHROMIUM X ==&lt;br /&gt;
[[File:25_10xAssays.png|thumb|left|400px]]&lt;br /&gt;
The BioMicro Center provides access to 10x Genomics library preparation as an assisted or a walk-up service. Added in 2023, The 10x Chromium X can handle a broad variety of methodologies now including [https://www.10xgenomics.com/solutions/single-cell/ 3&#039;, 5&#039;  and fixed RNA sequencing], [https://www.10xgenomics.com/solutions/single-cell-atac/ ATAC and multiome] &amp;lt;!-- [https://www.10xgenomics.com/solutions/single-cell-cnv/ CNV]. --&amp;gt; Dropoff for assisted service is coordinated with Center staff with at least one week&#039;s lead time. Users should bring their single cell/nuclei suspension(s) in 1.5 mL microfuge tubes in the standard buffer at or around that time. Staff works with the user to intake the initial samples and proceed through the protocol with quality control checks at the appropriate steps. &lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
Chromium X usage is also offered as a walkup service. Usage may be scheduled on the iLabs calendar after training by BMC staff. This still requires at least a week&#039;s lead time before usage. You will not have permission to schedule the equipment until you have been approved by BMC staff. Reagents are stocked in the BioMicro Center and we ask that you use our reagents. This allows us to get larger bulk discounts we can pass on to our users. Please note that we do include a fraction of the instrument usage cost in the cost of the chips and will charge this cost if you use your own chips.&lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
The full 10x suite of software is installed on LURIA and is integrated into our analysis package. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
{|&lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;width: 450px;&amp;quot;|&lt;br /&gt;
=== scRNAseq / snRNAseq ===&lt;br /&gt;
&amp;lt;!-- A &amp;quot;setup&amp;quot; covers the chip, labor, and service contract. For Flex it also includes the GEMs. Samples per setup differ by assay - see Samples per setup row. --&amp;gt;&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !   &lt;br /&gt;
  ! 3&#039;RNA/5&#039;RNA &amp;lt;BR&amp;gt; (GEM-X)&lt;br /&gt;
  ! 3&#039;/5&#039; OnChipMultiplexing &amp;lt;BR&amp;gt; (OCM)&lt;br /&gt;
  ! Fixed RNA &amp;lt;BR&amp;gt; (Flex v2 / Apex)&lt;br /&gt;
  |-&lt;br /&gt;
  !INPUT &lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot;|&lt;br /&gt;
[https://www.10xgenomics.com/support/universal-three-prime-gene-expression/documentation/steps/sample-prep Freshly counted cells/nuclei in suspension.]&lt;br /&gt;
  |&lt;br /&gt;
[https://www.10xgenomics.com/support/flex-gene-expression/documentation/steps/sample-prep Fixed cells in suspension.] Also supports fresh, frozen, FFPE, fixed whole blood, and flow-sorted cells.&lt;br /&gt;
  |-&lt;br /&gt;
  !Cell Concentration &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; cells|nuclei/uL &amp;lt;/small&amp;gt;&lt;br /&gt;
  |100-5000&lt;br /&gt;
  |100-5000&lt;br /&gt;
  |25,000-300,000&lt;br /&gt;
  |-&lt;br /&gt;
  ! Fraction Recovered &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; est. percent of input cells captured &amp;lt;/small&amp;gt;&lt;br /&gt;
  | ~65%&lt;br /&gt;
  | ~60%&lt;br /&gt;
  | ~50%&lt;br /&gt;
  |-&lt;br /&gt;
  ! Target recovery &amp;lt;BR&amp;gt; &amp;lt;small&amp;gt; multiply by recovery for input &amp;lt;/small&amp;gt;&lt;br /&gt;
  | 500-20,000/lane&lt;br /&gt;
  | 500-5,000/lane &lt;br /&gt;
  | up to 20,000/sample&lt;br /&gt;
  |-&lt;br /&gt;
  ! Expected doublet rate @ Max load&lt;br /&gt;
  | 8%&lt;br /&gt;
  | 7.5%&lt;br /&gt;
  | 8% doublet @ 20k&lt;br /&gt;
  |-&lt;br /&gt;
  ! Samples per setup &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; A setup covers chip, labor, and service contract. Flex also includes GEMs. &amp;lt;/small&amp;gt;&lt;br /&gt;
  | 1-8 samples &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; 8 GEMs per chip &amp;lt;/small&amp;gt;&lt;br /&gt;
  | 1-8 samples &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; 4 lanes/batch → 2 GEMs per chip &amp;lt;/small&amp;gt;&lt;br /&gt;
  | up to ~48 samples &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; 1 GEM; ~1M cells captured; ~20k cells/index &amp;lt;/small&amp;gt;&lt;br /&gt;
  |-&lt;br /&gt;
  !ADD&#039;L AMPLICONS&lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot; |&lt;br /&gt;
Custom priming for CITEseq, CRISPRs (perturb-seq), TCR (5&#039;), BCR (5&#039;). &amp;lt;BR&amp;gt; Please provide custom oligos and protocols to core. &lt;br /&gt;
  |&lt;br /&gt;
Additional genes [https://www.10xgenomics.com/support/flex-gene-expression/documentation/steps/experimental-design-and-planning/custom-probe-design-for-visium-spatial-gene-expression-and-chromium-single-cell-gene-expression-flex require new probes.]&lt;br /&gt;
  |-&lt;br /&gt;
  ! KEY NOTES&lt;br /&gt;
  |&lt;br /&gt;
  | Batches of 4 samples&lt;br /&gt;
  | Human/Mouse only. &amp;lt;BR&amp;gt;&amp;lt;small&amp;gt; Probe-based: exogenous sequences (GFP, reporters, etc.) not captured without custom probes. &amp;lt;/small&amp;gt;&lt;br /&gt;
  |-&lt;br /&gt;
  !SUBMISSION FORMS&lt;br /&gt;
  |colspan=&amp;quot;3&amp;quot;| ASSISTED - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=12903 ilabs]  WALKUP - [https://mit.ilabsolutions.com/equipment/380963 Calendar]&lt;br /&gt;
  |-&lt;br /&gt;
  !DELIVERY &lt;br /&gt;
  |colspan=&amp;quot;3&amp;quot;| FASTQ, SAM, BAM, 10X QC, loupe file&lt;br /&gt;
  |-&lt;br /&gt;
  !DONATED BY &lt;br /&gt;
  |colspan=&amp;quot;3&amp;quot;| [http://mit.edu/manoli/ Prof. Manolis Kellis]&lt;br /&gt;
 |}&lt;br /&gt;
&lt;br /&gt;
=== CHROMATIN ===&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !   &lt;br /&gt;
  ! snATACseq&lt;br /&gt;
  ! multiome&lt;br /&gt;
  |-&lt;br /&gt;
  ! Input&lt;br /&gt;
  | colspan=2 |&lt;br /&gt;
* 160-8,000 nuclei/uL&lt;br /&gt;
* 50% estimated recovery&lt;br /&gt;
* 7.5% doublets @ 10k cells recovered&lt;br /&gt;
* 10uL minimum volume&lt;br /&gt;
 |-&lt;br /&gt;
 ! Multiplexing&lt;br /&gt;
 | colspan =2 | Not available&lt;br /&gt;
 |-&lt;br /&gt;
  !SUBMISSION FORMS&lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot;| ASSISTED - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=12903 ilabs]  WALKUP - [https://mit.ilabsolutions.com/equipment/380963 Calendar]&lt;br /&gt;
  |-&lt;br /&gt;
  !DELIVERY &lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot;| FASTQ, BAM, 10X QC, loupe file&lt;br /&gt;
 |}&lt;br /&gt;
 &lt;br /&gt;
|&lt;br /&gt;
 &lt;br /&gt;
=== 10X Genomics ===&lt;br /&gt;
[[image:10xX.jpg|thumb|right|500px|10x Chromium X]]&lt;br /&gt;
 &lt;br /&gt;
 &lt;br /&gt;
FAQs for Users &amp;lt;BR&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;1) What buffers in the final suspension are compatible with 10X applications?&#039;&#039;&#039; &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[https://kb.10xgenomics.com/s/article/115001937123-What-buffers-can-be-used-for-washing-and-cell-resuspension Buffers/media] for the submitted single cell/nuclei suspension should not contain excessive amounts of EDTA (&amp;gt;0.1 mM) or magnesium (&amp;gt;3 mM) and should be free of surfactants (i.e. Tween-20, SDS etc) and any RNases or DNases.&lt;br /&gt;
*1xPBS (calcium free and magnesium free) containing 0.04%  weight/volume BSA (400 µg/ml) is recommended for most general protocols and is considered the standard buffer&lt;br /&gt;
*Cell culture media with up to 1% BSA or up to 10% FBS if cells are not viable in standard buffer&lt;br /&gt;
*1xPBS (calcium free and magnesium free) containing up to 10% FBS for CMO labelling&lt;br /&gt;
*Nuclei also require addition of RNase Inhibitor along with 10X Genomics 1X nuclei buffer before chip loading, instructions for which are included in 10x user guides. If needed, users can collect buffer aliquots from the BMC after submitting a project. Please coordinate with BMC staff for pick-up. &amp;lt;br&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;2) How many cells are captured in the Assay?&#039;&#039;&#039;&lt;br /&gt;
&amp;lt;br&amp;gt;Up to 20,000 cells per GEM can be uniquely barcoded with GEM-X, but this highly depends on cell counts and viability. Dying cells will leak RNA, hence may not be captured efficiently leading to sample failures. We recommend to count cells at the BMC to avoid discrepancies, but can work with users&#039; counts as well. &amp;lt;BR&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;3) What are the best practices for flow sorting cells?&#039;&#039;&#039; &amp;lt;br&amp;gt; &lt;br /&gt;
10x provides guidance with their tested protocols about pre-sort buffer, collection buffer and FACS best practices [https://kb.10xgenomics.com/s/article/360048826911-What-are-the-best-practices-for-flow-sorting-cells-for-10x-Genomics-assays here.] &amp;lt;br&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;4) What is the expected size distribution for cDNA?&#039;&#039;&#039; &amp;lt;br&amp;gt;&lt;br /&gt;
cDNA for 3&#039; and 5&#039; libraries will span between 400 to 9000 base pairs, depending on sample type.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&#039;&#039;&#039;5) How much sequencing per sample is recommended?&#039;&#039;&#039; &amp;lt;br&amp;gt;&lt;br /&gt;
10x makes several recommendations in their [https://www.10xgenomics.com/support/epi-atac/documentation/steps/sequencing/sequencing-handbook sequencing handbook]. Recommendation numbers vary by sample type, expected CNPs per sample, assay type and general sample quality. The higher the CNPs, the higher the quality, the more likely increased read depth is required. &amp;lt;br&amp;gt;&lt;br /&gt;
For more resources, please visit https://kb.10xgenomics.com/s/ &amp;lt;br&amp;gt;&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
 &lt;br /&gt;
== NAMOCELL SINGLE CELL SORTER ==&lt;br /&gt;
 &lt;br /&gt;
{| align=left &lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;width: 300px;&amp;quot;|&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  ! INSTRUMENT|| NAMOCELL SINGLE CELL SORTER&lt;br /&gt;
  |-&lt;br /&gt;
  | TYPE || WALKUP - MIT only &amp;lt;BR&amp;gt; FACS&lt;br /&gt;
  |-&lt;br /&gt;
  | UNIT || Per Cartridge&lt;br /&gt;
  |-&lt;br /&gt;
  | LASER WAVELENGTH	||  488 nm&lt;br /&gt;
  |-&lt;br /&gt;
  | DETECTION CHANNELS&lt;br /&gt;
  |&lt;br /&gt;
* FL1 533 nm (FITC/GFP)&lt;br /&gt;
* FL2 585 nm (PE/PI)&lt;br /&gt;
* FL3 676 nm (PerCP)&lt;br /&gt;
  |-&lt;br /&gt;
  | DISPENSE VOLUME || 1 ul&lt;br /&gt;
  |-&lt;br /&gt;
  | SAMPLE VOLUME || 100-750 ul&lt;br /&gt;
  |-&lt;br /&gt;
  | CELL INPUT || single cell mode: 100-10,000 cells &lt;br /&gt;
  |-&lt;br /&gt;
  | FORMAT || 96w/384w&lt;br /&gt;
  |-&lt;br /&gt;
  | SIGNUP || [https://mit.ilabsolutions.com/equipment/show/370751/?tab=schedule ILABS]&lt;br /&gt;
  |-&lt;br /&gt;
  | NEW USERS ||  New users should request training by emailing biomicro@mit.edu&lt;br /&gt;
  |-&lt;br /&gt;
  | DONATED BY || Prof Linda Griffith&lt;br /&gt;
 |}&lt;br /&gt;
 |&lt;br /&gt;
[[image:Namo.jpg|thumb|right|Namo (Namocell) Bio-Techne]]&lt;br /&gt;
The [https://www.bio-techne.com/brands/namocell Namocell Single Cell Sorter] allows users to sort cells into plates. The sorter uses microfluidics to sort single cells in 1uL of sheath fluid into a well. The instrument uses disposable cartridges to minimize contamination. The instrument integrates well with the [[BioMicroCenter:Tecan_Freedom_Evo#SPT_LABTECH_MOSQUITO_HV|SPT Labtech Mosquito HV]] which handles small reaction volumes. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
|} &lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;.&lt;br /&gt;
 &lt;br /&gt;
&amp;lt;!-- AVITI24 high-output DISS (whole transcriptome single cell) section pending - not yet released --&amp;gt;&lt;br /&gt;
 &lt;br /&gt;
&amp;lt;!-- commenting out Seq-Well &lt;br /&gt;
== SEQ-WELL ==&lt;br /&gt;
{|&lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;width: 300px;&amp;quot;|&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !   &lt;br /&gt;
  !SEQ-WELL &lt;br /&gt;
  |-&lt;br /&gt;
  |INPUT&lt;br /&gt;
  |&lt;br /&gt;
* FULL PREP: &amp;lt;BR&amp;gt;50,000 single free cells. 90% viability&lt;br /&gt;
* EXO1 and AMP &amp;lt;BR&amp;gt; Tubes with cDNA attached to beads&lt;br /&gt;
* LIBRARY ONLY &amp;lt;BR&amp;gt; Amplified cDNA&lt;br /&gt;
  |-&lt;br /&gt;
  |THROUGHPUT &lt;br /&gt;
  |&lt;br /&gt;
* FULL PREP/EXO: 4 samples/day&lt;br /&gt;
* LIBRARY: 24 samples/day&lt;br /&gt;
  |-&lt;br /&gt;
  |INCLUDED || QC at cDNA stage, library generation.&lt;br /&gt;
  |-&lt;br /&gt;
  |RECOMMENDED SEQUENCING || NextSeq500 - 75nt kit - 2-4 samples/flowcell&lt;br /&gt;
  |-&lt;br /&gt;
  |SUBMISSION || MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=12903 ilabs] &amp;lt;BR&amp;gt; External contact biomicro@mit.edu&lt;br /&gt;
  |-&lt;br /&gt;
  |DELIVERY || FASTQ, SAM, BAM, Cell:Gene matrix&lt;br /&gt;
  |-&lt;br /&gt;
  |UNIT || PER ARRAY&lt;br /&gt;
 |}&lt;br /&gt;
 |&lt;br /&gt;
The BioMicro Center collaborates closely with the Nanowell Core in the Koch Institute to provide support for the [https://shaleklab.com/resources/seq-well/ Seq-Well] protocol developed by Drs. Alex Shalek and Chris Love&#039;s groups. Seq-Well is based on the isolation of individual cells into microwells where cells are lysed and the associated mRNA is attached to polydT containing beads.  &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
Seq-Well projects can be brought in two ways. For full service, please use the ilabs form linked on the left. At the end of the form it asks you to select several days on which the experiment can be done. The Nanowell Core will review the possible dates with you to fit it in the schedule. On that date, the core will confirm the quality of your cells prior to beginning the experiment. While 10,000 cells are typically used in a Seq-Well experiment, the core requests you plan to bring more cells - often counts from flow cytometers and other instruments are incorrect. Planning to bring more cells ensures you have the 10,000 desired. The BioMicro Center becomes involved in these projects at the exonuclease treatment step, where we take over the preparation of the library and quality control, as well as sequencing and analysis.&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
Many laboratories are also using reagents from the Nanowell core to begin doing Seq-Well on their own. For these labs, we strongly recommend at least confirming the quality of the cDNA on our Advanced Analytical before continuing through library preparation. The library preparation can also be done in the BioMicro Center. Please use the standard Illumina library preparation form and note that the samples are Seq-Well. We do have all the custom primers needed for preparation and the pricing is identical to other NexteraXT preps. &lt;br /&gt;
|}&lt;br /&gt;
--&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:RNA_HTL&amp;diff=131438</id>
		<title>BioMicroCenter:RNA HTL</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:RNA_HTL&amp;diff=131438"/>
		<updated>2026-05-01T18:49:23Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* 3&amp;#039;Digital Gene Expression */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
= High-throughput RNA Library Preparation =&lt;br /&gt;
&lt;br /&gt;
[[Image:DE_HTL_RNA.jpeg|thumb|right|400px|Increased biological replicates increases the power of analysis. (Liu et al. 2014 Bioinformatics 30(3): 301-4)]]&lt;br /&gt;
&lt;br /&gt;
The BioMicro Center offers high-throughput RNA library preparation [[BioMicroCenter:FAQ#STANDARD_versus_HIGH_THROUGHPUT_LIBRARY_PREPARATION|(HTL-RNA)]] for both standard input and low input samples. Together, these high-throughput methodologies provide a comprehensive set of options to address a diverse range of experiments investigating RNA biology. High-throughput library generation focuses on reducing price and processing time on a per sample basis. To do this, there are several key differences from our standard library preparation service. First, HTL-RNA services have set batch sizes (24 and 96) with fixed price points (i.e. charge for 16 samples will be the as 24 samples; similarly for 80 samples as 96). If under these batch sizes, DO MORE REPLICATES to simultaneously enhance experimental power and reduce price per sample. Some samples may fail and the cost of re-prepping those samples is NOT included in the quoted cost. Re-prep is only deemed necessary by the core where we have found evidence of a reagent failure. User request re-preps of individuals samples can be done by hand, but at a higher rate. HTL focuses on reducing price and processing time per sample, so some routine services provided with standard library preparation - such as initial and final quality control for all samples, sample arraying, or automatic re-prep of failed samples - are not built in. These services are available as add ons to the original service request. &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;Reminder: &amp;lt;/b&amp;gt; high throughput projects are treated with &amp;lt;b&amp;gt;one condition&amp;lt;/b&amp;gt; (PCR cycles, fragmentation time, etc...). They are meant for allowing high replicates of the same samples. High throughput submissions for projects with multiple sub-projects from separate individuals combined on the same plate result in a low success rate due to the different conditions for each sub project. Therefore, htl submissions from multiple projects will tolerate and may expect, failure rates well over 10%.&lt;br /&gt;
&lt;br /&gt;
== STANDARD INPUT RNA-SEQ (Eurkaryotic) ==&lt;br /&gt;
=== NEB Ultra II Directional RNA with Poly(A) Selection===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact total RNA ([[BioMicroCenter:RIN|RIN]] &amp;gt;8)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10ng - 100ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L nuclease-free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 2.5&amp;amp;micro;L nuclease-free water (day of submission)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RNA selection &amp;lt;br&amp;gt; cDNA synthesis &amp;lt;br&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II Directional RNA preparation with poly(A) selection is used to selectively capture mRNA from high-quality total RNA. The selection of mRNA transcripts occurs by hybridization of the poly(A)-tail to magnetic oligo-d(T) beads, which we have miniaturized to 1/6th the original reaction volume using our Tecan Freedom Evo. The purified RNA is then further processed at a 1/10th reaction volume on the Mosquito HV to reliably generate RNA-Seq libraries with inputs ranging from 10ng to 100ng (recommended input of &amp;gt; 50ng). Because this method is reliant on poly(A)-tails during RNA isolation the sample quality significantly impacts performance, as such high-quality samples are an absolute requirement. &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:PolyA_HTL.jpg | 350px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== NEB Ultra II Directional RNA with rRNA Depletion ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RIN|Intact]] or [[BioMicroCenter:RIN|degraded]] - &#039;&#039;&#039;Human/Mouse/Rat samples only!&#039;&#039;&#039;&amp;lt;br&amp;gt;&#039;&#039;(Bacterial in development)&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10ng - 100ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5&amp;amp;micro;L nuclease free water (day of submission)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RNA selection &amp;lt;br&amp;gt; cDNA synthesis &amp;lt;br&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II Directional RNA preparation with ribosomal RNA (rRNA) depletion is used to deplete rRNA by enzymatic degradation using single-stranded DNA probes that target rRNAs, leaving all other RNA species present and available for library preparation. This depletion method is agnostic to input sample quality and is the go-to method if samples don&#039;t meet quality requirements for poly(A) selection. We have  miniaturized this rRNA depletion method to 1/6th and the following RNA library preparation to 1/10th the original reaction volume on the Mosquito HV. This method is suited for inputs ranging from 5ng to 100ng (recommended input of &amp;gt; 50ng). Due to probe design used in the depletion, this method is currently only available for species where NEB has probes available.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:Depletion_HTL.jpg|350px]] &lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LOW INPUT RNA-SEQ (Eukaryotic)==&lt;br /&gt;
=== Cv2 ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cells or [[BioMicroCenter:RIN|intact]] low RNA input&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10pg - 250pg&amp;lt;br&amp;gt;(Or as available for single cells)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cells pre-arrayed across plate or [[BioMicroCenter:RNA_HTL#Normalization|normalized]] RNA&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;amp;ge;5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cell or RNA in 1&amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Up to 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] (w/ Nextera Flex) &amp;lt;br&amp;gt; 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |cDNA generation of poly(A) RNA &amp;lt;br&amp;gt;cDNA amplification&amp;lt;br&amp;gt;Spot check of cDNA&amp;lt;br&amp;gt;Library preparation (Nextera Flex or XT)&amp;lt;br&amp;gt;Spot check of final libraries  &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Our Cv2 prep is a &amp;quot;home-brew&amp;quot; version of Clontech&#039;s SMART-Seq kits which generates cDNA of full length transcripts from low inputs of RNA (i.e. single cell, dilute RNA sample). This workflow plugs into either our HTL [[BioMicroCenter:DNA_HTL#Nextera_Flex|Nextera Flex]] or [[BioMicroCenter:DNA_HTL#Nextera_XT|XT]] preps where the cDNA is tagmented and indexed.&amp;lt;br&amp;gt;&lt;br /&gt;
:This method uses oligo-d(T) priming to selectively process polyadenylated RNA which is then amplified by an initial round of PCR, making this prep ideal low-input high quality RNA or single cells. Due to the nature method, submissions should be coordinated with BMC to schedule sample drop-off of up to 384 samples to begin processing immediately in order to reduce possible loss/degradation of sample. &amp;lt;br&amp;gt;&lt;br /&gt;
[[Image:Cv2_BMC.jpg|center|350px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== ZapR ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RIN|Degraded]] low RNA input&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 250pg - 10ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&amp;lt;br&amp;gt;(&amp;amp;ge; 750 pg/&amp;amp;micro;L strongly recommended)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;amp;ge; 5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 1.5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | cDNA synthesis&amp;lt;br&amp;gt;cDNA amplification&amp;lt;br&amp;gt;cDNA selection&amp;lt;br&amp;gt;Library preparation&amp;lt;br&amp;gt;Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
|&lt;br /&gt;
:SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (ZapR) is used for library preparation of low input degraded RNA samples by generating and amplifying cDNA from total RNA, after which the ribosomal cDNA is depleted through targeted enzymatic degradation using ZapR probes while keeping all other cDNA for library preparation. This method is typically used for low concentration RNA samples of poor quality ([[BioMicroCenter:RIN|RIN]]&amp;lt;7 or [[BioMicroCenter:RIN|DV200]]&amp;lt;60%). We have miniaturized the ZapR method to 1/10th the original reaction volume on the Mosquito HV. This method is capable of handling inputs ranging from 250pg to 10ng (or 50ng for FFPE) however, performance for a given sample input is dependent on the quality of the sample itself. Due to the design of the ZapR probes, this method is only available for Human samples.&lt;br /&gt;
[[Image:ZapR_BMC.jpg|center|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Digital Gene Expression (DGE) ==&lt;br /&gt;
=== 3&#039;Digital Gene Expression ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:400px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |+ &#039;&#039;&#039;HT-3&#039;DGE&#039;&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact RNA ([[BioMicroCenter:RIN|RIN]] &amp;amp;ge; 7)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 5ng - 15ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] samples&amp;lt;br&amp;gt;(2ng/&amp;amp;micro;L)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10 &amp;amp;micro;L nuclease free water or 10mM Tris pH8 (EB)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5 &amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples&amp;lt;br&amp;gt;96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by row in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Element single lane per 96&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |24 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|COMBINATORIAL]] &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |cDNA generation of poly(A) RNA&amp;lt;br&amp;gt;QC check of cDNA&amp;lt;br&amp;gt;Library preparation (Nextera XT)&amp;lt;br&amp;gt;QC check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=4110 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
  |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:High-Throughput 3&#039; Digital Gene Expression (HT3DGE) uses a combination of molecular tagged indexes, SMARTseq chemistry and Nextera Tagmentation to produce libraries derived from the 3&#039; ends of transcripts.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
:The protocol is based on [http://dx.doi.org/10.1101/003236/ Soumillon et al.,] as part of a collaboration with the KI High-Throughput Screening Core. In limiting the sequence space used by the samples, fewer reads should be required for a good transcriptome.&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:HT3DGE uses a very early indexing step to tag each sample with a &amp;quot;well ID&amp;quot; and a molecular ID. Once tagged the samples are immediately pooled to minimize costs but failed samples cannot be easily reprepped and are not identifiable until sequencing. As such, the method is best suited for experiments where the NUMBER of samples is not limiting (material can be). The 3&#039; nature of the protocol also limits the utility of this method in splicing applications but it should be more robust to using imperfect RNA ([[BioMicroCenter:RIN|RIN]] 7+ instead of 9+ for standard RNAseq) &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Analysis of HT3DGE is not a standard method supported by most open source platforms. We have built pipelines to work with this data, but working closely with the Bioinformatics team is highly recommended.&lt;br /&gt;
 |&amp;lt;br&amp;gt;[[image:DGE_workflow.jpg|right|Standard 3&#039;DGE workflow.]] &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
[[image:HT3DGE_gene_example.jpg|right|Example 3&#039;DGE Data]]&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=USEFUL INFORMATION=&lt;br /&gt;
==RNA Pre-load Submissions==&lt;br /&gt;
:Describes samples that upon submission to the BMC can be immediately plugged into the preparatory method that has been specified in the project submission form. This option is provided to reduce library preparation costs and expedite sample processing by minimizing hands-on time by a BMC staff. The specific requirements are listed for each preparatory method in the tables above. These specifications must be met in order to qualify as a pre-load, submissions otherwise may be subject to additional charges.&amp;lt;br&amp;gt; &lt;br /&gt;
:Due to the nature of a pre-load submission, the entire volume of sample submitted will be used and as such, additional services are not typically offered unless coordinated with a BMC technician. It is important to keep this in mind when submitting precious samples and the BMC recommends to save a portion of sample when possibly. To avoid unnecessary RNA degradation, all RNA pre-loads should be setup the day of submission and be coordinated with BMC staff. These pre-loads should be prepared with extreme care to avoid possible contamination and reduce freeze thaw cycles to prevent degradation of the samples. Degraded or contaminated samples can have a significant impact on library preparation and sequencing results.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==Quadrant Layout==&lt;br /&gt;
:At the BioMicro Center, we organize our high-throughput projects in 384-well plates using a quadrant layout. With quadrant 1 (Q1) representing one 96-well plate, quadrant 2 (Q2) representing a second 96-well plate and so on up to Q4. We ask that plates being submitted start with Q1 and arrayed column-wise. Below are diagrams illustrating quadrant layouts.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{|style=&amp;quot;background: white;&amp;quot; border=&amp;quot;0&amp;quot; height=&amp;quot;230&amp;quot; align=&amp;quot;center&amp;quot; valign=&amp;quot;bottom&amp;quot; cellpadding=10px cellspacing=30px&lt;br /&gt;
|-align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
|&#039;&#039;&#039;Quadrant 1 of 384-well plate&#039;&#039;&#039; &amp;lt;br&amp;gt; [[IMAGE:Quadrant 1.jpg|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Normalization==&lt;br /&gt;
:Normalization is referring to bringing all samples to a uniform concentration. For library preparation, uniform input mass is necessary for proper library generation and as such, calculations for normalization should be based upon concentration in ng/&amp;amp;micro;L. This is in contrast to normalization for pooling of final libraries, where calculations are based upon concentration in nM since the number of molecules is important to achieve a desired read distribution when sequencing.&lt;br /&gt;
&lt;br /&gt;
==Unique versus Combinatorial Dual Indexing==&lt;br /&gt;
:Combinatorial dual indexing is a technique that uses a set of Index 1 (denoted as i7) and Index 2(denoted as i5) barcodes that are combined in a manner such that it produces distinct i7 and i5 pairs which increases multiplexing capacity for sequencing. With combinatorial dual indexes, each i7 and i5 is shared among other samples on the same plate, typically with i5&#039;s repeating across rows and i7&#039;s down columns. &#039;&#039;These combinations are unique but individual indexes used are not&#039;&#039;. However, a phenomenon known as &#039;index hopping&#039; has been observed when sequencing multiplexed libraries that followed single or combinatorial indexing schemes with newer Illumina platforms utilizing ExAmp chemistry such as the NovaSeq ([[Media:Index_Hopping.pdf |Costello et al., 2018]]). This swapping of indexes causes reads to be mis-assigned and subsequently excluded from further analysis. The primary strategy employed to mitigate the effects of index hopping is through the utilization of unique dual indexes.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Unique dual indexes (UDI) are non-redundant indexes where each i5 and i7 has a distinct index sequence. As opposed to combinatorial dual indexing, an i7 and i5 index is never repeated nor shared among other samples (i.e. for a 96-well UDI index plate, there are 96 unique i7&#039;s and 96 unique i5&#039;s). Both the combinations and individual indexes used are unique, and as a result the frequency of mis-assigned reads due to index hopping is greatly reduced. The BioMicro Center recommends that UDI&#039;s always be used when sequencing on the NovaSeq. The number of libraries that can be multiplexed and sequenced on a single lane is determined by the total number of UDI&#039;s provided for each library preparation method.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:RNA_HTL&amp;diff=131437</id>
		<title>BioMicroCenter:RNA HTL</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:RNA_HTL&amp;diff=131437"/>
		<updated>2026-05-01T18:48:55Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* 3&amp;#039;Digital Gene Expression */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
= High-throughput RNA Library Preparation =&lt;br /&gt;
&lt;br /&gt;
[[Image:DE_HTL_RNA.jpeg|thumb|right|400px|Increased biological replicates increases the power of analysis. (Liu et al. 2014 Bioinformatics 30(3): 301-4)]]&lt;br /&gt;
&lt;br /&gt;
The BioMicro Center offers high-throughput RNA library preparation [[BioMicroCenter:FAQ#STANDARD_versus_HIGH_THROUGHPUT_LIBRARY_PREPARATION|(HTL-RNA)]] for both standard input and low input samples. Together, these high-throughput methodologies provide a comprehensive set of options to address a diverse range of experiments investigating RNA biology. High-throughput library generation focuses on reducing price and processing time on a per sample basis. To do this, there are several key differences from our standard library preparation service. First, HTL-RNA services have set batch sizes (24 and 96) with fixed price points (i.e. charge for 16 samples will be the as 24 samples; similarly for 80 samples as 96). If under these batch sizes, DO MORE REPLICATES to simultaneously enhance experimental power and reduce price per sample. Some samples may fail and the cost of re-prepping those samples is NOT included in the quoted cost. Re-prep is only deemed necessary by the core where we have found evidence of a reagent failure. User request re-preps of individuals samples can be done by hand, but at a higher rate. HTL focuses on reducing price and processing time per sample, so some routine services provided with standard library preparation - such as initial and final quality control for all samples, sample arraying, or automatic re-prep of failed samples - are not built in. These services are available as add ons to the original service request. &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;Reminder: &amp;lt;/b&amp;gt; high throughput projects are treated with &amp;lt;b&amp;gt;one condition&amp;lt;/b&amp;gt; (PCR cycles, fragmentation time, etc...). They are meant for allowing high replicates of the same samples. High throughput submissions for projects with multiple sub-projects from separate individuals combined on the same plate result in a low success rate due to the different conditions for each sub project. Therefore, htl submissions from multiple projects will tolerate and may expect, failure rates well over 10%.&lt;br /&gt;
&lt;br /&gt;
== STANDARD INPUT RNA-SEQ (Eurkaryotic) ==&lt;br /&gt;
=== NEB Ultra II Directional RNA with Poly(A) Selection===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact total RNA ([[BioMicroCenter:RIN|RIN]] &amp;gt;8)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10ng - 100ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L nuclease-free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 2.5&amp;amp;micro;L nuclease-free water (day of submission)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RNA selection &amp;lt;br&amp;gt; cDNA synthesis &amp;lt;br&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II Directional RNA preparation with poly(A) selection is used to selectively capture mRNA from high-quality total RNA. The selection of mRNA transcripts occurs by hybridization of the poly(A)-tail to magnetic oligo-d(T) beads, which we have miniaturized to 1/6th the original reaction volume using our Tecan Freedom Evo. The purified RNA is then further processed at a 1/10th reaction volume on the Mosquito HV to reliably generate RNA-Seq libraries with inputs ranging from 10ng to 100ng (recommended input of &amp;gt; 50ng). Because this method is reliant on poly(A)-tails during RNA isolation the sample quality significantly impacts performance, as such high-quality samples are an absolute requirement. &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:PolyA_HTL.jpg | 350px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== NEB Ultra II Directional RNA with rRNA Depletion ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RIN|Intact]] or [[BioMicroCenter:RIN|degraded]] - &#039;&#039;&#039;Human/Mouse/Rat samples only!&#039;&#039;&#039;&amp;lt;br&amp;gt;&#039;&#039;(Bacterial in development)&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10ng - 100ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5&amp;amp;micro;L nuclease free water (day of submission)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RNA selection &amp;lt;br&amp;gt; cDNA synthesis &amp;lt;br&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II Directional RNA preparation with ribosomal RNA (rRNA) depletion is used to deplete rRNA by enzymatic degradation using single-stranded DNA probes that target rRNAs, leaving all other RNA species present and available for library preparation. This depletion method is agnostic to input sample quality and is the go-to method if samples don&#039;t meet quality requirements for poly(A) selection. We have  miniaturized this rRNA depletion method to 1/6th and the following RNA library preparation to 1/10th the original reaction volume on the Mosquito HV. This method is suited for inputs ranging from 5ng to 100ng (recommended input of &amp;gt; 50ng). Due to probe design used in the depletion, this method is currently only available for species where NEB has probes available.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:Depletion_HTL.jpg|350px]] &lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LOW INPUT RNA-SEQ (Eukaryotic)==&lt;br /&gt;
=== Cv2 ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cells or [[BioMicroCenter:RIN|intact]] low RNA input&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10pg - 250pg&amp;lt;br&amp;gt;(Or as available for single cells)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cells pre-arrayed across plate or [[BioMicroCenter:RNA_HTL#Normalization|normalized]] RNA&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;amp;ge;5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cell or RNA in 1&amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Up to 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] (w/ Nextera Flex) &amp;lt;br&amp;gt; 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |cDNA generation of poly(A) RNA &amp;lt;br&amp;gt;cDNA amplification&amp;lt;br&amp;gt;Spot check of cDNA&amp;lt;br&amp;gt;Library preparation (Nextera Flex or XT)&amp;lt;br&amp;gt;Spot check of final libraries  &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Our Cv2 prep is a &amp;quot;home-brew&amp;quot; version of Clontech&#039;s SMART-Seq kits which generates cDNA of full length transcripts from low inputs of RNA (i.e. single cell, dilute RNA sample). This workflow plugs into either our HTL [[BioMicroCenter:DNA_HTL#Nextera_Flex|Nextera Flex]] or [[BioMicroCenter:DNA_HTL#Nextera_XT|XT]] preps where the cDNA is tagmented and indexed.&amp;lt;br&amp;gt;&lt;br /&gt;
:This method uses oligo-d(T) priming to selectively process polyadenylated RNA which is then amplified by an initial round of PCR, making this prep ideal low-input high quality RNA or single cells. Due to the nature method, submissions should be coordinated with BMC to schedule sample drop-off of up to 384 samples to begin processing immediately in order to reduce possible loss/degradation of sample. &amp;lt;br&amp;gt;&lt;br /&gt;
[[Image:Cv2_BMC.jpg|center|350px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== ZapR ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RIN|Degraded]] low RNA input&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 250pg - 10ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&amp;lt;br&amp;gt;(&amp;amp;ge; 750 pg/&amp;amp;micro;L strongly recommended)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;amp;ge; 5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 1.5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | cDNA synthesis&amp;lt;br&amp;gt;cDNA amplification&amp;lt;br&amp;gt;cDNA selection&amp;lt;br&amp;gt;Library preparation&amp;lt;br&amp;gt;Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
|&lt;br /&gt;
:SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (ZapR) is used for library preparation of low input degraded RNA samples by generating and amplifying cDNA from total RNA, after which the ribosomal cDNA is depleted through targeted enzymatic degradation using ZapR probes while keeping all other cDNA for library preparation. This method is typically used for low concentration RNA samples of poor quality ([[BioMicroCenter:RIN|RIN]]&amp;lt;7 or [[BioMicroCenter:RIN|DV200]]&amp;lt;60%). We have miniaturized the ZapR method to 1/10th the original reaction volume on the Mosquito HV. This method is capable of handling inputs ranging from 250pg to 10ng (or 50ng for FFPE) however, performance for a given sample input is dependent on the quality of the sample itself. Due to the design of the ZapR probes, this method is only available for Human samples.&lt;br /&gt;
[[Image:ZapR_BMC.jpg|center|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Digital Gene Expression (DGE) ==&lt;br /&gt;
=== 3&#039;Digital Gene Expression ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:400px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |+ &#039;&#039;&#039;HT-3&#039;DGE&#039;&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact RNA ([[BioMicroCenter:RIN|RIN]] &amp;amp;ge; 7)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 5ng - 15ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] samples&amp;lt;br&amp;gt;(2ng/&amp;amp;micro;L)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10 &amp;amp;micro;L nuclease free water or 10mM Tris pH8 (EB)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5 &amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples&amp;lt;br&amp;gt;96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by row in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Element single lane per 96&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |24 COMBINATORIAL [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |cDNA generation of poly(A) RNA&amp;lt;br&amp;gt;QC check of cDNA&amp;lt;br&amp;gt;Library preparation (Nextera XT)&amp;lt;br&amp;gt;QC check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=4110 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
  |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:High-Throughput 3&#039; Digital Gene Expression (HT3DGE) uses a combination of molecular tagged indexes, SMARTseq chemistry and Nextera Tagmentation to produce libraries derived from the 3&#039; ends of transcripts.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
:The protocol is based on [http://dx.doi.org/10.1101/003236/ Soumillon et al.,] as part of a collaboration with the KI High-Throughput Screening Core. In limiting the sequence space used by the samples, fewer reads should be required for a good transcriptome.&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:HT3DGE uses a very early indexing step to tag each sample with a &amp;quot;well ID&amp;quot; and a molecular ID. Once tagged the samples are immediately pooled to minimize costs but failed samples cannot be easily reprepped and are not identifiable until sequencing. As such, the method is best suited for experiments where the NUMBER of samples is not limiting (material can be). The 3&#039; nature of the protocol also limits the utility of this method in splicing applications but it should be more robust to using imperfect RNA ([[BioMicroCenter:RIN|RIN]] 7+ instead of 9+ for standard RNAseq) &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Analysis of HT3DGE is not a standard method supported by most open source platforms. We have built pipelines to work with this data, but working closely with the Bioinformatics team is highly recommended.&lt;br /&gt;
 |&amp;lt;br&amp;gt;[[image:DGE_workflow.jpg|right|Standard 3&#039;DGE workflow.]] &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
[[image:HT3DGE_gene_example.jpg|right|Example 3&#039;DGE Data]]&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=USEFUL INFORMATION=&lt;br /&gt;
==RNA Pre-load Submissions==&lt;br /&gt;
:Describes samples that upon submission to the BMC can be immediately plugged into the preparatory method that has been specified in the project submission form. This option is provided to reduce library preparation costs and expedite sample processing by minimizing hands-on time by a BMC staff. The specific requirements are listed for each preparatory method in the tables above. These specifications must be met in order to qualify as a pre-load, submissions otherwise may be subject to additional charges.&amp;lt;br&amp;gt; &lt;br /&gt;
:Due to the nature of a pre-load submission, the entire volume of sample submitted will be used and as such, additional services are not typically offered unless coordinated with a BMC technician. It is important to keep this in mind when submitting precious samples and the BMC recommends to save a portion of sample when possibly. To avoid unnecessary RNA degradation, all RNA pre-loads should be setup the day of submission and be coordinated with BMC staff. These pre-loads should be prepared with extreme care to avoid possible contamination and reduce freeze thaw cycles to prevent degradation of the samples. Degraded or contaminated samples can have a significant impact on library preparation and sequencing results.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==Quadrant Layout==&lt;br /&gt;
:At the BioMicro Center, we organize our high-throughput projects in 384-well plates using a quadrant layout. With quadrant 1 (Q1) representing one 96-well plate, quadrant 2 (Q2) representing a second 96-well plate and so on up to Q4. We ask that plates being submitted start with Q1 and arrayed column-wise. Below are diagrams illustrating quadrant layouts.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{|style=&amp;quot;background: white;&amp;quot; border=&amp;quot;0&amp;quot; height=&amp;quot;230&amp;quot; align=&amp;quot;center&amp;quot; valign=&amp;quot;bottom&amp;quot; cellpadding=10px cellspacing=30px&lt;br /&gt;
|-align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
|&#039;&#039;&#039;Quadrant 1 of 384-well plate&#039;&#039;&#039; &amp;lt;br&amp;gt; [[IMAGE:Quadrant 1.jpg|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Normalization==&lt;br /&gt;
:Normalization is referring to bringing all samples to a uniform concentration. For library preparation, uniform input mass is necessary for proper library generation and as such, calculations for normalization should be based upon concentration in ng/&amp;amp;micro;L. This is in contrast to normalization for pooling of final libraries, where calculations are based upon concentration in nM since the number of molecules is important to achieve a desired read distribution when sequencing.&lt;br /&gt;
&lt;br /&gt;
==Unique versus Combinatorial Dual Indexing==&lt;br /&gt;
:Combinatorial dual indexing is a technique that uses a set of Index 1 (denoted as i7) and Index 2(denoted as i5) barcodes that are combined in a manner such that it produces distinct i7 and i5 pairs which increases multiplexing capacity for sequencing. With combinatorial dual indexes, each i7 and i5 is shared among other samples on the same plate, typically with i5&#039;s repeating across rows and i7&#039;s down columns. &#039;&#039;These combinations are unique but individual indexes used are not&#039;&#039;. However, a phenomenon known as &#039;index hopping&#039; has been observed when sequencing multiplexed libraries that followed single or combinatorial indexing schemes with newer Illumina platforms utilizing ExAmp chemistry such as the NovaSeq ([[Media:Index_Hopping.pdf |Costello et al., 2018]]). This swapping of indexes causes reads to be mis-assigned and subsequently excluded from further analysis. The primary strategy employed to mitigate the effects of index hopping is through the utilization of unique dual indexes.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Unique dual indexes (UDI) are non-redundant indexes where each i5 and i7 has a distinct index sequence. As opposed to combinatorial dual indexing, an i7 and i5 index is never repeated nor shared among other samples (i.e. for a 96-well UDI index plate, there are 96 unique i7&#039;s and 96 unique i5&#039;s). Both the combinations and individual indexes used are unique, and as a result the frequency of mis-assigned reads due to index hopping is greatly reduced. The BioMicro Center recommends that UDI&#039;s always be used when sequencing on the NovaSeq. The number of libraries that can be multiplexed and sequenced on a single lane is determined by the total number of UDI&#039;s provided for each library preparation method.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:RNA_HTL&amp;diff=131436</id>
		<title>BioMicroCenter:RNA HTL</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:RNA_HTL&amp;diff=131436"/>
		<updated>2026-04-30T18:52:42Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* 3&amp;#039;Digital Gene Expression */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
= High-throughput RNA Library Preparation =&lt;br /&gt;
&lt;br /&gt;
[[Image:DE_HTL_RNA.jpeg|thumb|right|400px|Increased biological replicates increases the power of analysis. (Liu et al. 2014 Bioinformatics 30(3): 301-4)]]&lt;br /&gt;
&lt;br /&gt;
The BioMicro Center offers high-throughput RNA library preparation [[BioMicroCenter:FAQ#STANDARD_versus_HIGH_THROUGHPUT_LIBRARY_PREPARATION|(HTL-RNA)]] for both standard input and low input samples. Together, these high-throughput methodologies provide a comprehensive set of options to address a diverse range of experiments investigating RNA biology. High-throughput library generation focuses on reducing price and processing time on a per sample basis. To do this, there are several key differences from our standard library preparation service. First, HTL-RNA services have set batch sizes (24 and 96) with fixed price points (i.e. charge for 16 samples will be the as 24 samples; similarly for 80 samples as 96). If under these batch sizes, DO MORE REPLICATES to simultaneously enhance experimental power and reduce price per sample. Some samples may fail and the cost of re-prepping those samples is NOT included in the quoted cost. Re-prep is only deemed necessary by the core where we have found evidence of a reagent failure. User request re-preps of individuals samples can be done by hand, but at a higher rate. HTL focuses on reducing price and processing time per sample, so some routine services provided with standard library preparation - such as initial and final quality control for all samples, sample arraying, or automatic re-prep of failed samples - are not built in. These services are available as add ons to the original service request. &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;Reminder: &amp;lt;/b&amp;gt; high throughput projects are treated with &amp;lt;b&amp;gt;one condition&amp;lt;/b&amp;gt; (PCR cycles, fragmentation time, etc...). They are meant for allowing high replicates of the same samples. High throughput submissions for projects with multiple sub-projects from separate individuals combined on the same plate result in a low success rate due to the different conditions for each sub project. Therefore, htl submissions from multiple projects will tolerate and may expect, failure rates well over 10%.&lt;br /&gt;
&lt;br /&gt;
== STANDARD INPUT RNA-SEQ (Eurkaryotic) ==&lt;br /&gt;
=== NEB Ultra II Directional RNA with Poly(A) Selection===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact total RNA ([[BioMicroCenter:RIN|RIN]] &amp;gt;8)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10ng - 100ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L nuclease-free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 2.5&amp;amp;micro;L nuclease-free water (day of submission)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RNA selection &amp;lt;br&amp;gt; cDNA synthesis &amp;lt;br&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II Directional RNA preparation with poly(A) selection is used to selectively capture mRNA from high-quality total RNA. The selection of mRNA transcripts occurs by hybridization of the poly(A)-tail to magnetic oligo-d(T) beads, which we have miniaturized to 1/6th the original reaction volume using our Tecan Freedom Evo. The purified RNA is then further processed at a 1/10th reaction volume on the Mosquito HV to reliably generate RNA-Seq libraries with inputs ranging from 10ng to 100ng (recommended input of &amp;gt; 50ng). Because this method is reliant on poly(A)-tails during RNA isolation the sample quality significantly impacts performance, as such high-quality samples are an absolute requirement. &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:PolyA_HTL.jpg | 350px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== NEB Ultra II Directional RNA with rRNA Depletion ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RIN|Intact]] or [[BioMicroCenter:RIN|degraded]] - &#039;&#039;&#039;Human/Mouse/Rat samples only!&#039;&#039;&#039;&amp;lt;br&amp;gt;&#039;&#039;(Bacterial in development)&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10ng - 100ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5&amp;amp;micro;L nuclease free water (day of submission)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RNA selection &amp;lt;br&amp;gt; cDNA synthesis &amp;lt;br&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II Directional RNA preparation with ribosomal RNA (rRNA) depletion is used to deplete rRNA by enzymatic degradation using single-stranded DNA probes that target rRNAs, leaving all other RNA species present and available for library preparation. This depletion method is agnostic to input sample quality and is the go-to method if samples don&#039;t meet quality requirements for poly(A) selection. We have  miniaturized this rRNA depletion method to 1/6th and the following RNA library preparation to 1/10th the original reaction volume on the Mosquito HV. This method is suited for inputs ranging from 5ng to 100ng (recommended input of &amp;gt; 50ng). Due to probe design used in the depletion, this method is currently only available for species where NEB has probes available.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:Depletion_HTL.jpg|350px]] &lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LOW INPUT RNA-SEQ (Eukaryotic)==&lt;br /&gt;
=== Cv2 ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cells or [[BioMicroCenter:RIN|intact]] low RNA input&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10pg - 250pg&amp;lt;br&amp;gt;(Or as available for single cells)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cells pre-arrayed across plate or [[BioMicroCenter:RNA_HTL#Normalization|normalized]] RNA&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;amp;ge;5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cell or RNA in 1&amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Up to 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] (w/ Nextera Flex) &amp;lt;br&amp;gt; 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |cDNA generation of poly(A) RNA &amp;lt;br&amp;gt;cDNA amplification&amp;lt;br&amp;gt;Spot check of cDNA&amp;lt;br&amp;gt;Library preparation (Nextera Flex or XT)&amp;lt;br&amp;gt;Spot check of final libraries  &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Our Cv2 prep is a &amp;quot;home-brew&amp;quot; version of Clontech&#039;s SMART-Seq kits which generates cDNA of full length transcripts from low inputs of RNA (i.e. single cell, dilute RNA sample). This workflow plugs into either our HTL [[BioMicroCenter:DNA_HTL#Nextera_Flex|Nextera Flex]] or [[BioMicroCenter:DNA_HTL#Nextera_XT|XT]] preps where the cDNA is tagmented and indexed.&amp;lt;br&amp;gt;&lt;br /&gt;
:This method uses oligo-d(T) priming to selectively process polyadenylated RNA which is then amplified by an initial round of PCR, making this prep ideal low-input high quality RNA or single cells. Due to the nature method, submissions should be coordinated with BMC to schedule sample drop-off of up to 384 samples to begin processing immediately in order to reduce possible loss/degradation of sample. &amp;lt;br&amp;gt;&lt;br /&gt;
[[Image:Cv2_BMC.jpg|center|350px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== ZapR ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RIN|Degraded]] low RNA input&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 250pg - 10ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&amp;lt;br&amp;gt;(&amp;amp;ge; 750 pg/&amp;amp;micro;L strongly recommended)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;amp;ge; 5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 1.5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | cDNA synthesis&amp;lt;br&amp;gt;cDNA amplification&amp;lt;br&amp;gt;cDNA selection&amp;lt;br&amp;gt;Library preparation&amp;lt;br&amp;gt;Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
|&lt;br /&gt;
:SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (ZapR) is used for library preparation of low input degraded RNA samples by generating and amplifying cDNA from total RNA, after which the ribosomal cDNA is depleted through targeted enzymatic degradation using ZapR probes while keeping all other cDNA for library preparation. This method is typically used for low concentration RNA samples of poor quality ([[BioMicroCenter:RIN|RIN]]&amp;lt;7 or [[BioMicroCenter:RIN|DV200]]&amp;lt;60%). We have miniaturized the ZapR method to 1/10th the original reaction volume on the Mosquito HV. This method is capable of handling inputs ranging from 250pg to 10ng (or 50ng for FFPE) however, performance for a given sample input is dependent on the quality of the sample itself. Due to the design of the ZapR probes, this method is only available for Human samples.&lt;br /&gt;
[[Image:ZapR_BMC.jpg|center|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Digital Gene Expression (DGE) ==&lt;br /&gt;
=== 3&#039;Digital Gene Expression ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:400px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |+ &#039;&#039;&#039;HT-3&#039;DGE&#039;&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact RNA ([[BioMicroCenter:RIN|RIN]] &amp;amp;ge; 7)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 5ng - 15ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] samples&amp;lt;br&amp;gt;(2ng/&amp;amp;micro;L)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10 &amp;amp;micro;L nuclease free water or 10mM Tris pH8 (EB)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5 &amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples&amp;lt;br&amp;gt;96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by row in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Element single lane per 96&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |16 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 96 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |cDNA generation of poly(A) RNA&amp;lt;br&amp;gt;QC check of cDNA&amp;lt;br&amp;gt;Library preparation (Nextera XT)&amp;lt;br&amp;gt;QC check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=4110 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
  |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:High-Throughput 3&#039; Digital Gene Expression (HT3DGE) uses a combination of molecular tagged indexes, SMARTseq chemistry and Nextera Tagmentation to produce libraries derived from the 3&#039; ends of transcripts.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
:The protocol is based on [http://dx.doi.org/10.1101/003236/ Soumillon et al.,] as part of a collaboration with the KI High-Throughput Screening Core. In limiting the sequence space used by the samples, fewer reads should be required for a good transcriptome.&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:HT3DGE uses a very early indexing step to tag each sample with a &amp;quot;well ID&amp;quot; and a molecular ID. Once tagged the samples are immediately pooled to minimize costs but failed samples cannot be easily reprepped and are not identifiable until sequencing. As such, the method is best suited for experiments where the NUMBER of samples is not limiting (material can be). The 3&#039; nature of the protocol also limits the utility of this method in splicing applications but it should be more robust to using imperfect RNA ([[BioMicroCenter:RIN|RIN]] 7+ instead of 9+ for standard RNAseq) &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Analysis of HT3DGE is not a standard method supported by most open source platforms. We have built pipelines to work with this data, but working closely with the Bioinformatics team is highly recommended.&lt;br /&gt;
 |&amp;lt;br&amp;gt;[[image:DGE_workflow.jpg|right|Standard 3&#039;DGE workflow.]] &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
[[image:HT3DGE_gene_example.jpg|right|Example 3&#039;DGE Data]]&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=USEFUL INFORMATION=&lt;br /&gt;
==RNA Pre-load Submissions==&lt;br /&gt;
:Describes samples that upon submission to the BMC can be immediately plugged into the preparatory method that has been specified in the project submission form. This option is provided to reduce library preparation costs and expedite sample processing by minimizing hands-on time by a BMC staff. The specific requirements are listed for each preparatory method in the tables above. These specifications must be met in order to qualify as a pre-load, submissions otherwise may be subject to additional charges.&amp;lt;br&amp;gt; &lt;br /&gt;
:Due to the nature of a pre-load submission, the entire volume of sample submitted will be used and as such, additional services are not typically offered unless coordinated with a BMC technician. It is important to keep this in mind when submitting precious samples and the BMC recommends to save a portion of sample when possibly. To avoid unnecessary RNA degradation, all RNA pre-loads should be setup the day of submission and be coordinated with BMC staff. These pre-loads should be prepared with extreme care to avoid possible contamination and reduce freeze thaw cycles to prevent degradation of the samples. Degraded or contaminated samples can have a significant impact on library preparation and sequencing results.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==Quadrant Layout==&lt;br /&gt;
:At the BioMicro Center, we organize our high-throughput projects in 384-well plates using a quadrant layout. With quadrant 1 (Q1) representing one 96-well plate, quadrant 2 (Q2) representing a second 96-well plate and so on up to Q4. We ask that plates being submitted start with Q1 and arrayed column-wise. Below are diagrams illustrating quadrant layouts.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{|style=&amp;quot;background: white;&amp;quot; border=&amp;quot;0&amp;quot; height=&amp;quot;230&amp;quot; align=&amp;quot;center&amp;quot; valign=&amp;quot;bottom&amp;quot; cellpadding=10px cellspacing=30px&lt;br /&gt;
|-align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
|&#039;&#039;&#039;Quadrant 1 of 384-well plate&#039;&#039;&#039; &amp;lt;br&amp;gt; [[IMAGE:Quadrant 1.jpg|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Normalization==&lt;br /&gt;
:Normalization is referring to bringing all samples to a uniform concentration. For library preparation, uniform input mass is necessary for proper library generation and as such, calculations for normalization should be based upon concentration in ng/&amp;amp;micro;L. This is in contrast to normalization for pooling of final libraries, where calculations are based upon concentration in nM since the number of molecules is important to achieve a desired read distribution when sequencing.&lt;br /&gt;
&lt;br /&gt;
==Unique versus Combinatorial Dual Indexing==&lt;br /&gt;
:Combinatorial dual indexing is a technique that uses a set of Index 1 (denoted as i7) and Index 2(denoted as i5) barcodes that are combined in a manner such that it produces distinct i7 and i5 pairs which increases multiplexing capacity for sequencing. With combinatorial dual indexes, each i7 and i5 is shared among other samples on the same plate, typically with i5&#039;s repeating across rows and i7&#039;s down columns. &#039;&#039;These combinations are unique but individual indexes used are not&#039;&#039;. However, a phenomenon known as &#039;index hopping&#039; has been observed when sequencing multiplexed libraries that followed single or combinatorial indexing schemes with newer Illumina platforms utilizing ExAmp chemistry such as the NovaSeq ([[Media:Index_Hopping.pdf |Costello et al., 2018]]). This swapping of indexes causes reads to be mis-assigned and subsequently excluded from further analysis. The primary strategy employed to mitigate the effects of index hopping is through the utilization of unique dual indexes.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Unique dual indexes (UDI) are non-redundant indexes where each i5 and i7 has a distinct index sequence. As opposed to combinatorial dual indexing, an i7 and i5 index is never repeated nor shared among other samples (i.e. for a 96-well UDI index plate, there are 96 unique i7&#039;s and 96 unique i5&#039;s). Both the combinations and individual indexes used are unique, and as a result the frequency of mis-assigned reads due to index hopping is greatly reduced. The BioMicro Center recommends that UDI&#039;s always be used when sequencing on the NovaSeq. The number of libraries that can be multiplexed and sequenced on a single lane is determined by the total number of UDI&#039;s provided for each library preparation method.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:RNA_HTL&amp;diff=131435</id>
		<title>BioMicroCenter:RNA HTL</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:RNA_HTL&amp;diff=131435"/>
		<updated>2026-04-30T18:52:16Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* ZapR */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
= High-throughput RNA Library Preparation =&lt;br /&gt;
&lt;br /&gt;
[[Image:DE_HTL_RNA.jpeg|thumb|right|400px|Increased biological replicates increases the power of analysis. (Liu et al. 2014 Bioinformatics 30(3): 301-4)]]&lt;br /&gt;
&lt;br /&gt;
The BioMicro Center offers high-throughput RNA library preparation [[BioMicroCenter:FAQ#STANDARD_versus_HIGH_THROUGHPUT_LIBRARY_PREPARATION|(HTL-RNA)]] for both standard input and low input samples. Together, these high-throughput methodologies provide a comprehensive set of options to address a diverse range of experiments investigating RNA biology. High-throughput library generation focuses on reducing price and processing time on a per sample basis. To do this, there are several key differences from our standard library preparation service. First, HTL-RNA services have set batch sizes (24 and 96) with fixed price points (i.e. charge for 16 samples will be the as 24 samples; similarly for 80 samples as 96). If under these batch sizes, DO MORE REPLICATES to simultaneously enhance experimental power and reduce price per sample. Some samples may fail and the cost of re-prepping those samples is NOT included in the quoted cost. Re-prep is only deemed necessary by the core where we have found evidence of a reagent failure. User request re-preps of individuals samples can be done by hand, but at a higher rate. HTL focuses on reducing price and processing time per sample, so some routine services provided with standard library preparation - such as initial and final quality control for all samples, sample arraying, or automatic re-prep of failed samples - are not built in. These services are available as add ons to the original service request. &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;Reminder: &amp;lt;/b&amp;gt; high throughput projects are treated with &amp;lt;b&amp;gt;one condition&amp;lt;/b&amp;gt; (PCR cycles, fragmentation time, etc...). They are meant for allowing high replicates of the same samples. High throughput submissions for projects with multiple sub-projects from separate individuals combined on the same plate result in a low success rate due to the different conditions for each sub project. Therefore, htl submissions from multiple projects will tolerate and may expect, failure rates well over 10%.&lt;br /&gt;
&lt;br /&gt;
== STANDARD INPUT RNA-SEQ (Eurkaryotic) ==&lt;br /&gt;
=== NEB Ultra II Directional RNA with Poly(A) Selection===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact total RNA ([[BioMicroCenter:RIN|RIN]] &amp;gt;8)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10ng - 100ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L nuclease-free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 2.5&amp;amp;micro;L nuclease-free water (day of submission)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RNA selection &amp;lt;br&amp;gt; cDNA synthesis &amp;lt;br&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II Directional RNA preparation with poly(A) selection is used to selectively capture mRNA from high-quality total RNA. The selection of mRNA transcripts occurs by hybridization of the poly(A)-tail to magnetic oligo-d(T) beads, which we have miniaturized to 1/6th the original reaction volume using our Tecan Freedom Evo. The purified RNA is then further processed at a 1/10th reaction volume on the Mosquito HV to reliably generate RNA-Seq libraries with inputs ranging from 10ng to 100ng (recommended input of &amp;gt; 50ng). Because this method is reliant on poly(A)-tails during RNA isolation the sample quality significantly impacts performance, as such high-quality samples are an absolute requirement. &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:PolyA_HTL.jpg | 350px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== NEB Ultra II Directional RNA with rRNA Depletion ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RIN|Intact]] or [[BioMicroCenter:RIN|degraded]] - &#039;&#039;&#039;Human/Mouse/Rat samples only!&#039;&#039;&#039;&amp;lt;br&amp;gt;&#039;&#039;(Bacterial in development)&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10ng - 100ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5&amp;amp;micro;L nuclease free water (day of submission)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RNA selection &amp;lt;br&amp;gt; cDNA synthesis &amp;lt;br&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II Directional RNA preparation with ribosomal RNA (rRNA) depletion is used to deplete rRNA by enzymatic degradation using single-stranded DNA probes that target rRNAs, leaving all other RNA species present and available for library preparation. This depletion method is agnostic to input sample quality and is the go-to method if samples don&#039;t meet quality requirements for poly(A) selection. We have  miniaturized this rRNA depletion method to 1/6th and the following RNA library preparation to 1/10th the original reaction volume on the Mosquito HV. This method is suited for inputs ranging from 5ng to 100ng (recommended input of &amp;gt; 50ng). Due to probe design used in the depletion, this method is currently only available for species where NEB has probes available.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:Depletion_HTL.jpg|350px]] &lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LOW INPUT RNA-SEQ (Eukaryotic)==&lt;br /&gt;
=== Cv2 ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cells or [[BioMicroCenter:RIN|intact]] low RNA input&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10pg - 250pg&amp;lt;br&amp;gt;(Or as available for single cells)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cells pre-arrayed across plate or [[BioMicroCenter:RNA_HTL#Normalization|normalized]] RNA&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;amp;ge;5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cell or RNA in 1&amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Up to 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] (w/ Nextera Flex) &amp;lt;br&amp;gt; 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |cDNA generation of poly(A) RNA &amp;lt;br&amp;gt;cDNA amplification&amp;lt;br&amp;gt;Spot check of cDNA&amp;lt;br&amp;gt;Library preparation (Nextera Flex or XT)&amp;lt;br&amp;gt;Spot check of final libraries  &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Our Cv2 prep is a &amp;quot;home-brew&amp;quot; version of Clontech&#039;s SMART-Seq kits which generates cDNA of full length transcripts from low inputs of RNA (i.e. single cell, dilute RNA sample). This workflow plugs into either our HTL [[BioMicroCenter:DNA_HTL#Nextera_Flex|Nextera Flex]] or [[BioMicroCenter:DNA_HTL#Nextera_XT|XT]] preps where the cDNA is tagmented and indexed.&amp;lt;br&amp;gt;&lt;br /&gt;
:This method uses oligo-d(T) priming to selectively process polyadenylated RNA which is then amplified by an initial round of PCR, making this prep ideal low-input high quality RNA or single cells. Due to the nature method, submissions should be coordinated with BMC to schedule sample drop-off of up to 384 samples to begin processing immediately in order to reduce possible loss/degradation of sample. &amp;lt;br&amp;gt;&lt;br /&gt;
[[Image:Cv2_BMC.jpg|center|350px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== ZapR ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RIN|Degraded]] low RNA input&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 250pg - 10ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&amp;lt;br&amp;gt;(&amp;amp;ge; 750 pg/&amp;amp;micro;L strongly recommended)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;amp;ge; 5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 1.5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | cDNA synthesis&amp;lt;br&amp;gt;cDNA amplification&amp;lt;br&amp;gt;cDNA selection&amp;lt;br&amp;gt;Library preparation&amp;lt;br&amp;gt;Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
|&lt;br /&gt;
:SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (ZapR) is used for library preparation of low input degraded RNA samples by generating and amplifying cDNA from total RNA, after which the ribosomal cDNA is depleted through targeted enzymatic degradation using ZapR probes while keeping all other cDNA for library preparation. This method is typically used for low concentration RNA samples of poor quality ([[BioMicroCenter:RIN|RIN]]&amp;lt;7 or [[BioMicroCenter:RIN|DV200]]&amp;lt;60%). We have miniaturized the ZapR method to 1/10th the original reaction volume on the Mosquito HV. This method is capable of handling inputs ranging from 250pg to 10ng (or 50ng for FFPE) however, performance for a given sample input is dependent on the quality of the sample itself. Due to the design of the ZapR probes, this method is only available for Human samples.&lt;br /&gt;
[[Image:ZapR_BMC.jpg|center|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Digital Gene Expression (DGE) ==&lt;br /&gt;
=== 3&#039;Digital Gene Expression ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:400px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |+ &#039;&#039;&#039;HT-3&#039;DGE&#039;&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact RNA ([[BioMicroCenter:RIN|RIN]] &amp;amp;ge; 7)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 5ng - 15ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] samples&amp;lt;br&amp;gt;(2ng/&amp;amp;micro;L)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10 &amp;amp;micro;L nuclease free water or 10mM Tris pH8 (EB)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5 &amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples&amp;lt;br&amp;gt;96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by row in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | NextSeq&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |16 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 96 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |cDNA generation of poly(A) RNA&amp;lt;br&amp;gt;QC check of cDNA&amp;lt;br&amp;gt;Library preparation (Nextera XT)&amp;lt;br&amp;gt;QC check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=4110 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
  |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:High-Throughput 3&#039; Digital Gene Expression (HT3DGE) uses a combination of molecular tagged indexes, SMARTseq chemistry and Nextera Tagmentation to produce libraries derived from the 3&#039; ends of transcripts.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
:The protocol is based on [http://dx.doi.org/10.1101/003236/ Soumillon et al.,] as part of a collaboration with the KI High-Throughput Screening Core. In limiting the sequence space used by the samples, fewer reads should be required for a good transcriptome.&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:HT3DGE uses a very early indexing step to tag each sample with a &amp;quot;well ID&amp;quot; and a molecular ID. Once tagged the samples are immediately pooled to minimize costs but failed samples cannot be easily reprepped and are not identifiable until sequencing. As such, the method is best suited for experiments where the NUMBER of samples is not limiting (material can be). The 3&#039; nature of the protocol also limits the utility of this method in splicing applications but it should be more robust to using imperfect RNA ([[BioMicroCenter:RIN|RIN]] 7+ instead of 9+ for standard RNAseq) &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Analysis of HT3DGE is not a standard method supported by most open source platforms. We have built pipelines to work with this data, but working closely with the Bioinformatics team is highly recommended.&lt;br /&gt;
 |&amp;lt;br&amp;gt;[[image:DGE_workflow.jpg|right|Standard 3&#039;DGE workflow.]] &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
[[image:HT3DGE_gene_example.jpg|right|Example 3&#039;DGE Data]]&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=USEFUL INFORMATION=&lt;br /&gt;
==RNA Pre-load Submissions==&lt;br /&gt;
:Describes samples that upon submission to the BMC can be immediately plugged into the preparatory method that has been specified in the project submission form. This option is provided to reduce library preparation costs and expedite sample processing by minimizing hands-on time by a BMC staff. The specific requirements are listed for each preparatory method in the tables above. These specifications must be met in order to qualify as a pre-load, submissions otherwise may be subject to additional charges.&amp;lt;br&amp;gt; &lt;br /&gt;
:Due to the nature of a pre-load submission, the entire volume of sample submitted will be used and as such, additional services are not typically offered unless coordinated with a BMC technician. It is important to keep this in mind when submitting precious samples and the BMC recommends to save a portion of sample when possibly. To avoid unnecessary RNA degradation, all RNA pre-loads should be setup the day of submission and be coordinated with BMC staff. These pre-loads should be prepared with extreme care to avoid possible contamination and reduce freeze thaw cycles to prevent degradation of the samples. Degraded or contaminated samples can have a significant impact on library preparation and sequencing results.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==Quadrant Layout==&lt;br /&gt;
:At the BioMicro Center, we organize our high-throughput projects in 384-well plates using a quadrant layout. With quadrant 1 (Q1) representing one 96-well plate, quadrant 2 (Q2) representing a second 96-well plate and so on up to Q4. We ask that plates being submitted start with Q1 and arrayed column-wise. Below are diagrams illustrating quadrant layouts.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{|style=&amp;quot;background: white;&amp;quot; border=&amp;quot;0&amp;quot; height=&amp;quot;230&amp;quot; align=&amp;quot;center&amp;quot; valign=&amp;quot;bottom&amp;quot; cellpadding=10px cellspacing=30px&lt;br /&gt;
|-align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
|&#039;&#039;&#039;Quadrant 1 of 384-well plate&#039;&#039;&#039; &amp;lt;br&amp;gt; [[IMAGE:Quadrant 1.jpg|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Normalization==&lt;br /&gt;
:Normalization is referring to bringing all samples to a uniform concentration. For library preparation, uniform input mass is necessary for proper library generation and as such, calculations for normalization should be based upon concentration in ng/&amp;amp;micro;L. This is in contrast to normalization for pooling of final libraries, where calculations are based upon concentration in nM since the number of molecules is important to achieve a desired read distribution when sequencing.&lt;br /&gt;
&lt;br /&gt;
==Unique versus Combinatorial Dual Indexing==&lt;br /&gt;
:Combinatorial dual indexing is a technique that uses a set of Index 1 (denoted as i7) and Index 2(denoted as i5) barcodes that are combined in a manner such that it produces distinct i7 and i5 pairs which increases multiplexing capacity for sequencing. With combinatorial dual indexes, each i7 and i5 is shared among other samples on the same plate, typically with i5&#039;s repeating across rows and i7&#039;s down columns. &#039;&#039;These combinations are unique but individual indexes used are not&#039;&#039;. However, a phenomenon known as &#039;index hopping&#039; has been observed when sequencing multiplexed libraries that followed single or combinatorial indexing schemes with newer Illumina platforms utilizing ExAmp chemistry such as the NovaSeq ([[Media:Index_Hopping.pdf |Costello et al., 2018]]). This swapping of indexes causes reads to be mis-assigned and subsequently excluded from further analysis. The primary strategy employed to mitigate the effects of index hopping is through the utilization of unique dual indexes.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Unique dual indexes (UDI) are non-redundant indexes where each i5 and i7 has a distinct index sequence. As opposed to combinatorial dual indexing, an i7 and i5 index is never repeated nor shared among other samples (i.e. for a 96-well UDI index plate, there are 96 unique i7&#039;s and 96 unique i5&#039;s). Both the combinations and individual indexes used are unique, and as a result the frequency of mis-assigned reads due to index hopping is greatly reduced. The BioMicro Center recommends that UDI&#039;s always be used when sequencing on the NovaSeq. The number of libraries that can be multiplexed and sequenced on a single lane is determined by the total number of UDI&#039;s provided for each library preparation method.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:RNA_HTL&amp;diff=131434</id>
		<title>BioMicroCenter:RNA HTL</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:RNA_HTL&amp;diff=131434"/>
		<updated>2026-04-30T18:52:05Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* ZapR */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
= High-throughput RNA Library Preparation =&lt;br /&gt;
&lt;br /&gt;
[[Image:DE_HTL_RNA.jpeg|thumb|right|400px|Increased biological replicates increases the power of analysis. (Liu et al. 2014 Bioinformatics 30(3): 301-4)]]&lt;br /&gt;
&lt;br /&gt;
The BioMicro Center offers high-throughput RNA library preparation [[BioMicroCenter:FAQ#STANDARD_versus_HIGH_THROUGHPUT_LIBRARY_PREPARATION|(HTL-RNA)]] for both standard input and low input samples. Together, these high-throughput methodologies provide a comprehensive set of options to address a diverse range of experiments investigating RNA biology. High-throughput library generation focuses on reducing price and processing time on a per sample basis. To do this, there are several key differences from our standard library preparation service. First, HTL-RNA services have set batch sizes (24 and 96) with fixed price points (i.e. charge for 16 samples will be the as 24 samples; similarly for 80 samples as 96). If under these batch sizes, DO MORE REPLICATES to simultaneously enhance experimental power and reduce price per sample. Some samples may fail and the cost of re-prepping those samples is NOT included in the quoted cost. Re-prep is only deemed necessary by the core where we have found evidence of a reagent failure. User request re-preps of individuals samples can be done by hand, but at a higher rate. HTL focuses on reducing price and processing time per sample, so some routine services provided with standard library preparation - such as initial and final quality control for all samples, sample arraying, or automatic re-prep of failed samples - are not built in. These services are available as add ons to the original service request. &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;Reminder: &amp;lt;/b&amp;gt; high throughput projects are treated with &amp;lt;b&amp;gt;one condition&amp;lt;/b&amp;gt; (PCR cycles, fragmentation time, etc...). They are meant for allowing high replicates of the same samples. High throughput submissions for projects with multiple sub-projects from separate individuals combined on the same plate result in a low success rate due to the different conditions for each sub project. Therefore, htl submissions from multiple projects will tolerate and may expect, failure rates well over 10%.&lt;br /&gt;
&lt;br /&gt;
== STANDARD INPUT RNA-SEQ (Eurkaryotic) ==&lt;br /&gt;
=== NEB Ultra II Directional RNA with Poly(A) Selection===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact total RNA ([[BioMicroCenter:RIN|RIN]] &amp;gt;8)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10ng - 100ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L nuclease-free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 2.5&amp;amp;micro;L nuclease-free water (day of submission)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RNA selection &amp;lt;br&amp;gt; cDNA synthesis &amp;lt;br&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II Directional RNA preparation with poly(A) selection is used to selectively capture mRNA from high-quality total RNA. The selection of mRNA transcripts occurs by hybridization of the poly(A)-tail to magnetic oligo-d(T) beads, which we have miniaturized to 1/6th the original reaction volume using our Tecan Freedom Evo. The purified RNA is then further processed at a 1/10th reaction volume on the Mosquito HV to reliably generate RNA-Seq libraries with inputs ranging from 10ng to 100ng (recommended input of &amp;gt; 50ng). Because this method is reliant on poly(A)-tails during RNA isolation the sample quality significantly impacts performance, as such high-quality samples are an absolute requirement. &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:PolyA_HTL.jpg | 350px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== NEB Ultra II Directional RNA with rRNA Depletion ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RIN|Intact]] or [[BioMicroCenter:RIN|degraded]] - &#039;&#039;&#039;Human/Mouse/Rat samples only!&#039;&#039;&#039;&amp;lt;br&amp;gt;&#039;&#039;(Bacterial in development)&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10ng - 100ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5&amp;amp;micro;L nuclease free water (day of submission)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RNA selection &amp;lt;br&amp;gt; cDNA synthesis &amp;lt;br&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II Directional RNA preparation with ribosomal RNA (rRNA) depletion is used to deplete rRNA by enzymatic degradation using single-stranded DNA probes that target rRNAs, leaving all other RNA species present and available for library preparation. This depletion method is agnostic to input sample quality and is the go-to method if samples don&#039;t meet quality requirements for poly(A) selection. We have  miniaturized this rRNA depletion method to 1/6th and the following RNA library preparation to 1/10th the original reaction volume on the Mosquito HV. This method is suited for inputs ranging from 5ng to 100ng (recommended input of &amp;gt; 50ng). Due to probe design used in the depletion, this method is currently only available for species where NEB has probes available.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:Depletion_HTL.jpg|350px]] &lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LOW INPUT RNA-SEQ (Eukaryotic)==&lt;br /&gt;
=== Cv2 ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cells or [[BioMicroCenter:RIN|intact]] low RNA input&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10pg - 250pg&amp;lt;br&amp;gt;(Or as available for single cells)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cells pre-arrayed across plate or [[BioMicroCenter:RNA_HTL#Normalization|normalized]] RNA&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;amp;ge;5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cell or RNA in 1&amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Up to 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] (w/ Nextera Flex) &amp;lt;br&amp;gt; 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |cDNA generation of poly(A) RNA &amp;lt;br&amp;gt;cDNA amplification&amp;lt;br&amp;gt;Spot check of cDNA&amp;lt;br&amp;gt;Library preparation (Nextera Flex or XT)&amp;lt;br&amp;gt;Spot check of final libraries  &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Our Cv2 prep is a &amp;quot;home-brew&amp;quot; version of Clontech&#039;s SMART-Seq kits which generates cDNA of full length transcripts from low inputs of RNA (i.e. single cell, dilute RNA sample). This workflow plugs into either our HTL [[BioMicroCenter:DNA_HTL#Nextera_Flex|Nextera Flex]] or [[BioMicroCenter:DNA_HTL#Nextera_XT|XT]] preps where the cDNA is tagmented and indexed.&amp;lt;br&amp;gt;&lt;br /&gt;
:This method uses oligo-d(T) priming to selectively process polyadenylated RNA which is then amplified by an initial round of PCR, making this prep ideal low-input high quality RNA or single cells. Due to the nature method, submissions should be coordinated with BMC to schedule sample drop-off of up to 384 samples to begin processing immediately in order to reduce possible loss/degradation of sample. &amp;lt;br&amp;gt;&lt;br /&gt;
[[Image:Cv2_BMC.jpg|center|350px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== ZapR ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RIN|Degraded]] low RNA input&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 250pg - 10ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&amp;lt;br&amp;gt;(&amp;amp;ge; 750 pg/&amp;amp;micro;L strongly recommended)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;amp;ge; 5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 1.5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 384[[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | cDNA synthesis&amp;lt;br&amp;gt;cDNA amplification&amp;lt;br&amp;gt;cDNA selection&amp;lt;br&amp;gt;Library preparation&amp;lt;br&amp;gt;Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
|&lt;br /&gt;
:SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (ZapR) is used for library preparation of low input degraded RNA samples by generating and amplifying cDNA from total RNA, after which the ribosomal cDNA is depleted through targeted enzymatic degradation using ZapR probes while keeping all other cDNA for library preparation. This method is typically used for low concentration RNA samples of poor quality ([[BioMicroCenter:RIN|RIN]]&amp;lt;7 or [[BioMicroCenter:RIN|DV200]]&amp;lt;60%). We have miniaturized the ZapR method to 1/10th the original reaction volume on the Mosquito HV. This method is capable of handling inputs ranging from 250pg to 10ng (or 50ng for FFPE) however, performance for a given sample input is dependent on the quality of the sample itself. Due to the design of the ZapR probes, this method is only available for Human samples.&lt;br /&gt;
[[Image:ZapR_BMC.jpg|center|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Digital Gene Expression (DGE) ==&lt;br /&gt;
=== 3&#039;Digital Gene Expression ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:400px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |+ &#039;&#039;&#039;HT-3&#039;DGE&#039;&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact RNA ([[BioMicroCenter:RIN|RIN]] &amp;amp;ge; 7)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 5ng - 15ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] samples&amp;lt;br&amp;gt;(2ng/&amp;amp;micro;L)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10 &amp;amp;micro;L nuclease free water or 10mM Tris pH8 (EB)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5 &amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples&amp;lt;br&amp;gt;96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by row in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | NextSeq&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |16 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 96 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |cDNA generation of poly(A) RNA&amp;lt;br&amp;gt;QC check of cDNA&amp;lt;br&amp;gt;Library preparation (Nextera XT)&amp;lt;br&amp;gt;QC check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=4110 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
  |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:High-Throughput 3&#039; Digital Gene Expression (HT3DGE) uses a combination of molecular tagged indexes, SMARTseq chemistry and Nextera Tagmentation to produce libraries derived from the 3&#039; ends of transcripts.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
:The protocol is based on [http://dx.doi.org/10.1101/003236/ Soumillon et al.,] as part of a collaboration with the KI High-Throughput Screening Core. In limiting the sequence space used by the samples, fewer reads should be required for a good transcriptome.&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:HT3DGE uses a very early indexing step to tag each sample with a &amp;quot;well ID&amp;quot; and a molecular ID. Once tagged the samples are immediately pooled to minimize costs but failed samples cannot be easily reprepped and are not identifiable until sequencing. As such, the method is best suited for experiments where the NUMBER of samples is not limiting (material can be). The 3&#039; nature of the protocol also limits the utility of this method in splicing applications but it should be more robust to using imperfect RNA ([[BioMicroCenter:RIN|RIN]] 7+ instead of 9+ for standard RNAseq) &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Analysis of HT3DGE is not a standard method supported by most open source platforms. We have built pipelines to work with this data, but working closely with the Bioinformatics team is highly recommended.&lt;br /&gt;
 |&amp;lt;br&amp;gt;[[image:DGE_workflow.jpg|right|Standard 3&#039;DGE workflow.]] &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
[[image:HT3DGE_gene_example.jpg|right|Example 3&#039;DGE Data]]&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=USEFUL INFORMATION=&lt;br /&gt;
==RNA Pre-load Submissions==&lt;br /&gt;
:Describes samples that upon submission to the BMC can be immediately plugged into the preparatory method that has been specified in the project submission form. This option is provided to reduce library preparation costs and expedite sample processing by minimizing hands-on time by a BMC staff. The specific requirements are listed for each preparatory method in the tables above. These specifications must be met in order to qualify as a pre-load, submissions otherwise may be subject to additional charges.&amp;lt;br&amp;gt; &lt;br /&gt;
:Due to the nature of a pre-load submission, the entire volume of sample submitted will be used and as such, additional services are not typically offered unless coordinated with a BMC technician. It is important to keep this in mind when submitting precious samples and the BMC recommends to save a portion of sample when possibly. To avoid unnecessary RNA degradation, all RNA pre-loads should be setup the day of submission and be coordinated with BMC staff. These pre-loads should be prepared with extreme care to avoid possible contamination and reduce freeze thaw cycles to prevent degradation of the samples. Degraded or contaminated samples can have a significant impact on library preparation and sequencing results.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==Quadrant Layout==&lt;br /&gt;
:At the BioMicro Center, we organize our high-throughput projects in 384-well plates using a quadrant layout. With quadrant 1 (Q1) representing one 96-well plate, quadrant 2 (Q2) representing a second 96-well plate and so on up to Q4. We ask that plates being submitted start with Q1 and arrayed column-wise. Below are diagrams illustrating quadrant layouts.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{|style=&amp;quot;background: white;&amp;quot; border=&amp;quot;0&amp;quot; height=&amp;quot;230&amp;quot; align=&amp;quot;center&amp;quot; valign=&amp;quot;bottom&amp;quot; cellpadding=10px cellspacing=30px&lt;br /&gt;
|-align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
|&#039;&#039;&#039;Quadrant 1 of 384-well plate&#039;&#039;&#039; &amp;lt;br&amp;gt; [[IMAGE:Quadrant 1.jpg|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Normalization==&lt;br /&gt;
:Normalization is referring to bringing all samples to a uniform concentration. For library preparation, uniform input mass is necessary for proper library generation and as such, calculations for normalization should be based upon concentration in ng/&amp;amp;micro;L. This is in contrast to normalization for pooling of final libraries, where calculations are based upon concentration in nM since the number of molecules is important to achieve a desired read distribution when sequencing.&lt;br /&gt;
&lt;br /&gt;
==Unique versus Combinatorial Dual Indexing==&lt;br /&gt;
:Combinatorial dual indexing is a technique that uses a set of Index 1 (denoted as i7) and Index 2(denoted as i5) barcodes that are combined in a manner such that it produces distinct i7 and i5 pairs which increases multiplexing capacity for sequencing. With combinatorial dual indexes, each i7 and i5 is shared among other samples on the same plate, typically with i5&#039;s repeating across rows and i7&#039;s down columns. &#039;&#039;These combinations are unique but individual indexes used are not&#039;&#039;. However, a phenomenon known as &#039;index hopping&#039; has been observed when sequencing multiplexed libraries that followed single or combinatorial indexing schemes with newer Illumina platforms utilizing ExAmp chemistry such as the NovaSeq ([[Media:Index_Hopping.pdf |Costello et al., 2018]]). This swapping of indexes causes reads to be mis-assigned and subsequently excluded from further analysis. The primary strategy employed to mitigate the effects of index hopping is through the utilization of unique dual indexes.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Unique dual indexes (UDI) are non-redundant indexes where each i5 and i7 has a distinct index sequence. As opposed to combinatorial dual indexing, an i7 and i5 index is never repeated nor shared among other samples (i.e. for a 96-well UDI index plate, there are 96 unique i7&#039;s and 96 unique i5&#039;s). Both the combinations and individual indexes used are unique, and as a result the frequency of mis-assigned reads due to index hopping is greatly reduced. The BioMicro Center recommends that UDI&#039;s always be used when sequencing on the NovaSeq. The number of libraries that can be multiplexed and sequenced on a single lane is determined by the total number of UDI&#039;s provided for each library preparation method.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:RNA_HTL&amp;diff=131433</id>
		<title>BioMicroCenter:RNA HTL</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:RNA_HTL&amp;diff=131433"/>
		<updated>2026-04-30T18:50:45Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* NEB Ultra II Directional RNA with rRNA Depletion */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
= High-throughput RNA Library Preparation =&lt;br /&gt;
&lt;br /&gt;
[[Image:DE_HTL_RNA.jpeg|thumb|right|400px|Increased biological replicates increases the power of analysis. (Liu et al. 2014 Bioinformatics 30(3): 301-4)]]&lt;br /&gt;
&lt;br /&gt;
The BioMicro Center offers high-throughput RNA library preparation [[BioMicroCenter:FAQ#STANDARD_versus_HIGH_THROUGHPUT_LIBRARY_PREPARATION|(HTL-RNA)]] for both standard input and low input samples. Together, these high-throughput methodologies provide a comprehensive set of options to address a diverse range of experiments investigating RNA biology. High-throughput library generation focuses on reducing price and processing time on a per sample basis. To do this, there are several key differences from our standard library preparation service. First, HTL-RNA services have set batch sizes (24 and 96) with fixed price points (i.e. charge for 16 samples will be the as 24 samples; similarly for 80 samples as 96). If under these batch sizes, DO MORE REPLICATES to simultaneously enhance experimental power and reduce price per sample. Some samples may fail and the cost of re-prepping those samples is NOT included in the quoted cost. Re-prep is only deemed necessary by the core where we have found evidence of a reagent failure. User request re-preps of individuals samples can be done by hand, but at a higher rate. HTL focuses on reducing price and processing time per sample, so some routine services provided with standard library preparation - such as initial and final quality control for all samples, sample arraying, or automatic re-prep of failed samples - are not built in. These services are available as add ons to the original service request. &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;Reminder: &amp;lt;/b&amp;gt; high throughput projects are treated with &amp;lt;b&amp;gt;one condition&amp;lt;/b&amp;gt; (PCR cycles, fragmentation time, etc...). They are meant for allowing high replicates of the same samples. High throughput submissions for projects with multiple sub-projects from separate individuals combined on the same plate result in a low success rate due to the different conditions for each sub project. Therefore, htl submissions from multiple projects will tolerate and may expect, failure rates well over 10%.&lt;br /&gt;
&lt;br /&gt;
== STANDARD INPUT RNA-SEQ (Eurkaryotic) ==&lt;br /&gt;
=== NEB Ultra II Directional RNA with Poly(A) Selection===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact total RNA ([[BioMicroCenter:RIN|RIN]] &amp;gt;8)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10ng - 100ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L nuclease-free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 2.5&amp;amp;micro;L nuclease-free water (day of submission)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RNA selection &amp;lt;br&amp;gt; cDNA synthesis &amp;lt;br&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II Directional RNA preparation with poly(A) selection is used to selectively capture mRNA from high-quality total RNA. The selection of mRNA transcripts occurs by hybridization of the poly(A)-tail to magnetic oligo-d(T) beads, which we have miniaturized to 1/6th the original reaction volume using our Tecan Freedom Evo. The purified RNA is then further processed at a 1/10th reaction volume on the Mosquito HV to reliably generate RNA-Seq libraries with inputs ranging from 10ng to 100ng (recommended input of &amp;gt; 50ng). Because this method is reliant on poly(A)-tails during RNA isolation the sample quality significantly impacts performance, as such high-quality samples are an absolute requirement. &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:PolyA_HTL.jpg | 350px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== NEB Ultra II Directional RNA with rRNA Depletion ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RIN|Intact]] or [[BioMicroCenter:RIN|degraded]] - &#039;&#039;&#039;Human/Mouse/Rat samples only!&#039;&#039;&#039;&amp;lt;br&amp;gt;&#039;&#039;(Bacterial in development)&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10ng - 100ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5&amp;amp;micro;L nuclease free water (day of submission)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RNA selection &amp;lt;br&amp;gt; cDNA synthesis &amp;lt;br&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II Directional RNA preparation with ribosomal RNA (rRNA) depletion is used to deplete rRNA by enzymatic degradation using single-stranded DNA probes that target rRNAs, leaving all other RNA species present and available for library preparation. This depletion method is agnostic to input sample quality and is the go-to method if samples don&#039;t meet quality requirements for poly(A) selection. We have  miniaturized this rRNA depletion method to 1/6th and the following RNA library preparation to 1/10th the original reaction volume on the Mosquito HV. This method is suited for inputs ranging from 5ng to 100ng (recommended input of &amp;gt; 50ng). Due to probe design used in the depletion, this method is currently only available for species where NEB has probes available.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:Depletion_HTL.jpg|350px]] &lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LOW INPUT RNA-SEQ (Eukaryotic)==&lt;br /&gt;
=== Cv2 ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cells or [[BioMicroCenter:RIN|intact]] low RNA input&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10pg - 250pg&amp;lt;br&amp;gt;(Or as available for single cells)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cells pre-arrayed across plate or [[BioMicroCenter:RNA_HTL#Normalization|normalized]] RNA&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;amp;ge;5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cell or RNA in 1&amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Up to 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] (w/ Nextera Flex) &amp;lt;br&amp;gt; 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |cDNA generation of poly(A) RNA &amp;lt;br&amp;gt;cDNA amplification&amp;lt;br&amp;gt;Spot check of cDNA&amp;lt;br&amp;gt;Library preparation (Nextera Flex or XT)&amp;lt;br&amp;gt;Spot check of final libraries  &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Our Cv2 prep is a &amp;quot;home-brew&amp;quot; version of Clontech&#039;s SMART-Seq kits which generates cDNA of full length transcripts from low inputs of RNA (i.e. single cell, dilute RNA sample). This workflow plugs into either our HTL [[BioMicroCenter:DNA_HTL#Nextera_Flex|Nextera Flex]] or [[BioMicroCenter:DNA_HTL#Nextera_XT|XT]] preps where the cDNA is tagmented and indexed.&amp;lt;br&amp;gt;&lt;br /&gt;
:This method uses oligo-d(T) priming to selectively process polyadenylated RNA which is then amplified by an initial round of PCR, making this prep ideal low-input high quality RNA or single cells. Due to the nature method, submissions should be coordinated with BMC to schedule sample drop-off of up to 384 samples to begin processing immediately in order to reduce possible loss/degradation of sample. &amp;lt;br&amp;gt;&lt;br /&gt;
[[Image:Cv2_BMC.jpg|center|350px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== ZapR ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RIN|Degraded]] low RNA input&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 250pg - 10ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&amp;lt;br&amp;gt;(&amp;amp;ge; 750 pg/&amp;amp;micro;L strongly recommended)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;amp;ge; 5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 1.5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |16 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 96 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | cDNA synthesis&amp;lt;br&amp;gt;cDNA amplification&amp;lt;br&amp;gt;cDNA selection&amp;lt;br&amp;gt;Library preparation&amp;lt;br&amp;gt;Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
|&lt;br /&gt;
:SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (ZapR) is used for library preparation of low input degraded RNA samples by generating and amplifying cDNA from total RNA, after which the ribosomal cDNA is depleted through targeted enzymatic degradation using ZapR probes while keeping all other cDNA for library preparation. This method is typically used for low concentration RNA samples of poor quality ([[BioMicroCenter:RIN|RIN]]&amp;lt;7 or [[BioMicroCenter:RIN|DV200]]&amp;lt;60%). We have miniaturized the ZapR method to 1/10th the original reaction volume on the Mosquito HV. This method is capable of handling inputs ranging from 250pg to 10ng (or 50ng for FFPE) however, performance for a given sample input is dependent on the quality of the sample itself. Due to the design of the ZapR probes, this method is only available for Human samples.&lt;br /&gt;
[[Image:ZapR_BMC.jpg|center|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Digital Gene Expression (DGE) ==&lt;br /&gt;
=== 3&#039;Digital Gene Expression ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:400px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |+ &#039;&#039;&#039;HT-3&#039;DGE&#039;&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact RNA ([[BioMicroCenter:RIN|RIN]] &amp;amp;ge; 7)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 5ng - 15ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] samples&amp;lt;br&amp;gt;(2ng/&amp;amp;micro;L)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10 &amp;amp;micro;L nuclease free water or 10mM Tris pH8 (EB)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5 &amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples&amp;lt;br&amp;gt;96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by row in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | NextSeq&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |16 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 96 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |cDNA generation of poly(A) RNA&amp;lt;br&amp;gt;QC check of cDNA&amp;lt;br&amp;gt;Library preparation (Nextera XT)&amp;lt;br&amp;gt;QC check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=4110 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
  |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:High-Throughput 3&#039; Digital Gene Expression (HT3DGE) uses a combination of molecular tagged indexes, SMARTseq chemistry and Nextera Tagmentation to produce libraries derived from the 3&#039; ends of transcripts.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
:The protocol is based on [http://dx.doi.org/10.1101/003236/ Soumillon et al.,] as part of a collaboration with the KI High-Throughput Screening Core. In limiting the sequence space used by the samples, fewer reads should be required for a good transcriptome.&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:HT3DGE uses a very early indexing step to tag each sample with a &amp;quot;well ID&amp;quot; and a molecular ID. Once tagged the samples are immediately pooled to minimize costs but failed samples cannot be easily reprepped and are not identifiable until sequencing. As such, the method is best suited for experiments where the NUMBER of samples is not limiting (material can be). The 3&#039; nature of the protocol also limits the utility of this method in splicing applications but it should be more robust to using imperfect RNA ([[BioMicroCenter:RIN|RIN]] 7+ instead of 9+ for standard RNAseq) &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Analysis of HT3DGE is not a standard method supported by most open source platforms. We have built pipelines to work with this data, but working closely with the Bioinformatics team is highly recommended.&lt;br /&gt;
 |&amp;lt;br&amp;gt;[[image:DGE_workflow.jpg|right|Standard 3&#039;DGE workflow.]] &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
[[image:HT3DGE_gene_example.jpg|right|Example 3&#039;DGE Data]]&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=USEFUL INFORMATION=&lt;br /&gt;
==RNA Pre-load Submissions==&lt;br /&gt;
:Describes samples that upon submission to the BMC can be immediately plugged into the preparatory method that has been specified in the project submission form. This option is provided to reduce library preparation costs and expedite sample processing by minimizing hands-on time by a BMC staff. The specific requirements are listed for each preparatory method in the tables above. These specifications must be met in order to qualify as a pre-load, submissions otherwise may be subject to additional charges.&amp;lt;br&amp;gt; &lt;br /&gt;
:Due to the nature of a pre-load submission, the entire volume of sample submitted will be used and as such, additional services are not typically offered unless coordinated with a BMC technician. It is important to keep this in mind when submitting precious samples and the BMC recommends to save a portion of sample when possibly. To avoid unnecessary RNA degradation, all RNA pre-loads should be setup the day of submission and be coordinated with BMC staff. These pre-loads should be prepared with extreme care to avoid possible contamination and reduce freeze thaw cycles to prevent degradation of the samples. Degraded or contaminated samples can have a significant impact on library preparation and sequencing results.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==Quadrant Layout==&lt;br /&gt;
:At the BioMicro Center, we organize our high-throughput projects in 384-well plates using a quadrant layout. With quadrant 1 (Q1) representing one 96-well plate, quadrant 2 (Q2) representing a second 96-well plate and so on up to Q4. We ask that plates being submitted start with Q1 and arrayed column-wise. Below are diagrams illustrating quadrant layouts.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{|style=&amp;quot;background: white;&amp;quot; border=&amp;quot;0&amp;quot; height=&amp;quot;230&amp;quot; align=&amp;quot;center&amp;quot; valign=&amp;quot;bottom&amp;quot; cellpadding=10px cellspacing=30px&lt;br /&gt;
|-align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
|&#039;&#039;&#039;Quadrant 1 of 384-well plate&#039;&#039;&#039; &amp;lt;br&amp;gt; [[IMAGE:Quadrant 1.jpg|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Normalization==&lt;br /&gt;
:Normalization is referring to bringing all samples to a uniform concentration. For library preparation, uniform input mass is necessary for proper library generation and as such, calculations for normalization should be based upon concentration in ng/&amp;amp;micro;L. This is in contrast to normalization for pooling of final libraries, where calculations are based upon concentration in nM since the number of molecules is important to achieve a desired read distribution when sequencing.&lt;br /&gt;
&lt;br /&gt;
==Unique versus Combinatorial Dual Indexing==&lt;br /&gt;
:Combinatorial dual indexing is a technique that uses a set of Index 1 (denoted as i7) and Index 2(denoted as i5) barcodes that are combined in a manner such that it produces distinct i7 and i5 pairs which increases multiplexing capacity for sequencing. With combinatorial dual indexes, each i7 and i5 is shared among other samples on the same plate, typically with i5&#039;s repeating across rows and i7&#039;s down columns. &#039;&#039;These combinations are unique but individual indexes used are not&#039;&#039;. However, a phenomenon known as &#039;index hopping&#039; has been observed when sequencing multiplexed libraries that followed single or combinatorial indexing schemes with newer Illumina platforms utilizing ExAmp chemistry such as the NovaSeq ([[Media:Index_Hopping.pdf |Costello et al., 2018]]). This swapping of indexes causes reads to be mis-assigned and subsequently excluded from further analysis. The primary strategy employed to mitigate the effects of index hopping is through the utilization of unique dual indexes.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Unique dual indexes (UDI) are non-redundant indexes where each i5 and i7 has a distinct index sequence. As opposed to combinatorial dual indexing, an i7 and i5 index is never repeated nor shared among other samples (i.e. for a 96-well UDI index plate, there are 96 unique i7&#039;s and 96 unique i5&#039;s). Both the combinations and individual indexes used are unique, and as a result the frequency of mis-assigned reads due to index hopping is greatly reduced. The BioMicro Center recommends that UDI&#039;s always be used when sequencing on the NovaSeq. The number of libraries that can be multiplexed and sequenced on a single lane is determined by the total number of UDI&#039;s provided for each library preparation method.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:RNA_HTL&amp;diff=131432</id>
		<title>BioMicroCenter:RNA HTL</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:RNA_HTL&amp;diff=131432"/>
		<updated>2026-04-30T18:50:15Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* NEB Ultra II Directional RNA with Poly(A) Selection */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
= High-throughput RNA Library Preparation =&lt;br /&gt;
&lt;br /&gt;
[[Image:DE_HTL_RNA.jpeg|thumb|right|400px|Increased biological replicates increases the power of analysis. (Liu et al. 2014 Bioinformatics 30(3): 301-4)]]&lt;br /&gt;
&lt;br /&gt;
The BioMicro Center offers high-throughput RNA library preparation [[BioMicroCenter:FAQ#STANDARD_versus_HIGH_THROUGHPUT_LIBRARY_PREPARATION|(HTL-RNA)]] for both standard input and low input samples. Together, these high-throughput methodologies provide a comprehensive set of options to address a diverse range of experiments investigating RNA biology. High-throughput library generation focuses on reducing price and processing time on a per sample basis. To do this, there are several key differences from our standard library preparation service. First, HTL-RNA services have set batch sizes (24 and 96) with fixed price points (i.e. charge for 16 samples will be the as 24 samples; similarly for 80 samples as 96). If under these batch sizes, DO MORE REPLICATES to simultaneously enhance experimental power and reduce price per sample. Some samples may fail and the cost of re-prepping those samples is NOT included in the quoted cost. Re-prep is only deemed necessary by the core where we have found evidence of a reagent failure. User request re-preps of individuals samples can be done by hand, but at a higher rate. HTL focuses on reducing price and processing time per sample, so some routine services provided with standard library preparation - such as initial and final quality control for all samples, sample arraying, or automatic re-prep of failed samples - are not built in. These services are available as add ons to the original service request. &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;Reminder: &amp;lt;/b&amp;gt; high throughput projects are treated with &amp;lt;b&amp;gt;one condition&amp;lt;/b&amp;gt; (PCR cycles, fragmentation time, etc...). They are meant for allowing high replicates of the same samples. High throughput submissions for projects with multiple sub-projects from separate individuals combined on the same plate result in a low success rate due to the different conditions for each sub project. Therefore, htl submissions from multiple projects will tolerate and may expect, failure rates well over 10%.&lt;br /&gt;
&lt;br /&gt;
== STANDARD INPUT RNA-SEQ (Eurkaryotic) ==&lt;br /&gt;
=== NEB Ultra II Directional RNA with Poly(A) Selection===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact total RNA ([[BioMicroCenter:RIN|RIN]] &amp;gt;8)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10ng - 100ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L nuclease-free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 2.5&amp;amp;micro;L nuclease-free water (day of submission)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  |colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RNA selection &amp;lt;br&amp;gt; cDNA synthesis &amp;lt;br&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II Directional RNA preparation with poly(A) selection is used to selectively capture mRNA from high-quality total RNA. The selection of mRNA transcripts occurs by hybridization of the poly(A)-tail to magnetic oligo-d(T) beads, which we have miniaturized to 1/6th the original reaction volume using our Tecan Freedom Evo. The purified RNA is then further processed at a 1/10th reaction volume on the Mosquito HV to reliably generate RNA-Seq libraries with inputs ranging from 10ng to 100ng (recommended input of &amp;gt; 50ng). Because this method is reliant on poly(A)-tails during RNA isolation the sample quality significantly impacts performance, as such high-quality samples are an absolute requirement. &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:PolyA_HTL.jpg | 350px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== NEB Ultra II Directional RNA with rRNA Depletion ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RIN|Intact]] or [[BioMicroCenter:RIN|degraded]] - &#039;&#039;&#039;Human/Mouse/Rat samples only!&#039;&#039;&#039;&amp;lt;br&amp;gt;&#039;&#039;(Bacterial in development)&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10ng - 100ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5&amp;amp;micro;L nuclease free water (day of submission)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |112 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 192 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RNA selection &amp;lt;br&amp;gt; cDNA synthesis &amp;lt;br&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II Directional RNA preparation with ribosomal RNA (rRNA) depletion is used to deplete rRNA by enzymatic degradation using single-stranded DNA probes that target rRNAs, leaving all other RNA species present and available for library preparation. This depletion method is agnostic to input sample quality and is the go-to method if samples don&#039;t meet quality requirements for poly(A) selection. We have  miniaturized this rRNA depletion method to 1/6th and the following RNA library preparation to 1/10th the original reaction volume on the Mosquito HV. This method is suited for inputs ranging from 5ng to 100ng (recommended input of &amp;gt; 50ng). Due to probe design used in the depletion, this method is currently only available for species where NEB has probes available.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:Depletion_HTL.jpg|350px]] &lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LOW INPUT RNA-SEQ (Eukaryotic)==&lt;br /&gt;
=== Cv2 ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cells or [[BioMicroCenter:RIN|intact]] low RNA input&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 10pg - 250pg&amp;lt;br&amp;gt;(Or as available for single cells)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cells pre-arrayed across plate or [[BioMicroCenter:RNA_HTL#Normalization|normalized]] RNA&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;amp;ge;5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Single cell or RNA in 1&amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Up to 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] (w/ Nextera Flex) &amp;lt;br&amp;gt; 384 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |cDNA generation of poly(A) RNA &amp;lt;br&amp;gt;cDNA amplification&amp;lt;br&amp;gt;Spot check of cDNA&amp;lt;br&amp;gt;Library preparation (Nextera Flex or XT)&amp;lt;br&amp;gt;Spot check of final libraries  &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Our Cv2 prep is a &amp;quot;home-brew&amp;quot; version of Clontech&#039;s SMART-Seq kits which generates cDNA of full length transcripts from low inputs of RNA (i.e. single cell, dilute RNA sample). This workflow plugs into either our HTL [[BioMicroCenter:DNA_HTL#Nextera_Flex|Nextera Flex]] or [[BioMicroCenter:DNA_HTL#Nextera_XT|XT]] preps where the cDNA is tagmented and indexed.&amp;lt;br&amp;gt;&lt;br /&gt;
:This method uses oligo-d(T) priming to selectively process polyadenylated RNA which is then amplified by an initial round of PCR, making this prep ideal low-input high quality RNA or single cells. Due to the nature method, submissions should be coordinated with BMC to schedule sample drop-off of up to 384 samples to begin processing immediately in order to reduce possible loss/degradation of sample. &amp;lt;br&amp;gt;&lt;br /&gt;
[[Image:Cv2_BMC.jpg|center|350px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== ZapR ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RIN|Degraded]] low RNA input&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 250pg - 10ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] sample&amp;lt;br&amp;gt;(&amp;amp;ge; 750 pg/&amp;amp;micro;L strongly recommended)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;amp;ge; 5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 1.5&amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:RNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |16 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 96 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | cDNA synthesis&amp;lt;br&amp;gt;cDNA amplification&amp;lt;br&amp;gt;cDNA selection&amp;lt;br&amp;gt;Library preparation&amp;lt;br&amp;gt;Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_RNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
|&lt;br /&gt;
:SMARTer Stranded Total RNA-Seq Kit v2 - Pico Input Mammalian (ZapR) is used for library preparation of low input degraded RNA samples by generating and amplifying cDNA from total RNA, after which the ribosomal cDNA is depleted through targeted enzymatic degradation using ZapR probes while keeping all other cDNA for library preparation. This method is typically used for low concentration RNA samples of poor quality ([[BioMicroCenter:RIN|RIN]]&amp;lt;7 or [[BioMicroCenter:RIN|DV200]]&amp;lt;60%). We have miniaturized the ZapR method to 1/10th the original reaction volume on the Mosquito HV. This method is capable of handling inputs ranging from 250pg to 10ng (or 50ng for FFPE) however, performance for a given sample input is dependent on the quality of the sample itself. Due to the design of the ZapR probes, this method is only available for Human samples.&lt;br /&gt;
[[Image:ZapR_BMC.jpg|center|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Digital Gene Expression (DGE) ==&lt;br /&gt;
=== 3&#039;Digital Gene Expression ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:400px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |+ &#039;&#039;&#039;HT-3&#039;DGE&#039;&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact RNA ([[BioMicroCenter:RIN|RIN]] &amp;amp;ge; 7)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 5ng - 15ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#Normalization|Normalized]] samples&amp;lt;br&amp;gt;(2ng/&amp;amp;micro;L)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10 &amp;amp;micro;L nuclease free water or 10mM Tris pH8 (EB)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5 &amp;amp;micro;L nuclease free water&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples&amp;lt;br&amp;gt;96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by row in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | NextSeq&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |16 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 96 [[BioMicroCenter:RNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |cDNA generation of poly(A) RNA&amp;lt;br&amp;gt;QC check of cDNA&amp;lt;br&amp;gt;Library preparation (Nextera XT)&amp;lt;br&amp;gt;QC check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:RNA_HTL#RNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=4110 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
  |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:High-Throughput 3&#039; Digital Gene Expression (HT3DGE) uses a combination of molecular tagged indexes, SMARTseq chemistry and Nextera Tagmentation to produce libraries derived from the 3&#039; ends of transcripts.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
:The protocol is based on [http://dx.doi.org/10.1101/003236/ Soumillon et al.,] as part of a collaboration with the KI High-Throughput Screening Core. In limiting the sequence space used by the samples, fewer reads should be required for a good transcriptome.&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:HT3DGE uses a very early indexing step to tag each sample with a &amp;quot;well ID&amp;quot; and a molecular ID. Once tagged the samples are immediately pooled to minimize costs but failed samples cannot be easily reprepped and are not identifiable until sequencing. As such, the method is best suited for experiments where the NUMBER of samples is not limiting (material can be). The 3&#039; nature of the protocol also limits the utility of this method in splicing applications but it should be more robust to using imperfect RNA ([[BioMicroCenter:RIN|RIN]] 7+ instead of 9+ for standard RNAseq) &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Analysis of HT3DGE is not a standard method supported by most open source platforms. We have built pipelines to work with this data, but working closely with the Bioinformatics team is highly recommended.&lt;br /&gt;
 |&amp;lt;br&amp;gt;[[image:DGE_workflow.jpg|right|Standard 3&#039;DGE workflow.]] &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
[[image:HT3DGE_gene_example.jpg|right|Example 3&#039;DGE Data]]&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=USEFUL INFORMATION=&lt;br /&gt;
==RNA Pre-load Submissions==&lt;br /&gt;
:Describes samples that upon submission to the BMC can be immediately plugged into the preparatory method that has been specified in the project submission form. This option is provided to reduce library preparation costs and expedite sample processing by minimizing hands-on time by a BMC staff. The specific requirements are listed for each preparatory method in the tables above. These specifications must be met in order to qualify as a pre-load, submissions otherwise may be subject to additional charges.&amp;lt;br&amp;gt; &lt;br /&gt;
:Due to the nature of a pre-load submission, the entire volume of sample submitted will be used and as such, additional services are not typically offered unless coordinated with a BMC technician. It is important to keep this in mind when submitting precious samples and the BMC recommends to save a portion of sample when possibly. To avoid unnecessary RNA degradation, all RNA pre-loads should be setup the day of submission and be coordinated with BMC staff. These pre-loads should be prepared with extreme care to avoid possible contamination and reduce freeze thaw cycles to prevent degradation of the samples. Degraded or contaminated samples can have a significant impact on library preparation and sequencing results.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==Quadrant Layout==&lt;br /&gt;
:At the BioMicro Center, we organize our high-throughput projects in 384-well plates using a quadrant layout. With quadrant 1 (Q1) representing one 96-well plate, quadrant 2 (Q2) representing a second 96-well plate and so on up to Q4. We ask that plates being submitted start with Q1 and arrayed column-wise. Below are diagrams illustrating quadrant layouts.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{|style=&amp;quot;background: white;&amp;quot; border=&amp;quot;0&amp;quot; height=&amp;quot;230&amp;quot; align=&amp;quot;center&amp;quot; valign=&amp;quot;bottom&amp;quot; cellpadding=10px cellspacing=30px&lt;br /&gt;
|-align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
|&#039;&#039;&#039;Quadrant 1 of 384-well plate&#039;&#039;&#039; &amp;lt;br&amp;gt; [[IMAGE:Quadrant 1.jpg|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Normalization==&lt;br /&gt;
:Normalization is referring to bringing all samples to a uniform concentration. For library preparation, uniform input mass is necessary for proper library generation and as such, calculations for normalization should be based upon concentration in ng/&amp;amp;micro;L. This is in contrast to normalization for pooling of final libraries, where calculations are based upon concentration in nM since the number of molecules is important to achieve a desired read distribution when sequencing.&lt;br /&gt;
&lt;br /&gt;
==Unique versus Combinatorial Dual Indexing==&lt;br /&gt;
:Combinatorial dual indexing is a technique that uses a set of Index 1 (denoted as i7) and Index 2(denoted as i5) barcodes that are combined in a manner such that it produces distinct i7 and i5 pairs which increases multiplexing capacity for sequencing. With combinatorial dual indexes, each i7 and i5 is shared among other samples on the same plate, typically with i5&#039;s repeating across rows and i7&#039;s down columns. &#039;&#039;These combinations are unique but individual indexes used are not&#039;&#039;. However, a phenomenon known as &#039;index hopping&#039; has been observed when sequencing multiplexed libraries that followed single or combinatorial indexing schemes with newer Illumina platforms utilizing ExAmp chemistry such as the NovaSeq ([[Media:Index_Hopping.pdf |Costello et al., 2018]]). This swapping of indexes causes reads to be mis-assigned and subsequently excluded from further analysis. The primary strategy employed to mitigate the effects of index hopping is through the utilization of unique dual indexes.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Unique dual indexes (UDI) are non-redundant indexes where each i5 and i7 has a distinct index sequence. As opposed to combinatorial dual indexing, an i7 and i5 index is never repeated nor shared among other samples (i.e. for a 96-well UDI index plate, there are 96 unique i7&#039;s and 96 unique i5&#039;s). Both the combinations and individual indexes used are unique, and as a result the frequency of mis-assigned reads due to index hopping is greatly reduced. The BioMicro Center recommends that UDI&#039;s always be used when sequencing on the NovaSeq. The number of libraries that can be multiplexed and sequenced on a single lane is determined by the total number of UDI&#039;s provided for each library preparation method.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:DNA_HTL&amp;diff=131431</id>
		<title>BioMicroCenter:DNA HTL</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:DNA_HTL&amp;diff=131431"/>
		<updated>2026-04-30T18:49:13Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* Nextera Flex */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
= High-throughput DNA Library Preparation =&lt;br /&gt;
The BioMicro Center offers high-throuhgput DNA library preparation ([[BioMicroCenter:FAQ#STANDARD_versus_HIGH_THROUGHPUT_LIBRARY_PREPARATION|HTL-DNA]]) for both intact and fragmented samples as well as for metagenomics/amplicon generation. High-throughput library generation focuses on reducing price and processing time on a per sample basis. To do this, there are several key differences from our standard library preparation service. First, HTL-DNA services have set batch sizes (24 and 96) with fixed price points (i.e. charge for 16 samples will be the as 24 samples; similarly for 80 samples as 96). If under these batch sizes, DO MORE REPLICATES to simultaneously enhance experimental power and reduce price per sample. Some samples may fail and the cost of re-prepping those samples is NOT included in the quoted cost unless re-prep of the entire plate is deemed necessary. Re-preps can be done by hand, but at a higher rate. Second, the HTL option focuses on reducing price and processing time per sample, so some routine services provided with standard library preparation - such as initial and final quality control for all samples, sample arraying, or automatic re-prep of failed samples - are not built in. These services are available as add ons to the original service request. &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;Reminder: &amp;lt;/b&amp;gt; high throughput projects are treated with &amp;lt;b&amp;gt;one condition&amp;lt;/b&amp;gt; (PCR cycles, fragmentation time, etc...). They are meant for allowing high replicates of the same samples. High throughput submissions for projects with multiple sub-projects from separate individuals combined on the same plate result in a low success rate due to the different conditions for each sub project. Therefore, htl submissions from multiple projects will tolerate and may expect, failure rates well over 10%.&lt;br /&gt;
&lt;br /&gt;
== FRAGMENTED DNA ==&lt;br /&gt;
=== NEB Ultra II ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Fragmented DNA (i.e. ChIP-Seq, small PCR amplicons)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 100pg - 75ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples all [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to same concentration in 10&amp;amp;micro;L (100pg/&amp;amp;micro;L - 7.5ng/&amp;amp;micro;L)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris pH 8.0&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 10&amp;amp;micro;L 10mM Tris pH 8.0&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II is used for standard ligation-mediated PCR based approaches. We have miniaturized the reaction volume to a 1/5th scale that reliably performs on inputs ranging from 10pg to 75ng (recommended minimum of 100pg). The reaction begins with 10&amp;amp;micro;L of normalized sample to which reagents are added. As such, initial submission of clean samples that have been pre-normalized in greater than 10&amp;amp;micro;L of appropriate buffer will hasten sample processing. &lt;br /&gt;
&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:Ultra_II_DNA_Input.jpg | 400px]] [[IMAGE:Ultra_II_FAtrace.jpg | 400px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== INTACT GENOMES ==&lt;br /&gt;
=== Nextera Flex ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact DNA and large amplicons&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 1ng - 50ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples all [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to same concentration in 3µL (330pg/µL - 16.5ng/µL, *higher is better)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 3&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]] &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Unlike XT, Nextera Flex, also known as Illumina DNA Prep, utilizes bead-linked transposomes (BLT) to tagment and generate libraries from intact DNA samples. These BLTs control sizing during the tagmentation reaction by sterics, producing a much more consistent libraries with larger size distribution which makes it ideal for larger paired-end runs on sequencers.&lt;br /&gt;
:Nextera Flex is currently run at a 1/10th miniaturization scale on the Mosquito HV with a broader dynamic range of input (1ng - 50ng) compared to XT. Nextera Flex self-normalizes at a certain input (if sample concentration is 3ng/&amp;amp;micro;L or greater) and submissions do not have to be normalized so long as that threshold is met. Up to 384 libraries can be multiplexed using Nextera unique dual-indexes (UDI) which helps to avoid issues with &#039;barcode hopping&#039;.&lt;br /&gt;
::::[[IMAGE:Flex_Diagram.jpg | 500px]]&lt;br /&gt;
::::::[[IMAGE:Flex_Trace.jpg | 300px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Nextera XT ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact DNA and large amplicons&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt; 0.2ng/&amp;amp;micro;L&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to 0.2ng/&amp;amp;micro;L&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL#Quadrant_Layout|1st quadrant]] of a 384-well LVSD plate (Available at BMC)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Nextera XT is a solution-based &amp;quot;tagmentation&amp;quot; chemistry used for the preparation of intact DNA samples to generate libraries with smaller insert sizes which is best suited for 40bp single-end runs on sequencers. Nextera XT has been miniaturized to a 1/12th reaction volume on our Mosquito HV from minimal low sample concentration (0.2ng/&amp;amp;micro;L or greater) and up to 384 libraries can be run on a single sequencing lane using dual indexes.&lt;br /&gt;
:The Mosquito HV allows for libraries to be prepared at decreased volumes which results in significantly reduced costs but also lowers library complexity. As such, it is most suitable for single cell and amplicon analysis. De novo work should not be done using Nextera XT preps on the Mosquito HV.&lt;br /&gt;
&lt;br /&gt;
::[[IMAGE:Nextera_Illumina_fig1.jpg | 200px]][[IMAGE:XT_Trace.jpg | 250px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== 16S / AMPLICON SEQUENCING ==&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:350px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |+ &#039;&#039;&#039;16S Metagenomic/Amplicon Library Preparation&#039;&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 100px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 250px;&amp;quot; | General requirements&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Clean DNA&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | As available&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 48 samples* &amp;lt;br&amp;gt; The BioMicro Center &#039;&#039;&#039;strongly&#039;&#039;&#039; encourages leaving space for 4 control samples within each batch of 48. &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column from left to right in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 250PE/300PE MiSeq&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Initial qPCR &amp;lt;BR&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=4110 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
  |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[[image:16S_layout.jpg|thumb|200px|16S v4 region is amplified in standard BioMicro Center preps. Other regions can be substituted by submitting oligos with different variable regions. (Lopez-Aladid et al Sci. Rep. 2023)]] &lt;br /&gt;
:The BioMicro Center offers 16S and amplicon sequencing for metagenomics projects. Derived from the [http://be.mit.edu/directory/eric-alm Alm Lab] with support from a pilot grant from [http://cehs.mit.edu/ MIT CEHS], our protocol uses a two step amplification to first expand the 16S population and add defined 3&#039; and 5&#039; sequences which are then used to add Illumina anchors and sequences. This two step method allows easy multiplexing and the ability change the amplicon insert sequence at minimal cost. &lt;br /&gt;
[[image:16S_diagram.jpg|thumb|400px|Standard NGS amplicon design]]&lt;br /&gt;
:The same method used for 16S is also applicable to other amplicons as well with minor adaption. Because we use a nested PCR, only the internal sequences need to be modified. The adapter sequences - Green:Blue - are the key element of this method. On the 5&#039; end, they contain a &amp;quot;YRYR&amp;quot; sequence that introduces the complexity required for Illumina sequencing. &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
::FORWARD: &amp;lt;font color=green&amp;gt;ACACGACGCTCTTCCGATCT&amp;lt;/font&amp;gt;&amp;lt;font color=orange&amp;gt;&#039;&#039;&#039;YRYR&#039;&#039;&#039;&amp;lt;/font&amp;gt;&amp;lt;font color=blue&amp;gt;XXXXXXX&amp;lt;/font&amp;gt;&lt;br /&gt;
::REVERSE: &amp;lt;font color=green&amp;gt;CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT&amp;lt;/font&amp;gt;&amp;lt;font color=blue&amp;gt;XXXXXXX&amp;lt;/font&amp;gt;&lt;br /&gt;
::(&amp;lt;font color=blue&amp;gt;X&amp;lt;/font&amp;gt; = insert element)&lt;br /&gt;
:{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;margin-left: auto; margin-right: auto; border: none;&amp;quot;&lt;br /&gt;
    |+ &#039;&#039;&#039;Regions&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2;&amp;quot; | Target Region&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2&amp;quot; | Forward Primer&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2&amp;quot; | Reverse Primer&lt;br /&gt;
    |-&lt;br /&gt;
    | colspan=&amp;quot;3&amp;quot; style=&amp;quot;text-align: center; height: 0.5em; background: #d0e5f5;&amp;quot; |&#039;&#039;&#039;Standard Region&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |16S V4&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U515F&amp;lt;br&amp;gt;GTGCCAGCMGCCGCGGTAA&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: E786R&amp;lt;br&amp;gt;GGACTACHVGGGTWTCTAAT&lt;br /&gt;
    |-&lt;br /&gt;
    | colspan=&amp;quot;3&amp;quot; style=&amp;quot;text-align: center; height: 0.5em; background: #d0e5f5;&amp;quot; |&#039;&#039;&#039;Alternative Regions&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |16S V1-V3&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U24F&amp;lt;br&amp;gt;GAGTTTGATYMTGGCTCAG&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U553R&amp;lt;br&amp;gt;GCGGCTGCTGGCACG&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |18S&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |-&lt;br /&gt;
    |}&lt;br /&gt;
:The most common source of failures for amplicon sequencing are samples that fail to amplify in the initial qPCR. The first step of the process is a qPCR reaction using the forward and reverse primers of the specific target regions to determine the number of cycles to be used in library generation. Libraries that fail to amplify in 20 cycles generally perform poorly enough to be unusable. Removal of PCR inhibitors is critical to success of this protocol. We do attempt to do this by serially diluting the samples and testing dilutions in the initial qPCR.&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
= USEFUL INFORMATION =&lt;br /&gt;
== DNA Pre-load Submissions ==&lt;br /&gt;
:Describes samples that upon submission to the BMC can be immediately plugged into the preparatory method that has been specified in the project submission form. This option is provided to reduce library preparation costs and expedite sample processing by minimizing hands-on time by a BMC staff. The specific requirements are listed for each preparatory method (excluding 16S) in the tables above. These specifications must be met in order to qualify as a pre-load, submissions otherwise may be subject to additional charges.&amp;lt;br&amp;gt; &lt;br /&gt;
:Due to the nature of a pre-load submission, the entire volume of sample submitted will be used and as such, additional services are not typically offered unless coordinated with a BMC technician. It is important to keep this in mind when submitting precious samples and the BMC recommends to save a portion of sample when possibly.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Quadrant Layout ==&lt;br /&gt;
:At the BioMicro Center, we organize our high-throughput projects in 384-well plates using a quadrant layout. With quadrant 1 (Q1) representing one 96-well plate, quadrant 2 (Q2) representing a second 96-well plate and so on up to Q4. We ask that plates being submitted start with Q1 and arrayed column-wise. Below is a diagram illustrating the desired filled quadrant.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{|style=&amp;quot;background: white;&amp;quot; border=&amp;quot;0&amp;quot; height=&amp;quot;230&amp;quot; align=&amp;quot;center&amp;quot; valign=&amp;quot;bottom&amp;quot; cellpadding=10px cellspacing=30px&lt;br /&gt;
|-align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
|&#039;&#039;&#039;Quadrant 1 of 384-well plate&#039;&#039;&#039; &amp;lt;br&amp;gt; [[IMAGE:Quadrant_1.jpg|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Normalization ==&lt;br /&gt;
:Normalization is referring to bringing all samples to a uniform concentration. For library preparation, uniform input mass is necessary for proper library generation and as such, calculations for normalization should be based upon concentration in ng/&amp;amp;micro;L. This is in contrast to normalization for pooling of final libraries, where calculations are based upon concentration in nM since the number of molecules is important to achieve a desired read distribution when sequencing.&lt;br /&gt;
&lt;br /&gt;
==Unique versus Combinatorial Dual Indexing==&lt;br /&gt;
:Combinatorial dual indexing is a technique that uses a set of Index 1 (denoted as i7) and Index 2(denoted as i5) barcodes that are combined in a manner such that it produces distinct i7 and i5 pairs which increases multiplexing capacity for sequencing. With combinatorial dual indexes, each i7 and i5 is shared among other samples on the same plate, typically with i5&#039;s repeating across rows and i7&#039;s down columns. &#039;&#039;These combinations are unique but individual indexes used are not&#039;&#039;. However, a phenomenon known as &#039;index hopping&#039; has been observed when sequencing multiplexed libraries that followed single or combinatorial indexing schemes with newer Illumina platforms utilizing ExAmp chemistry such as the NovaSeq ([[Media:Index_Hopping.pdf |Costello et al., 2018]]). This swapping of indexes causes reads to be mis-assigned and subsequently excluded from further analysis. The primary strategy employed to mitigate the effects of index hopping is through the utilization of unique dual indexes.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Unique dual indexes (UDI) are non-redundant indexes where each i5 and i7 has a distinct index sequence. As opposed to combinatorial dual indexing, an i7 and i5 index is never repeated nor shared among other samples (i.e. for a 96-well UDI index plate, there are 96 unique i7&#039;s and 96 unique i5&#039;s). Both the combinations and individual indexes used are unique, and as a result the frequency of mis-assigned reads due to index hopping is greatly reduced. The BioMicro Center recommends that UDI&#039;s always be used when sequencing on the NovaSeq. The number of libraries that can be multiplexed and sequenced on a single lane is determined by the total number of UDI&#039;s provided for each library preparation method.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:DNA_HTL&amp;diff=131430</id>
		<title>BioMicroCenter:DNA HTL</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:DNA_HTL&amp;diff=131430"/>
		<updated>2026-04-30T18:48:52Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* Nextera Flex */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
= High-throughput DNA Library Preparation =&lt;br /&gt;
The BioMicro Center offers high-throuhgput DNA library preparation ([[BioMicroCenter:FAQ#STANDARD_versus_HIGH_THROUGHPUT_LIBRARY_PREPARATION|HTL-DNA]]) for both intact and fragmented samples as well as for metagenomics/amplicon generation. High-throughput library generation focuses on reducing price and processing time on a per sample basis. To do this, there are several key differences from our standard library preparation service. First, HTL-DNA services have set batch sizes (24 and 96) with fixed price points (i.e. charge for 16 samples will be the as 24 samples; similarly for 80 samples as 96). If under these batch sizes, DO MORE REPLICATES to simultaneously enhance experimental power and reduce price per sample. Some samples may fail and the cost of re-prepping those samples is NOT included in the quoted cost unless re-prep of the entire plate is deemed necessary. Re-preps can be done by hand, but at a higher rate. Second, the HTL option focuses on reducing price and processing time per sample, so some routine services provided with standard library preparation - such as initial and final quality control for all samples, sample arraying, or automatic re-prep of failed samples - are not built in. These services are available as add ons to the original service request. &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;Reminder: &amp;lt;/b&amp;gt; high throughput projects are treated with &amp;lt;b&amp;gt;one condition&amp;lt;/b&amp;gt; (PCR cycles, fragmentation time, etc...). They are meant for allowing high replicates of the same samples. High throughput submissions for projects with multiple sub-projects from separate individuals combined on the same plate result in a low success rate due to the different conditions for each sub project. Therefore, htl submissions from multiple projects will tolerate and may expect, failure rates well over 10%.&lt;br /&gt;
&lt;br /&gt;
== FRAGMENTED DNA ==&lt;br /&gt;
=== NEB Ultra II ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Fragmented DNA (i.e. ChIP-Seq, small PCR amplicons)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 100pg - 75ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples all [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to same concentration in 10&amp;amp;micro;L (100pg/&amp;amp;micro;L - 7.5ng/&amp;amp;micro;L)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris pH 8.0&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 10&amp;amp;micro;L 10mM Tris pH 8.0&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II is used for standard ligation-mediated PCR based approaches. We have miniaturized the reaction volume to a 1/5th scale that reliably performs on inputs ranging from 10pg to 75ng (recommended minimum of 100pg). The reaction begins with 10&amp;amp;micro;L of normalized sample to which reagents are added. As such, initial submission of clean samples that have been pre-normalized in greater than 10&amp;amp;micro;L of appropriate buffer will hasten sample processing. &lt;br /&gt;
&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:Ultra_II_DNA_Input.jpg | 400px]] [[IMAGE:Ultra_II_FAtrace.jpg | 400px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== INTACT GENOMES ==&lt;br /&gt;
=== Nextera Flex ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact DNA and large amplicons&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 1ng - 50ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples all [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to same concentration in 3µL (330pg/µL - 16.5ng/µL, *higher is better)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 3&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]] &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Unlike XT, Nextera Flex, also known as Illumina DNA Prep, utilizes bead-linked transposomes (BLT) to tagment and generate libraries from intact DNA samples. These BLTs control sizing during the tagmentation reaction by sterics, producing a much more consistent libraries with larger size distribution which makes it ideal for larger paired-end runs on sequencers.&lt;br /&gt;
:Nextera Flex is currently run at a 1/10th miniaturization scale on the Mosquito HV with a broader dynamic range of input (1ng - 50ng) compared to XT. Nextera Flex self-normalizes at a certain input (if sample concentration is 3ng/&amp;amp;micro;L or greater) and submissions do not have to be normalized so long as that threshold is met. Up to 384 libraries can be multiplexed using Nextera unique dual-indexes (UDI) which helps to avoid issues with &#039;barcode hopping&#039;.&lt;br /&gt;
::::[[IMAGE:Flex_Diagram.jpg | 500px]]&lt;br /&gt;
::::::[[IMAGE:Flex_Trace.jpg | 300px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Nextera XT ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact DNA and large amplicons&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt; 0.2ng/&amp;amp;micro;L&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to 0.2ng/&amp;amp;micro;L&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL#Quadrant_Layout|1st quadrant]] of a 384-well LVSD plate (Available at BMC)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Nextera XT is a solution-based &amp;quot;tagmentation&amp;quot; chemistry used for the preparation of intact DNA samples to generate libraries with smaller insert sizes which is best suited for 40bp single-end runs on sequencers. Nextera XT has been miniaturized to a 1/12th reaction volume on our Mosquito HV from minimal low sample concentration (0.2ng/&amp;amp;micro;L or greater) and up to 384 libraries can be run on a single sequencing lane using dual indexes.&lt;br /&gt;
:The Mosquito HV allows for libraries to be prepared at decreased volumes which results in significantly reduced costs but also lowers library complexity. As such, it is most suitable for single cell and amplicon analysis. De novo work should not be done using Nextera XT preps on the Mosquito HV.&lt;br /&gt;
&lt;br /&gt;
::[[IMAGE:Nextera_Illumina_fig1.jpg | 200px]][[IMAGE:XT_Trace.jpg | 250px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== 16S / AMPLICON SEQUENCING ==&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:350px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |+ &#039;&#039;&#039;16S Metagenomic/Amplicon Library Preparation&#039;&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 100px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 250px;&amp;quot; | General requirements&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Clean DNA&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | As available&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 48 samples* &amp;lt;br&amp;gt; The BioMicro Center &#039;&#039;&#039;strongly&#039;&#039;&#039; encourages leaving space for 4 control samples within each batch of 48. &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column from left to right in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 250PE/300PE MiSeq&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Initial qPCR &amp;lt;BR&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=4110 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
  |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[[image:16S_layout.jpg|thumb|200px|16S v4 region is amplified in standard BioMicro Center preps. Other regions can be substituted by submitting oligos with different variable regions. (Lopez-Aladid et al Sci. Rep. 2023)]] &lt;br /&gt;
:The BioMicro Center offers 16S and amplicon sequencing for metagenomics projects. Derived from the [http://be.mit.edu/directory/eric-alm Alm Lab] with support from a pilot grant from [http://cehs.mit.edu/ MIT CEHS], our protocol uses a two step amplification to first expand the 16S population and add defined 3&#039; and 5&#039; sequences which are then used to add Illumina anchors and sequences. This two step method allows easy multiplexing and the ability change the amplicon insert sequence at minimal cost. &lt;br /&gt;
[[image:16S_diagram.jpg|thumb|400px|Standard NGS amplicon design]]&lt;br /&gt;
:The same method used for 16S is also applicable to other amplicons as well with minor adaption. Because we use a nested PCR, only the internal sequences need to be modified. The adapter sequences - Green:Blue - are the key element of this method. On the 5&#039; end, they contain a &amp;quot;YRYR&amp;quot; sequence that introduces the complexity required for Illumina sequencing. &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
::FORWARD: &amp;lt;font color=green&amp;gt;ACACGACGCTCTTCCGATCT&amp;lt;/font&amp;gt;&amp;lt;font color=orange&amp;gt;&#039;&#039;&#039;YRYR&#039;&#039;&#039;&amp;lt;/font&amp;gt;&amp;lt;font color=blue&amp;gt;XXXXXXX&amp;lt;/font&amp;gt;&lt;br /&gt;
::REVERSE: &amp;lt;font color=green&amp;gt;CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT&amp;lt;/font&amp;gt;&amp;lt;font color=blue&amp;gt;XXXXXXX&amp;lt;/font&amp;gt;&lt;br /&gt;
::(&amp;lt;font color=blue&amp;gt;X&amp;lt;/font&amp;gt; = insert element)&lt;br /&gt;
:{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;margin-left: auto; margin-right: auto; border: none;&amp;quot;&lt;br /&gt;
    |+ &#039;&#039;&#039;Regions&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2;&amp;quot; | Target Region&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2&amp;quot; | Forward Primer&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2&amp;quot; | Reverse Primer&lt;br /&gt;
    |-&lt;br /&gt;
    | colspan=&amp;quot;3&amp;quot; style=&amp;quot;text-align: center; height: 0.5em; background: #d0e5f5;&amp;quot; |&#039;&#039;&#039;Standard Region&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |16S V4&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U515F&amp;lt;br&amp;gt;GTGCCAGCMGCCGCGGTAA&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: E786R&amp;lt;br&amp;gt;GGACTACHVGGGTWTCTAAT&lt;br /&gt;
    |-&lt;br /&gt;
    | colspan=&amp;quot;3&amp;quot; style=&amp;quot;text-align: center; height: 0.5em; background: #d0e5f5;&amp;quot; |&#039;&#039;&#039;Alternative Regions&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |16S V1-V3&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U24F&amp;lt;br&amp;gt;GAGTTTGATYMTGGCTCAG&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U553R&amp;lt;br&amp;gt;GCGGCTGCTGGCACG&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |18S&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |-&lt;br /&gt;
    |}&lt;br /&gt;
:The most common source of failures for amplicon sequencing are samples that fail to amplify in the initial qPCR. The first step of the process is a qPCR reaction using the forward and reverse primers of the specific target regions to determine the number of cycles to be used in library generation. Libraries that fail to amplify in 20 cycles generally perform poorly enough to be unusable. Removal of PCR inhibitors is critical to success of this protocol. We do attempt to do this by serially diluting the samples and testing dilutions in the initial qPCR.&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
= USEFUL INFORMATION =&lt;br /&gt;
== DNA Pre-load Submissions ==&lt;br /&gt;
:Describes samples that upon submission to the BMC can be immediately plugged into the preparatory method that has been specified in the project submission form. This option is provided to reduce library preparation costs and expedite sample processing by minimizing hands-on time by a BMC staff. The specific requirements are listed for each preparatory method (excluding 16S) in the tables above. These specifications must be met in order to qualify as a pre-load, submissions otherwise may be subject to additional charges.&amp;lt;br&amp;gt; &lt;br /&gt;
:Due to the nature of a pre-load submission, the entire volume of sample submitted will be used and as such, additional services are not typically offered unless coordinated with a BMC technician. It is important to keep this in mind when submitting precious samples and the BMC recommends to save a portion of sample when possibly.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Quadrant Layout ==&lt;br /&gt;
:At the BioMicro Center, we organize our high-throughput projects in 384-well plates using a quadrant layout. With quadrant 1 (Q1) representing one 96-well plate, quadrant 2 (Q2) representing a second 96-well plate and so on up to Q4. We ask that plates being submitted start with Q1 and arrayed column-wise. Below is a diagram illustrating the desired filled quadrant.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{|style=&amp;quot;background: white;&amp;quot; border=&amp;quot;0&amp;quot; height=&amp;quot;230&amp;quot; align=&amp;quot;center&amp;quot; valign=&amp;quot;bottom&amp;quot; cellpadding=10px cellspacing=30px&lt;br /&gt;
|-align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
|&#039;&#039;&#039;Quadrant 1 of 384-well plate&#039;&#039;&#039; &amp;lt;br&amp;gt; [[IMAGE:Quadrant_1.jpg|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Normalization ==&lt;br /&gt;
:Normalization is referring to bringing all samples to a uniform concentration. For library preparation, uniform input mass is necessary for proper library generation and as such, calculations for normalization should be based upon concentration in ng/&amp;amp;micro;L. This is in contrast to normalization for pooling of final libraries, where calculations are based upon concentration in nM since the number of molecules is important to achieve a desired read distribution when sequencing.&lt;br /&gt;
&lt;br /&gt;
==Unique versus Combinatorial Dual Indexing==&lt;br /&gt;
:Combinatorial dual indexing is a technique that uses a set of Index 1 (denoted as i7) and Index 2(denoted as i5) barcodes that are combined in a manner such that it produces distinct i7 and i5 pairs which increases multiplexing capacity for sequencing. With combinatorial dual indexes, each i7 and i5 is shared among other samples on the same plate, typically with i5&#039;s repeating across rows and i7&#039;s down columns. &#039;&#039;These combinations are unique but individual indexes used are not&#039;&#039;. However, a phenomenon known as &#039;index hopping&#039; has been observed when sequencing multiplexed libraries that followed single or combinatorial indexing schemes with newer Illumina platforms utilizing ExAmp chemistry such as the NovaSeq ([[Media:Index_Hopping.pdf |Costello et al., 2018]]). This swapping of indexes causes reads to be mis-assigned and subsequently excluded from further analysis. The primary strategy employed to mitigate the effects of index hopping is through the utilization of unique dual indexes.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Unique dual indexes (UDI) are non-redundant indexes where each i5 and i7 has a distinct index sequence. As opposed to combinatorial dual indexing, an i7 and i5 index is never repeated nor shared among other samples (i.e. for a 96-well UDI index plate, there are 96 unique i7&#039;s and 96 unique i5&#039;s). Both the combinations and individual indexes used are unique, and as a result the frequency of mis-assigned reads due to index hopping is greatly reduced. The BioMicro Center recommends that UDI&#039;s always be used when sequencing on the NovaSeq. The number of libraries that can be multiplexed and sequenced on a single lane is determined by the total number of UDI&#039;s provided for each library preparation method.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:DNA_HTL&amp;diff=131429</id>
		<title>BioMicroCenter:DNA HTL</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:DNA_HTL&amp;diff=131429"/>
		<updated>2026-04-30T18:48:12Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* 16S / AMPLICON SEQUENCING */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
= High-throughput DNA Library Preparation =&lt;br /&gt;
The BioMicro Center offers high-throuhgput DNA library preparation ([[BioMicroCenter:FAQ#STANDARD_versus_HIGH_THROUGHPUT_LIBRARY_PREPARATION|HTL-DNA]]) for both intact and fragmented samples as well as for metagenomics/amplicon generation. High-throughput library generation focuses on reducing price and processing time on a per sample basis. To do this, there are several key differences from our standard library preparation service. First, HTL-DNA services have set batch sizes (24 and 96) with fixed price points (i.e. charge for 16 samples will be the as 24 samples; similarly for 80 samples as 96). If under these batch sizes, DO MORE REPLICATES to simultaneously enhance experimental power and reduce price per sample. Some samples may fail and the cost of re-prepping those samples is NOT included in the quoted cost unless re-prep of the entire plate is deemed necessary. Re-preps can be done by hand, but at a higher rate. Second, the HTL option focuses on reducing price and processing time per sample, so some routine services provided with standard library preparation - such as initial and final quality control for all samples, sample arraying, or automatic re-prep of failed samples - are not built in. These services are available as add ons to the original service request. &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;Reminder: &amp;lt;/b&amp;gt; high throughput projects are treated with &amp;lt;b&amp;gt;one condition&amp;lt;/b&amp;gt; (PCR cycles, fragmentation time, etc...). They are meant for allowing high replicates of the same samples. High throughput submissions for projects with multiple sub-projects from separate individuals combined on the same plate result in a low success rate due to the different conditions for each sub project. Therefore, htl submissions from multiple projects will tolerate and may expect, failure rates well over 10%.&lt;br /&gt;
&lt;br /&gt;
== FRAGMENTED DNA ==&lt;br /&gt;
=== NEB Ultra II ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Fragmented DNA (i.e. ChIP-Seq, small PCR amplicons)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 100pg - 75ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples all [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to same concentration in 10&amp;amp;micro;L (100pg/&amp;amp;micro;L - 7.5ng/&amp;amp;micro;L)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris pH 8.0&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 10&amp;amp;micro;L 10mM Tris pH 8.0&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II is used for standard ligation-mediated PCR based approaches. We have miniaturized the reaction volume to a 1/5th scale that reliably performs on inputs ranging from 10pg to 75ng (recommended minimum of 100pg). The reaction begins with 10&amp;amp;micro;L of normalized sample to which reagents are added. As such, initial submission of clean samples that have been pre-normalized in greater than 10&amp;amp;micro;L of appropriate buffer will hasten sample processing. &lt;br /&gt;
&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:Ultra_II_DNA_Input.jpg | 400px]] [[IMAGE:Ultra_II_FAtrace.jpg | 400px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== INTACT GENOMES ==&lt;br /&gt;
=== Nextera Flex ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact DNA and large amplicons&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 1ng - 50ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples all [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to same concentration in 3µL (330pg/µL - 16.5ng/µL, *higher is better)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 3&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms except 40SE HiSeq&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]] &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Unlike XT, Nextera Flex, also known as Illumina DNA Prep, utilizes bead-linked transposomes (BLT) to tagment and generate libraries from intact DNA samples. These BLTs control sizing during the tagmentation reaction by sterics, producing a much more consistent libraries with larger size distribution which makes it ideal for larger paired-end runs on sequencers.&lt;br /&gt;
:Nextera Flex is currently run at a 1/10th miniaturization scale on the Mosquito HV with a broader dynamic range of input (1ng - 50ng) compared to XT. Nextera Flex self-normalizes at a certain input (if sample concentration is 3ng/&amp;amp;micro;L or greater) and submissions do not have to be normalized so long as that threshold is met. Up to 384 libraries can be multiplexed using Nextera unique dual-indexes (UDI) which helps to avoid issues with &#039;barcode hopping&#039;.&lt;br /&gt;
::::[[IMAGE:Flex_Diagram.jpg | 500px]]&lt;br /&gt;
::::::[[IMAGE:Flex_Trace.jpg | 300px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Nextera XT ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact DNA and large amplicons&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt; 0.2ng/&amp;amp;micro;L&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to 0.2ng/&amp;amp;micro;L&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL#Quadrant_Layout|1st quadrant]] of a 384-well LVSD plate (Available at BMC)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Nextera XT is a solution-based &amp;quot;tagmentation&amp;quot; chemistry used for the preparation of intact DNA samples to generate libraries with smaller insert sizes which is best suited for 40bp single-end runs on sequencers. Nextera XT has been miniaturized to a 1/12th reaction volume on our Mosquito HV from minimal low sample concentration (0.2ng/&amp;amp;micro;L or greater) and up to 384 libraries can be run on a single sequencing lane using dual indexes.&lt;br /&gt;
:The Mosquito HV allows for libraries to be prepared at decreased volumes which results in significantly reduced costs but also lowers library complexity. As such, it is most suitable for single cell and amplicon analysis. De novo work should not be done using Nextera XT preps on the Mosquito HV.&lt;br /&gt;
&lt;br /&gt;
::[[IMAGE:Nextera_Illumina_fig1.jpg | 200px]][[IMAGE:XT_Trace.jpg | 250px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== 16S / AMPLICON SEQUENCING ==&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:350px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |+ &#039;&#039;&#039;16S Metagenomic/Amplicon Library Preparation&#039;&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 100px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 250px;&amp;quot; | General requirements&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Clean DNA&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | As available&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 48 samples* &amp;lt;br&amp;gt; The BioMicro Center &#039;&#039;&#039;strongly&#039;&#039;&#039; encourages leaving space for 4 control samples within each batch of 48. &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column from left to right in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 250PE/300PE MiSeq&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Initial qPCR &amp;lt;BR&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=4110 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
  |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[[image:16S_layout.jpg|thumb|200px|16S v4 region is amplified in standard BioMicro Center preps. Other regions can be substituted by submitting oligos with different variable regions. (Lopez-Aladid et al Sci. Rep. 2023)]] &lt;br /&gt;
:The BioMicro Center offers 16S and amplicon sequencing for metagenomics projects. Derived from the [http://be.mit.edu/directory/eric-alm Alm Lab] with support from a pilot grant from [http://cehs.mit.edu/ MIT CEHS], our protocol uses a two step amplification to first expand the 16S population and add defined 3&#039; and 5&#039; sequences which are then used to add Illumina anchors and sequences. This two step method allows easy multiplexing and the ability change the amplicon insert sequence at minimal cost. &lt;br /&gt;
[[image:16S_diagram.jpg|thumb|400px|Standard NGS amplicon design]]&lt;br /&gt;
:The same method used for 16S is also applicable to other amplicons as well with minor adaption. Because we use a nested PCR, only the internal sequences need to be modified. The adapter sequences - Green:Blue - are the key element of this method. On the 5&#039; end, they contain a &amp;quot;YRYR&amp;quot; sequence that introduces the complexity required for Illumina sequencing. &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
::FORWARD: &amp;lt;font color=green&amp;gt;ACACGACGCTCTTCCGATCT&amp;lt;/font&amp;gt;&amp;lt;font color=orange&amp;gt;&#039;&#039;&#039;YRYR&#039;&#039;&#039;&amp;lt;/font&amp;gt;&amp;lt;font color=blue&amp;gt;XXXXXXX&amp;lt;/font&amp;gt;&lt;br /&gt;
::REVERSE: &amp;lt;font color=green&amp;gt;CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT&amp;lt;/font&amp;gt;&amp;lt;font color=blue&amp;gt;XXXXXXX&amp;lt;/font&amp;gt;&lt;br /&gt;
::(&amp;lt;font color=blue&amp;gt;X&amp;lt;/font&amp;gt; = insert element)&lt;br /&gt;
:{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;margin-left: auto; margin-right: auto; border: none;&amp;quot;&lt;br /&gt;
    |+ &#039;&#039;&#039;Regions&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2;&amp;quot; | Target Region&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2&amp;quot; | Forward Primer&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2&amp;quot; | Reverse Primer&lt;br /&gt;
    |-&lt;br /&gt;
    | colspan=&amp;quot;3&amp;quot; style=&amp;quot;text-align: center; height: 0.5em; background: #d0e5f5;&amp;quot; |&#039;&#039;&#039;Standard Region&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |16S V4&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U515F&amp;lt;br&amp;gt;GTGCCAGCMGCCGCGGTAA&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: E786R&amp;lt;br&amp;gt;GGACTACHVGGGTWTCTAAT&lt;br /&gt;
    |-&lt;br /&gt;
    | colspan=&amp;quot;3&amp;quot; style=&amp;quot;text-align: center; height: 0.5em; background: #d0e5f5;&amp;quot; |&#039;&#039;&#039;Alternative Regions&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |16S V1-V3&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U24F&amp;lt;br&amp;gt;GAGTTTGATYMTGGCTCAG&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U553R&amp;lt;br&amp;gt;GCGGCTGCTGGCACG&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |18S&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |-&lt;br /&gt;
    |}&lt;br /&gt;
:The most common source of failures for amplicon sequencing are samples that fail to amplify in the initial qPCR. The first step of the process is a qPCR reaction using the forward and reverse primers of the specific target regions to determine the number of cycles to be used in library generation. Libraries that fail to amplify in 20 cycles generally perform poorly enough to be unusable. Removal of PCR inhibitors is critical to success of this protocol. We do attempt to do this by serially diluting the samples and testing dilutions in the initial qPCR.&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
= USEFUL INFORMATION =&lt;br /&gt;
== DNA Pre-load Submissions ==&lt;br /&gt;
:Describes samples that upon submission to the BMC can be immediately plugged into the preparatory method that has been specified in the project submission form. This option is provided to reduce library preparation costs and expedite sample processing by minimizing hands-on time by a BMC staff. The specific requirements are listed for each preparatory method (excluding 16S) in the tables above. These specifications must be met in order to qualify as a pre-load, submissions otherwise may be subject to additional charges.&amp;lt;br&amp;gt; &lt;br /&gt;
:Due to the nature of a pre-load submission, the entire volume of sample submitted will be used and as such, additional services are not typically offered unless coordinated with a BMC technician. It is important to keep this in mind when submitting precious samples and the BMC recommends to save a portion of sample when possibly.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Quadrant Layout ==&lt;br /&gt;
:At the BioMicro Center, we organize our high-throughput projects in 384-well plates using a quadrant layout. With quadrant 1 (Q1) representing one 96-well plate, quadrant 2 (Q2) representing a second 96-well plate and so on up to Q4. We ask that plates being submitted start with Q1 and arrayed column-wise. Below is a diagram illustrating the desired filled quadrant.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{|style=&amp;quot;background: white;&amp;quot; border=&amp;quot;0&amp;quot; height=&amp;quot;230&amp;quot; align=&amp;quot;center&amp;quot; valign=&amp;quot;bottom&amp;quot; cellpadding=10px cellspacing=30px&lt;br /&gt;
|-align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
|&#039;&#039;&#039;Quadrant 1 of 384-well plate&#039;&#039;&#039; &amp;lt;br&amp;gt; [[IMAGE:Quadrant_1.jpg|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Normalization ==&lt;br /&gt;
:Normalization is referring to bringing all samples to a uniform concentration. For library preparation, uniform input mass is necessary for proper library generation and as such, calculations for normalization should be based upon concentration in ng/&amp;amp;micro;L. This is in contrast to normalization for pooling of final libraries, where calculations are based upon concentration in nM since the number of molecules is important to achieve a desired read distribution when sequencing.&lt;br /&gt;
&lt;br /&gt;
==Unique versus Combinatorial Dual Indexing==&lt;br /&gt;
:Combinatorial dual indexing is a technique that uses a set of Index 1 (denoted as i7) and Index 2(denoted as i5) barcodes that are combined in a manner such that it produces distinct i7 and i5 pairs which increases multiplexing capacity for sequencing. With combinatorial dual indexes, each i7 and i5 is shared among other samples on the same plate, typically with i5&#039;s repeating across rows and i7&#039;s down columns. &#039;&#039;These combinations are unique but individual indexes used are not&#039;&#039;. However, a phenomenon known as &#039;index hopping&#039; has been observed when sequencing multiplexed libraries that followed single or combinatorial indexing schemes with newer Illumina platforms utilizing ExAmp chemistry such as the NovaSeq ([[Media:Index_Hopping.pdf |Costello et al., 2018]]). This swapping of indexes causes reads to be mis-assigned and subsequently excluded from further analysis. The primary strategy employed to mitigate the effects of index hopping is through the utilization of unique dual indexes.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Unique dual indexes (UDI) are non-redundant indexes where each i5 and i7 has a distinct index sequence. As opposed to combinatorial dual indexing, an i7 and i5 index is never repeated nor shared among other samples (i.e. for a 96-well UDI index plate, there are 96 unique i7&#039;s and 96 unique i5&#039;s). Both the combinations and individual indexes used are unique, and as a result the frequency of mis-assigned reads due to index hopping is greatly reduced. The BioMicro Center recommends that UDI&#039;s always be used when sequencing on the NovaSeq. The number of libraries that can be multiplexed and sequenced on a single lane is determined by the total number of UDI&#039;s provided for each library preparation method.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:DNA_HTL&amp;diff=131428</id>
		<title>BioMicroCenter:DNA HTL</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:DNA_HTL&amp;diff=131428"/>
		<updated>2026-04-30T18:47:41Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* Nextera XT */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
= High-throughput DNA Library Preparation =&lt;br /&gt;
The BioMicro Center offers high-throuhgput DNA library preparation ([[BioMicroCenter:FAQ#STANDARD_versus_HIGH_THROUGHPUT_LIBRARY_PREPARATION|HTL-DNA]]) for both intact and fragmented samples as well as for metagenomics/amplicon generation. High-throughput library generation focuses on reducing price and processing time on a per sample basis. To do this, there are several key differences from our standard library preparation service. First, HTL-DNA services have set batch sizes (24 and 96) with fixed price points (i.e. charge for 16 samples will be the as 24 samples; similarly for 80 samples as 96). If under these batch sizes, DO MORE REPLICATES to simultaneously enhance experimental power and reduce price per sample. Some samples may fail and the cost of re-prepping those samples is NOT included in the quoted cost unless re-prep of the entire plate is deemed necessary. Re-preps can be done by hand, but at a higher rate. Second, the HTL option focuses on reducing price and processing time per sample, so some routine services provided with standard library preparation - such as initial and final quality control for all samples, sample arraying, or automatic re-prep of failed samples - are not built in. These services are available as add ons to the original service request. &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;Reminder: &amp;lt;/b&amp;gt; high throughput projects are treated with &amp;lt;b&amp;gt;one condition&amp;lt;/b&amp;gt; (PCR cycles, fragmentation time, etc...). They are meant for allowing high replicates of the same samples. High throughput submissions for projects with multiple sub-projects from separate individuals combined on the same plate result in a low success rate due to the different conditions for each sub project. Therefore, htl submissions from multiple projects will tolerate and may expect, failure rates well over 10%.&lt;br /&gt;
&lt;br /&gt;
== FRAGMENTED DNA ==&lt;br /&gt;
=== NEB Ultra II ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Fragmented DNA (i.e. ChIP-Seq, small PCR amplicons)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 100pg - 75ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples all [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to same concentration in 10&amp;amp;micro;L (100pg/&amp;amp;micro;L - 7.5ng/&amp;amp;micro;L)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris pH 8.0&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 10&amp;amp;micro;L 10mM Tris pH 8.0&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II is used for standard ligation-mediated PCR based approaches. We have miniaturized the reaction volume to a 1/5th scale that reliably performs on inputs ranging from 10pg to 75ng (recommended minimum of 100pg). The reaction begins with 10&amp;amp;micro;L of normalized sample to which reagents are added. As such, initial submission of clean samples that have been pre-normalized in greater than 10&amp;amp;micro;L of appropriate buffer will hasten sample processing. &lt;br /&gt;
&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:Ultra_II_DNA_Input.jpg | 400px]] [[IMAGE:Ultra_II_FAtrace.jpg | 400px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== INTACT GENOMES ==&lt;br /&gt;
=== Nextera Flex ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact DNA and large amplicons&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 1ng - 50ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples all [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to same concentration in 3µL (330pg/µL - 16.5ng/µL, *higher is better)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 3&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms except 40SE HiSeq&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]] &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Unlike XT, Nextera Flex, also known as Illumina DNA Prep, utilizes bead-linked transposomes (BLT) to tagment and generate libraries from intact DNA samples. These BLTs control sizing during the tagmentation reaction by sterics, producing a much more consistent libraries with larger size distribution which makes it ideal for larger paired-end runs on sequencers.&lt;br /&gt;
:Nextera Flex is currently run at a 1/10th miniaturization scale on the Mosquito HV with a broader dynamic range of input (1ng - 50ng) compared to XT. Nextera Flex self-normalizes at a certain input (if sample concentration is 3ng/&amp;amp;micro;L or greater) and submissions do not have to be normalized so long as that threshold is met. Up to 384 libraries can be multiplexed using Nextera unique dual-indexes (UDI) which helps to avoid issues with &#039;barcode hopping&#039;.&lt;br /&gt;
::::[[IMAGE:Flex_Diagram.jpg | 500px]]&lt;br /&gt;
::::::[[IMAGE:Flex_Trace.jpg | 300px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Nextera XT ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact DNA and large amplicons&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt; 0.2ng/&amp;amp;micro;L&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to 0.2ng/&amp;amp;micro;L&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL#Quadrant_Layout|1st quadrant]] of a 384-well LVSD plate (Available at BMC)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Nextera XT is a solution-based &amp;quot;tagmentation&amp;quot; chemistry used for the preparation of intact DNA samples to generate libraries with smaller insert sizes which is best suited for 40bp single-end runs on sequencers. Nextera XT has been miniaturized to a 1/12th reaction volume on our Mosquito HV from minimal low sample concentration (0.2ng/&amp;amp;micro;L or greater) and up to 384 libraries can be run on a single sequencing lane using dual indexes.&lt;br /&gt;
:The Mosquito HV allows for libraries to be prepared at decreased volumes which results in significantly reduced costs but also lowers library complexity. As such, it is most suitable for single cell and amplicon analysis. De novo work should not be done using Nextera XT preps on the Mosquito HV.&lt;br /&gt;
&lt;br /&gt;
::[[IMAGE:Nextera_Illumina_fig1.jpg | 200px]][[IMAGE:XT_Trace.jpg | 250px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== 16S / AMPLICON SEQUENCING ==&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:350px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |+ &#039;&#039;&#039;16S Metagenomic/Amplicon Library Preparation&#039;&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 100px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 250px;&amp;quot; | General requirements&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Clean DNA&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | As available&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 48 samples* &amp;lt;br&amp;gt; The BioMicro Center &#039;&#039;&#039;strongly&#039;&#039;&#039; encourages leaving space for 4 control samples within each batch of 48. &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column from left to right in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 250PE/300PE MiSeq&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 16 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 96 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Initial qPCR &amp;lt;BR&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=4110 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
  |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[[image:16S_layout.jpg|thumb|200px|16S v4 region is amplified in standard BioMicro Center preps. Other regions can be substituted by submitting oligos with different variable regions. (Lopez-Aladid et al Sci. Rep. 2023)]] &lt;br /&gt;
:The BioMicro Center offers 16S and amplicon sequencing for metagenomics projects. Derived from the [http://be.mit.edu/directory/eric-alm Alm Lab] with support from a pilot grant from [http://cehs.mit.edu/ MIT CEHS], our protocol uses a two step amplification to first expand the 16S population and add defined 3&#039; and 5&#039; sequences which are then used to add Illumina anchors and sequences. This two step method allows easy multiplexing and the ability change the amplicon insert sequence at minimal cost. &lt;br /&gt;
[[image:16S_diagram.jpg|thumb|400px|Standard NGS amplicon design]]&lt;br /&gt;
:The same method used for 16S is also applicable to other amplicons as well with minor adaption. Because we use a nested PCR, only the internal sequences need to be modified. The adapter sequences - Green:Blue - are the key element of this method. On the 5&#039; end, they contain a &amp;quot;YRYR&amp;quot; sequence that introduces the complexity required for Illumina sequencing. &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
::FORWARD: &amp;lt;font color=green&amp;gt;ACACGACGCTCTTCCGATCT&amp;lt;/font&amp;gt;&amp;lt;font color=orange&amp;gt;&#039;&#039;&#039;YRYR&#039;&#039;&#039;&amp;lt;/font&amp;gt;&amp;lt;font color=blue&amp;gt;XXXXXXX&amp;lt;/font&amp;gt;&lt;br /&gt;
::REVERSE: &amp;lt;font color=green&amp;gt;CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT&amp;lt;/font&amp;gt;&amp;lt;font color=blue&amp;gt;XXXXXXX&amp;lt;/font&amp;gt;&lt;br /&gt;
::(&amp;lt;font color=blue&amp;gt;X&amp;lt;/font&amp;gt; = insert element)&lt;br /&gt;
:{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;margin-left: auto; margin-right: auto; border: none;&amp;quot;&lt;br /&gt;
    |+ &#039;&#039;&#039;Regions&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2;&amp;quot; | Target Region&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2&amp;quot; | Forward Primer&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2&amp;quot; | Reverse Primer&lt;br /&gt;
    |-&lt;br /&gt;
    | colspan=&amp;quot;3&amp;quot; style=&amp;quot;text-align: center; height: 0.5em; background: #d0e5f5;&amp;quot; |&#039;&#039;&#039;Standard Region&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |16S V4&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U515F&amp;lt;br&amp;gt;GTGCCAGCMGCCGCGGTAA&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: E786R&amp;lt;br&amp;gt;GGACTACHVGGGTWTCTAAT&lt;br /&gt;
    |-&lt;br /&gt;
    | colspan=&amp;quot;3&amp;quot; style=&amp;quot;text-align: center; height: 0.5em; background: #d0e5f5;&amp;quot; |&#039;&#039;&#039;Alternative Regions&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |16S V1-V3&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U24F&amp;lt;br&amp;gt;GAGTTTGATYMTGGCTCAG&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U553R&amp;lt;br&amp;gt;GCGGCTGCTGGCACG&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |18S&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |-&lt;br /&gt;
    |}&lt;br /&gt;
:The most common source of failures for amplicon sequencing are samples that fail to amplify in the initial qPCR. The first step of the process is a qPCR reaction using the forward and reverse primers of the specific target regions to determine the number of cycles to be used in library generation. Libraries that fail to amplify in 20 cycles generally perform poorly enough to be unusable. Removal of PCR inhibitors is critical to success of this protocol. We do attempt to do this by serially diluting the samples and testing dilutions in the initial qPCR.&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
= USEFUL INFORMATION =&lt;br /&gt;
== DNA Pre-load Submissions ==&lt;br /&gt;
:Describes samples that upon submission to the BMC can be immediately plugged into the preparatory method that has been specified in the project submission form. This option is provided to reduce library preparation costs and expedite sample processing by minimizing hands-on time by a BMC staff. The specific requirements are listed for each preparatory method (excluding 16S) in the tables above. These specifications must be met in order to qualify as a pre-load, submissions otherwise may be subject to additional charges.&amp;lt;br&amp;gt; &lt;br /&gt;
:Due to the nature of a pre-load submission, the entire volume of sample submitted will be used and as such, additional services are not typically offered unless coordinated with a BMC technician. It is important to keep this in mind when submitting precious samples and the BMC recommends to save a portion of sample when possibly.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Quadrant Layout ==&lt;br /&gt;
:At the BioMicro Center, we organize our high-throughput projects in 384-well plates using a quadrant layout. With quadrant 1 (Q1) representing one 96-well plate, quadrant 2 (Q2) representing a second 96-well plate and so on up to Q4. We ask that plates being submitted start with Q1 and arrayed column-wise. Below is a diagram illustrating the desired filled quadrant.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{|style=&amp;quot;background: white;&amp;quot; border=&amp;quot;0&amp;quot; height=&amp;quot;230&amp;quot; align=&amp;quot;center&amp;quot; valign=&amp;quot;bottom&amp;quot; cellpadding=10px cellspacing=30px&lt;br /&gt;
|-align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
|&#039;&#039;&#039;Quadrant 1 of 384-well plate&#039;&#039;&#039; &amp;lt;br&amp;gt; [[IMAGE:Quadrant_1.jpg|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Normalization ==&lt;br /&gt;
:Normalization is referring to bringing all samples to a uniform concentration. For library preparation, uniform input mass is necessary for proper library generation and as such, calculations for normalization should be based upon concentration in ng/&amp;amp;micro;L. This is in contrast to normalization for pooling of final libraries, where calculations are based upon concentration in nM since the number of molecules is important to achieve a desired read distribution when sequencing.&lt;br /&gt;
&lt;br /&gt;
==Unique versus Combinatorial Dual Indexing==&lt;br /&gt;
:Combinatorial dual indexing is a technique that uses a set of Index 1 (denoted as i7) and Index 2(denoted as i5) barcodes that are combined in a manner such that it produces distinct i7 and i5 pairs which increases multiplexing capacity for sequencing. With combinatorial dual indexes, each i7 and i5 is shared among other samples on the same plate, typically with i5&#039;s repeating across rows and i7&#039;s down columns. &#039;&#039;These combinations are unique but individual indexes used are not&#039;&#039;. However, a phenomenon known as &#039;index hopping&#039; has been observed when sequencing multiplexed libraries that followed single or combinatorial indexing schemes with newer Illumina platforms utilizing ExAmp chemistry such as the NovaSeq ([[Media:Index_Hopping.pdf |Costello et al., 2018]]). This swapping of indexes causes reads to be mis-assigned and subsequently excluded from further analysis. The primary strategy employed to mitigate the effects of index hopping is through the utilization of unique dual indexes.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Unique dual indexes (UDI) are non-redundant indexes where each i5 and i7 has a distinct index sequence. As opposed to combinatorial dual indexing, an i7 and i5 index is never repeated nor shared among other samples (i.e. for a 96-well UDI index plate, there are 96 unique i7&#039;s and 96 unique i5&#039;s). Both the combinations and individual indexes used are unique, and as a result the frequency of mis-assigned reads due to index hopping is greatly reduced. The BioMicro Center recommends that UDI&#039;s always be used when sequencing on the NovaSeq. The number of libraries that can be multiplexed and sequenced on a single lane is determined by the total number of UDI&#039;s provided for each library preparation method.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:DNA_HTL&amp;diff=131427</id>
		<title>BioMicroCenter:DNA HTL</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:DNA_HTL&amp;diff=131427"/>
		<updated>2026-04-30T18:47:21Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* Nextera XT */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
= High-throughput DNA Library Preparation =&lt;br /&gt;
The BioMicro Center offers high-throuhgput DNA library preparation ([[BioMicroCenter:FAQ#STANDARD_versus_HIGH_THROUGHPUT_LIBRARY_PREPARATION|HTL-DNA]]) for both intact and fragmented samples as well as for metagenomics/amplicon generation. High-throughput library generation focuses on reducing price and processing time on a per sample basis. To do this, there are several key differences from our standard library preparation service. First, HTL-DNA services have set batch sizes (24 and 96) with fixed price points (i.e. charge for 16 samples will be the as 24 samples; similarly for 80 samples as 96). If under these batch sizes, DO MORE REPLICATES to simultaneously enhance experimental power and reduce price per sample. Some samples may fail and the cost of re-prepping those samples is NOT included in the quoted cost unless re-prep of the entire plate is deemed necessary. Re-preps can be done by hand, but at a higher rate. Second, the HTL option focuses on reducing price and processing time per sample, so some routine services provided with standard library preparation - such as initial and final quality control for all samples, sample arraying, or automatic re-prep of failed samples - are not built in. These services are available as add ons to the original service request. &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;Reminder: &amp;lt;/b&amp;gt; high throughput projects are treated with &amp;lt;b&amp;gt;one condition&amp;lt;/b&amp;gt; (PCR cycles, fragmentation time, etc...). They are meant for allowing high replicates of the same samples. High throughput submissions for projects with multiple sub-projects from separate individuals combined on the same plate result in a low success rate due to the different conditions for each sub project. Therefore, htl submissions from multiple projects will tolerate and may expect, failure rates well over 10%.&lt;br /&gt;
&lt;br /&gt;
== FRAGMENTED DNA ==&lt;br /&gt;
=== NEB Ultra II ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Fragmented DNA (i.e. ChIP-Seq, small PCR amplicons)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 100pg - 75ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples all [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to same concentration in 10&amp;amp;micro;L (100pg/&amp;amp;micro;L - 7.5ng/&amp;amp;micro;L)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris pH 8.0&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 10&amp;amp;micro;L 10mM Tris pH 8.0&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II is used for standard ligation-mediated PCR based approaches. We have miniaturized the reaction volume to a 1/5th scale that reliably performs on inputs ranging from 10pg to 75ng (recommended minimum of 100pg). The reaction begins with 10&amp;amp;micro;L of normalized sample to which reagents are added. As such, initial submission of clean samples that have been pre-normalized in greater than 10&amp;amp;micro;L of appropriate buffer will hasten sample processing. &lt;br /&gt;
&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:Ultra_II_DNA_Input.jpg | 400px]] [[IMAGE:Ultra_II_FAtrace.jpg | 400px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== INTACT GENOMES ==&lt;br /&gt;
=== Nextera Flex ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact DNA and large amplicons&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 1ng - 50ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples all [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to same concentration in 3µL (330pg/µL - 16.5ng/µL, *higher is better)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 3&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms except 40SE HiSeq&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]] &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Unlike XT, Nextera Flex, also known as Illumina DNA Prep, utilizes bead-linked transposomes (BLT) to tagment and generate libraries from intact DNA samples. These BLTs control sizing during the tagmentation reaction by sterics, producing a much more consistent libraries with larger size distribution which makes it ideal for larger paired-end runs on sequencers.&lt;br /&gt;
:Nextera Flex is currently run at a 1/10th miniaturization scale on the Mosquito HV with a broader dynamic range of input (1ng - 50ng) compared to XT. Nextera Flex self-normalizes at a certain input (if sample concentration is 3ng/&amp;amp;micro;L or greater) and submissions do not have to be normalized so long as that threshold is met. Up to 384 libraries can be multiplexed using Nextera unique dual-indexes (UDI) which helps to avoid issues with &#039;barcode hopping&#039;.&lt;br /&gt;
::::[[IMAGE:Flex_Diagram.jpg | 500px]]&lt;br /&gt;
::::::[[IMAGE:Flex_Trace.jpg | 300px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Nextera XT ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact DNA and large amplicons&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt; 0.2ng/&amp;amp;micro;L&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to 0.2ng/&amp;amp;micro;L&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL#Quadrant_Layout|1st quadrant]] of a 384-well LVSD plate (Available at BMC)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 40SE HiSeq&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Nextera XT is a solution-based &amp;quot;tagmentation&amp;quot; chemistry used for the preparation of intact DNA samples to generate libraries with smaller insert sizes which is best suited for 40bp single-end runs on sequencers. Nextera XT has been miniaturized to a 1/12th reaction volume on our Mosquito HV from minimal low sample concentration (0.2ng/&amp;amp;micro;L or greater) and up to 384 libraries can be run on a single sequencing lane using dual indexes.&lt;br /&gt;
:The Mosquito HV allows for libraries to be prepared at decreased volumes which results in significantly reduced costs but also lowers library complexity. As such, it is most suitable for single cell and amplicon analysis. De novo work should not be done using Nextera XT preps on the Mosquito HV.&lt;br /&gt;
&lt;br /&gt;
::[[IMAGE:Nextera_Illumina_fig1.jpg | 200px]][[IMAGE:XT_Trace.jpg | 250px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== 16S / AMPLICON SEQUENCING ==&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:350px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |+ &#039;&#039;&#039;16S Metagenomic/Amplicon Library Preparation&#039;&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 100px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 250px;&amp;quot; | General requirements&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Clean DNA&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | As available&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 48 samples* &amp;lt;br&amp;gt; The BioMicro Center &#039;&#039;&#039;strongly&#039;&#039;&#039; encourages leaving space for 4 control samples within each batch of 48. &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column from left to right in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 250PE/300PE MiSeq&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 16 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 96 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Initial qPCR &amp;lt;BR&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=4110 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
  |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[[image:16S_layout.jpg|thumb|200px|16S v4 region is amplified in standard BioMicro Center preps. Other regions can be substituted by submitting oligos with different variable regions. (Lopez-Aladid et al Sci. Rep. 2023)]] &lt;br /&gt;
:The BioMicro Center offers 16S and amplicon sequencing for metagenomics projects. Derived from the [http://be.mit.edu/directory/eric-alm Alm Lab] with support from a pilot grant from [http://cehs.mit.edu/ MIT CEHS], our protocol uses a two step amplification to first expand the 16S population and add defined 3&#039; and 5&#039; sequences which are then used to add Illumina anchors and sequences. This two step method allows easy multiplexing and the ability change the amplicon insert sequence at minimal cost. &lt;br /&gt;
[[image:16S_diagram.jpg|thumb|400px|Standard NGS amplicon design]]&lt;br /&gt;
:The same method used for 16S is also applicable to other amplicons as well with minor adaption. Because we use a nested PCR, only the internal sequences need to be modified. The adapter sequences - Green:Blue - are the key element of this method. On the 5&#039; end, they contain a &amp;quot;YRYR&amp;quot; sequence that introduces the complexity required for Illumina sequencing. &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
::FORWARD: &amp;lt;font color=green&amp;gt;ACACGACGCTCTTCCGATCT&amp;lt;/font&amp;gt;&amp;lt;font color=orange&amp;gt;&#039;&#039;&#039;YRYR&#039;&#039;&#039;&amp;lt;/font&amp;gt;&amp;lt;font color=blue&amp;gt;XXXXXXX&amp;lt;/font&amp;gt;&lt;br /&gt;
::REVERSE: &amp;lt;font color=green&amp;gt;CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT&amp;lt;/font&amp;gt;&amp;lt;font color=blue&amp;gt;XXXXXXX&amp;lt;/font&amp;gt;&lt;br /&gt;
::(&amp;lt;font color=blue&amp;gt;X&amp;lt;/font&amp;gt; = insert element)&lt;br /&gt;
:{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;margin-left: auto; margin-right: auto; border: none;&amp;quot;&lt;br /&gt;
    |+ &#039;&#039;&#039;Regions&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2;&amp;quot; | Target Region&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2&amp;quot; | Forward Primer&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2&amp;quot; | Reverse Primer&lt;br /&gt;
    |-&lt;br /&gt;
    | colspan=&amp;quot;3&amp;quot; style=&amp;quot;text-align: center; height: 0.5em; background: #d0e5f5;&amp;quot; |&#039;&#039;&#039;Standard Region&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |16S V4&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U515F&amp;lt;br&amp;gt;GTGCCAGCMGCCGCGGTAA&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: E786R&amp;lt;br&amp;gt;GGACTACHVGGGTWTCTAAT&lt;br /&gt;
    |-&lt;br /&gt;
    | colspan=&amp;quot;3&amp;quot; style=&amp;quot;text-align: center; height: 0.5em; background: #d0e5f5;&amp;quot; |&#039;&#039;&#039;Alternative Regions&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |16S V1-V3&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U24F&amp;lt;br&amp;gt;GAGTTTGATYMTGGCTCAG&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U553R&amp;lt;br&amp;gt;GCGGCTGCTGGCACG&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |18S&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |-&lt;br /&gt;
    |}&lt;br /&gt;
:The most common source of failures for amplicon sequencing are samples that fail to amplify in the initial qPCR. The first step of the process is a qPCR reaction using the forward and reverse primers of the specific target regions to determine the number of cycles to be used in library generation. Libraries that fail to amplify in 20 cycles generally perform poorly enough to be unusable. Removal of PCR inhibitors is critical to success of this protocol. We do attempt to do this by serially diluting the samples and testing dilutions in the initial qPCR.&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
= USEFUL INFORMATION =&lt;br /&gt;
== DNA Pre-load Submissions ==&lt;br /&gt;
:Describes samples that upon submission to the BMC can be immediately plugged into the preparatory method that has been specified in the project submission form. This option is provided to reduce library preparation costs and expedite sample processing by minimizing hands-on time by a BMC staff. The specific requirements are listed for each preparatory method (excluding 16S) in the tables above. These specifications must be met in order to qualify as a pre-load, submissions otherwise may be subject to additional charges.&amp;lt;br&amp;gt; &lt;br /&gt;
:Due to the nature of a pre-load submission, the entire volume of sample submitted will be used and as such, additional services are not typically offered unless coordinated with a BMC technician. It is important to keep this in mind when submitting precious samples and the BMC recommends to save a portion of sample when possibly.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Quadrant Layout ==&lt;br /&gt;
:At the BioMicro Center, we organize our high-throughput projects in 384-well plates using a quadrant layout. With quadrant 1 (Q1) representing one 96-well plate, quadrant 2 (Q2) representing a second 96-well plate and so on up to Q4. We ask that plates being submitted start with Q1 and arrayed column-wise. Below is a diagram illustrating the desired filled quadrant.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{|style=&amp;quot;background: white;&amp;quot; border=&amp;quot;0&amp;quot; height=&amp;quot;230&amp;quot; align=&amp;quot;center&amp;quot; valign=&amp;quot;bottom&amp;quot; cellpadding=10px cellspacing=30px&lt;br /&gt;
|-align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
|&#039;&#039;&#039;Quadrant 1 of 384-well plate&#039;&#039;&#039; &amp;lt;br&amp;gt; [[IMAGE:Quadrant_1.jpg|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Normalization ==&lt;br /&gt;
:Normalization is referring to bringing all samples to a uniform concentration. For library preparation, uniform input mass is necessary for proper library generation and as such, calculations for normalization should be based upon concentration in ng/&amp;amp;micro;L. This is in contrast to normalization for pooling of final libraries, where calculations are based upon concentration in nM since the number of molecules is important to achieve a desired read distribution when sequencing.&lt;br /&gt;
&lt;br /&gt;
==Unique versus Combinatorial Dual Indexing==&lt;br /&gt;
:Combinatorial dual indexing is a technique that uses a set of Index 1 (denoted as i7) and Index 2(denoted as i5) barcodes that are combined in a manner such that it produces distinct i7 and i5 pairs which increases multiplexing capacity for sequencing. With combinatorial dual indexes, each i7 and i5 is shared among other samples on the same plate, typically with i5&#039;s repeating across rows and i7&#039;s down columns. &#039;&#039;These combinations are unique but individual indexes used are not&#039;&#039;. However, a phenomenon known as &#039;index hopping&#039; has been observed when sequencing multiplexed libraries that followed single or combinatorial indexing schemes with newer Illumina platforms utilizing ExAmp chemistry such as the NovaSeq ([[Media:Index_Hopping.pdf |Costello et al., 2018]]). This swapping of indexes causes reads to be mis-assigned and subsequently excluded from further analysis. The primary strategy employed to mitigate the effects of index hopping is through the utilization of unique dual indexes.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Unique dual indexes (UDI) are non-redundant indexes where each i5 and i7 has a distinct index sequence. As opposed to combinatorial dual indexing, an i7 and i5 index is never repeated nor shared among other samples (i.e. for a 96-well UDI index plate, there are 96 unique i7&#039;s and 96 unique i5&#039;s). Both the combinations and individual indexes used are unique, and as a result the frequency of mis-assigned reads due to index hopping is greatly reduced. The BioMicro Center recommends that UDI&#039;s always be used when sequencing on the NovaSeq. The number of libraries that can be multiplexed and sequenced on a single lane is determined by the total number of UDI&#039;s provided for each library preparation method.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:DNA_HTL&amp;diff=131426</id>
		<title>BioMicroCenter:DNA HTL</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:DNA_HTL&amp;diff=131426"/>
		<updated>2026-04-30T18:46:44Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* Nextera Flex */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
= High-throughput DNA Library Preparation =&lt;br /&gt;
The BioMicro Center offers high-throuhgput DNA library preparation ([[BioMicroCenter:FAQ#STANDARD_versus_HIGH_THROUGHPUT_LIBRARY_PREPARATION|HTL-DNA]]) for both intact and fragmented samples as well as for metagenomics/amplicon generation. High-throughput library generation focuses on reducing price and processing time on a per sample basis. To do this, there are several key differences from our standard library preparation service. First, HTL-DNA services have set batch sizes (24 and 96) with fixed price points (i.e. charge for 16 samples will be the as 24 samples; similarly for 80 samples as 96). If under these batch sizes, DO MORE REPLICATES to simultaneously enhance experimental power and reduce price per sample. Some samples may fail and the cost of re-prepping those samples is NOT included in the quoted cost unless re-prep of the entire plate is deemed necessary. Re-preps can be done by hand, but at a higher rate. Second, the HTL option focuses on reducing price and processing time per sample, so some routine services provided with standard library preparation - such as initial and final quality control for all samples, sample arraying, or automatic re-prep of failed samples - are not built in. These services are available as add ons to the original service request. &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;Reminder: &amp;lt;/b&amp;gt; high throughput projects are treated with &amp;lt;b&amp;gt;one condition&amp;lt;/b&amp;gt; (PCR cycles, fragmentation time, etc...). They are meant for allowing high replicates of the same samples. High throughput submissions for projects with multiple sub-projects from separate individuals combined on the same plate result in a low success rate due to the different conditions for each sub project. Therefore, htl submissions from multiple projects will tolerate and may expect, failure rates well over 10%.&lt;br /&gt;
&lt;br /&gt;
== FRAGMENTED DNA ==&lt;br /&gt;
=== NEB Ultra II ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Fragmented DNA (i.e. ChIP-Seq, small PCR amplicons)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 100pg - 75ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples all [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to same concentration in 10&amp;amp;micro;L (100pg/&amp;amp;micro;L - 7.5ng/&amp;amp;micro;L)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris pH 8.0&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 10&amp;amp;micro;L 10mM Tris pH 8.0&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II is used for standard ligation-mediated PCR based approaches. We have miniaturized the reaction volume to a 1/5th scale that reliably performs on inputs ranging from 10pg to 75ng (recommended minimum of 100pg). The reaction begins with 10&amp;amp;micro;L of normalized sample to which reagents are added. As such, initial submission of clean samples that have been pre-normalized in greater than 10&amp;amp;micro;L of appropriate buffer will hasten sample processing. &lt;br /&gt;
&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:Ultra_II_DNA_Input.jpg | 400px]] [[IMAGE:Ultra_II_FAtrace.jpg | 400px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== INTACT GENOMES ==&lt;br /&gt;
=== Nextera Flex ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact DNA and large amplicons&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 1ng - 50ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples all [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to same concentration in 3µL (330pg/µL - 16.5ng/µL, *higher is better)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 3&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms except 40SE HiSeq&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]] &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Unlike XT, Nextera Flex, also known as Illumina DNA Prep, utilizes bead-linked transposomes (BLT) to tagment and generate libraries from intact DNA samples. These BLTs control sizing during the tagmentation reaction by sterics, producing a much more consistent libraries with larger size distribution which makes it ideal for larger paired-end runs on sequencers.&lt;br /&gt;
:Nextera Flex is currently run at a 1/10th miniaturization scale on the Mosquito HV with a broader dynamic range of input (1ng - 50ng) compared to XT. Nextera Flex self-normalizes at a certain input (if sample concentration is 3ng/&amp;amp;micro;L or greater) and submissions do not have to be normalized so long as that threshold is met. Up to 384 libraries can be multiplexed using Nextera unique dual-indexes (UDI) which helps to avoid issues with &#039;barcode hopping&#039;.&lt;br /&gt;
::::[[IMAGE:Flex_Diagram.jpg | 500px]]&lt;br /&gt;
::::::[[IMAGE:Flex_Trace.jpg | 300px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Nextera XT ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact DNA and large amplicons&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt; 0.2ng/&amp;amp;micro;L&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to 0.2ng/&amp;amp;micro;L&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL#Quadrant_Layout|1st quadrant]] of a 384-well LVSD plate (Available at BMC)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 40SE HiSeq&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 16 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Nextera XT is a solution-based &amp;quot;tagmentation&amp;quot; chemistry used for the preparation of intact DNA samples to generate libraries with smaller insert sizes which is best suited for 40bp single-end runs on sequencers. Nextera XT has been miniaturized to a 1/12th reaction volume on our Mosquito HV from minimal low sample concentration (0.2ng/&amp;amp;micro;L or greater) and up to 384 libraries can be run on a single sequencing lane using dual indexes.&lt;br /&gt;
:The Mosquito HV allows for libraries to be prepared at decreased volumes which results in significantly reduced costs but also lowers library complexity. As such, it is most suitable for single cell and amplicon analysis. De novo work should not be done using Nextera XT preps on the Mosquito HV.&lt;br /&gt;
&lt;br /&gt;
::[[IMAGE:Nextera_Illumina_fig1.jpg | 200px]][[IMAGE:XT_Trace.jpg | 250px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== 16S / AMPLICON SEQUENCING ==&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:350px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |+ &#039;&#039;&#039;16S Metagenomic/Amplicon Library Preparation&#039;&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 100px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 250px;&amp;quot; | General requirements&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Clean DNA&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | As available&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 48 samples* &amp;lt;br&amp;gt; The BioMicro Center &#039;&#039;&#039;strongly&#039;&#039;&#039; encourages leaving space for 4 control samples within each batch of 48. &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column from left to right in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 250PE/300PE MiSeq&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 16 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 96 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Initial qPCR &amp;lt;BR&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=4110 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
  |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[[image:16S_layout.jpg|thumb|200px|16S v4 region is amplified in standard BioMicro Center preps. Other regions can be substituted by submitting oligos with different variable regions. (Lopez-Aladid et al Sci. Rep. 2023)]] &lt;br /&gt;
:The BioMicro Center offers 16S and amplicon sequencing for metagenomics projects. Derived from the [http://be.mit.edu/directory/eric-alm Alm Lab] with support from a pilot grant from [http://cehs.mit.edu/ MIT CEHS], our protocol uses a two step amplification to first expand the 16S population and add defined 3&#039; and 5&#039; sequences which are then used to add Illumina anchors and sequences. This two step method allows easy multiplexing and the ability change the amplicon insert sequence at minimal cost. &lt;br /&gt;
[[image:16S_diagram.jpg|thumb|400px|Standard NGS amplicon design]]&lt;br /&gt;
:The same method used for 16S is also applicable to other amplicons as well with minor adaption. Because we use a nested PCR, only the internal sequences need to be modified. The adapter sequences - Green:Blue - are the key element of this method. On the 5&#039; end, they contain a &amp;quot;YRYR&amp;quot; sequence that introduces the complexity required for Illumina sequencing. &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
::FORWARD: &amp;lt;font color=green&amp;gt;ACACGACGCTCTTCCGATCT&amp;lt;/font&amp;gt;&amp;lt;font color=orange&amp;gt;&#039;&#039;&#039;YRYR&#039;&#039;&#039;&amp;lt;/font&amp;gt;&amp;lt;font color=blue&amp;gt;XXXXXXX&amp;lt;/font&amp;gt;&lt;br /&gt;
::REVERSE: &amp;lt;font color=green&amp;gt;CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT&amp;lt;/font&amp;gt;&amp;lt;font color=blue&amp;gt;XXXXXXX&amp;lt;/font&amp;gt;&lt;br /&gt;
::(&amp;lt;font color=blue&amp;gt;X&amp;lt;/font&amp;gt; = insert element)&lt;br /&gt;
:{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;margin-left: auto; margin-right: auto; border: none;&amp;quot;&lt;br /&gt;
    |+ &#039;&#039;&#039;Regions&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2;&amp;quot; | Target Region&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2&amp;quot; | Forward Primer&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2&amp;quot; | Reverse Primer&lt;br /&gt;
    |-&lt;br /&gt;
    | colspan=&amp;quot;3&amp;quot; style=&amp;quot;text-align: center; height: 0.5em; background: #d0e5f5;&amp;quot; |&#039;&#039;&#039;Standard Region&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |16S V4&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U515F&amp;lt;br&amp;gt;GTGCCAGCMGCCGCGGTAA&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: E786R&amp;lt;br&amp;gt;GGACTACHVGGGTWTCTAAT&lt;br /&gt;
    |-&lt;br /&gt;
    | colspan=&amp;quot;3&amp;quot; style=&amp;quot;text-align: center; height: 0.5em; background: #d0e5f5;&amp;quot; |&#039;&#039;&#039;Alternative Regions&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |16S V1-V3&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U24F&amp;lt;br&amp;gt;GAGTTTGATYMTGGCTCAG&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U553R&amp;lt;br&amp;gt;GCGGCTGCTGGCACG&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |18S&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |-&lt;br /&gt;
    |}&lt;br /&gt;
:The most common source of failures for amplicon sequencing are samples that fail to amplify in the initial qPCR. The first step of the process is a qPCR reaction using the forward and reverse primers of the specific target regions to determine the number of cycles to be used in library generation. Libraries that fail to amplify in 20 cycles generally perform poorly enough to be unusable. Removal of PCR inhibitors is critical to success of this protocol. We do attempt to do this by serially diluting the samples and testing dilutions in the initial qPCR.&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
= USEFUL INFORMATION =&lt;br /&gt;
== DNA Pre-load Submissions ==&lt;br /&gt;
:Describes samples that upon submission to the BMC can be immediately plugged into the preparatory method that has been specified in the project submission form. This option is provided to reduce library preparation costs and expedite sample processing by minimizing hands-on time by a BMC staff. The specific requirements are listed for each preparatory method (excluding 16S) in the tables above. These specifications must be met in order to qualify as a pre-load, submissions otherwise may be subject to additional charges.&amp;lt;br&amp;gt; &lt;br /&gt;
:Due to the nature of a pre-load submission, the entire volume of sample submitted will be used and as such, additional services are not typically offered unless coordinated with a BMC technician. It is important to keep this in mind when submitting precious samples and the BMC recommends to save a portion of sample when possibly.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Quadrant Layout ==&lt;br /&gt;
:At the BioMicro Center, we organize our high-throughput projects in 384-well plates using a quadrant layout. With quadrant 1 (Q1) representing one 96-well plate, quadrant 2 (Q2) representing a second 96-well plate and so on up to Q4. We ask that plates being submitted start with Q1 and arrayed column-wise. Below is a diagram illustrating the desired filled quadrant.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{|style=&amp;quot;background: white;&amp;quot; border=&amp;quot;0&amp;quot; height=&amp;quot;230&amp;quot; align=&amp;quot;center&amp;quot; valign=&amp;quot;bottom&amp;quot; cellpadding=10px cellspacing=30px&lt;br /&gt;
|-align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
|&#039;&#039;&#039;Quadrant 1 of 384-well plate&#039;&#039;&#039; &amp;lt;br&amp;gt; [[IMAGE:Quadrant_1.jpg|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Normalization ==&lt;br /&gt;
:Normalization is referring to bringing all samples to a uniform concentration. For library preparation, uniform input mass is necessary for proper library generation and as such, calculations for normalization should be based upon concentration in ng/&amp;amp;micro;L. This is in contrast to normalization for pooling of final libraries, where calculations are based upon concentration in nM since the number of molecules is important to achieve a desired read distribution when sequencing.&lt;br /&gt;
&lt;br /&gt;
==Unique versus Combinatorial Dual Indexing==&lt;br /&gt;
:Combinatorial dual indexing is a technique that uses a set of Index 1 (denoted as i7) and Index 2(denoted as i5) barcodes that are combined in a manner such that it produces distinct i7 and i5 pairs which increases multiplexing capacity for sequencing. With combinatorial dual indexes, each i7 and i5 is shared among other samples on the same plate, typically with i5&#039;s repeating across rows and i7&#039;s down columns. &#039;&#039;These combinations are unique but individual indexes used are not&#039;&#039;. However, a phenomenon known as &#039;index hopping&#039; has been observed when sequencing multiplexed libraries that followed single or combinatorial indexing schemes with newer Illumina platforms utilizing ExAmp chemistry such as the NovaSeq ([[Media:Index_Hopping.pdf |Costello et al., 2018]]). This swapping of indexes causes reads to be mis-assigned and subsequently excluded from further analysis. The primary strategy employed to mitigate the effects of index hopping is through the utilization of unique dual indexes.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Unique dual indexes (UDI) are non-redundant indexes where each i5 and i7 has a distinct index sequence. As opposed to combinatorial dual indexing, an i7 and i5 index is never repeated nor shared among other samples (i.e. for a 96-well UDI index plate, there are 96 unique i7&#039;s and 96 unique i5&#039;s). Both the combinations and individual indexes used are unique, and as a result the frequency of mis-assigned reads due to index hopping is greatly reduced. The BioMicro Center recommends that UDI&#039;s always be used when sequencing on the NovaSeq. The number of libraries that can be multiplexed and sequenced on a single lane is determined by the total number of UDI&#039;s provided for each library preparation method.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:DNA_HTL&amp;diff=131425</id>
		<title>BioMicroCenter:DNA HTL</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:DNA_HTL&amp;diff=131425"/>
		<updated>2026-04-30T18:46:25Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* NEB Ultra II */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
= High-throughput DNA Library Preparation =&lt;br /&gt;
The BioMicro Center offers high-throuhgput DNA library preparation ([[BioMicroCenter:FAQ#STANDARD_versus_HIGH_THROUGHPUT_LIBRARY_PREPARATION|HTL-DNA]]) for both intact and fragmented samples as well as for metagenomics/amplicon generation. High-throughput library generation focuses on reducing price and processing time on a per sample basis. To do this, there are several key differences from our standard library preparation service. First, HTL-DNA services have set batch sizes (24 and 96) with fixed price points (i.e. charge for 16 samples will be the as 24 samples; similarly for 80 samples as 96). If under these batch sizes, DO MORE REPLICATES to simultaneously enhance experimental power and reduce price per sample. Some samples may fail and the cost of re-prepping those samples is NOT included in the quoted cost unless re-prep of the entire plate is deemed necessary. Re-preps can be done by hand, but at a higher rate. Second, the HTL option focuses on reducing price and processing time per sample, so some routine services provided with standard library preparation - such as initial and final quality control for all samples, sample arraying, or automatic re-prep of failed samples - are not built in. These services are available as add ons to the original service request. &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;b&amp;gt;Reminder: &amp;lt;/b&amp;gt; high throughput projects are treated with &amp;lt;b&amp;gt;one condition&amp;lt;/b&amp;gt; (PCR cycles, fragmentation time, etc...). They are meant for allowing high replicates of the same samples. High throughput submissions for projects with multiple sub-projects from separate individuals combined on the same plate result in a low success rate due to the different conditions for each sub project. Therefore, htl submissions from multiple projects will tolerate and may expect, failure rates well over 10%.&lt;br /&gt;
&lt;br /&gt;
== FRAGMENTED DNA ==&lt;br /&gt;
=== NEB Ultra II ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Fragmented DNA (i.e. ChIP-Seq, small PCR amplicons)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 100pg - 75ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples all [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to same concentration in 10&amp;amp;micro;L (100pg/&amp;amp;micro;L - 7.5ng/&amp;amp;micro;L)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris pH 8.0&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 10&amp;amp;micro;L 10mM Tris pH 8.0&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL#Quadrant_Layout|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; |384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:NEBNext Ultra II is used for standard ligation-mediated PCR based approaches. We have miniaturized the reaction volume to a 1/5th scale that reliably performs on inputs ranging from 10pg to 75ng (recommended minimum of 100pg). The reaction begins with 10&amp;amp;micro;L of normalized sample to which reagents are added. As such, initial submission of clean samples that have been pre-normalized in greater than 10&amp;amp;micro;L of appropriate buffer will hasten sample processing. &lt;br /&gt;
&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
:[[IMAGE:Ultra_II_DNA_Input.jpg | 400px]] [[IMAGE:Ultra_II_FAtrace.jpg | 400px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== INTACT GENOMES ==&lt;br /&gt;
=== Nextera Flex ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact DNA and large amplicons&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 1ng - 50ng&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples all [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to same concentration in 3µL (330pg/µL - 16.5ng/µL, *higher is better)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 3&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL|1st quadrant]] of 384-well hard-shell plate (BioRad)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | All platforms except 40SE HiSeq&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]] &#039;&#039;not available&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Unlike XT, Nextera Flex, also known as Illumina DNA Prep, utilizes bead-linked transposomes (BLT) to tagment and generate libraries from intact DNA samples. These BLTs control sizing during the tagmentation reaction by sterics, producing a much more consistent libraries with larger size distribution which makes it ideal for larger paired-end runs on sequencers.&lt;br /&gt;
:Nextera Flex is currently run at a 1/10th miniaturization scale on the Mosquito HV with a broader dynamic range of input (1ng - 50ng) compared to XT. Nextera Flex self-normalizes at a certain input (if sample concentration is 3ng/&amp;amp;micro;L or greater) and submissions do not have to be normalized so long as that threshold is met. Up to 384 libraries can be multiplexed using Nextera unique dual-indexes (UDI) which helps to avoid issues with &#039;barcode hopping&#039;.&lt;br /&gt;
::::[[IMAGE:Flex_Diagram.jpg | 500px]]&lt;br /&gt;
::::::[[IMAGE:Flex_Trace.jpg | 300px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Nextera XT ===&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:500px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | General requirements&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|Pre-load requirements]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Intact DNA and large amplicons&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt; 0.2ng/&amp;amp;micro;L&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples [[BioMicroCenter:DNA_HTL#Normalization|normalized]] to 0.2ng/&amp;amp;micro;L&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Exactly 5&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 24 samples &amp;lt;BR&amp;gt; 96 samples&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples arrayed by column in [[BioMicroCenter:DNA_HTL#Quadrant_Layout|1st quadrant]] of a 384-well LVSD plate (Available at BMC)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 40SE HiSeq&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 16 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 384 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &amp;lt;BR&amp;gt; Sample re-prep&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:DNA_HTL#DNA_Pre-load_Submissions|N/A]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | colspan=&amp;quot;2&amp;quot; style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:Nextera XT is a solution-based &amp;quot;tagmentation&amp;quot; chemistry used for the preparation of intact DNA samples to generate libraries with smaller insert sizes which is best suited for 40bp single-end runs on sequencers. Nextera XT has been miniaturized to a 1/12th reaction volume on our Mosquito HV from minimal low sample concentration (0.2ng/&amp;amp;micro;L or greater) and up to 384 libraries can be run on a single sequencing lane using dual indexes.&lt;br /&gt;
:The Mosquito HV allows for libraries to be prepared at decreased volumes which results in significantly reduced costs but also lowers library complexity. As such, it is most suitable for single cell and amplicon analysis. De novo work should not be done using Nextera XT preps on the Mosquito HV.&lt;br /&gt;
&lt;br /&gt;
::[[IMAGE:Nextera_Illumina_fig1.jpg | 200px]][[IMAGE:XT_Trace.jpg | 250px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== 16S / AMPLICON SEQUENCING ==&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:350px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |+ &#039;&#039;&#039;16S Metagenomic/Amplicon Library Preparation&#039;&#039;&#039;&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 100px;&amp;quot; | Parameter&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 250px;&amp;quot; | General requirements&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SAMPLE INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Clean DNA&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | RANGE OF INPUT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | As available&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION VOLUME&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &amp;gt;10&amp;amp;micro;L 10 mM Tris Buffer&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 48 samples* &amp;lt;br&amp;gt; The BioMicro Center &#039;&#039;&#039;strongly&#039;&#039;&#039; encourages leaving space for 4 control samples within each batch of 48. &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PLATE SETUP&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Samples should be arrayed by column from left to right in a 96-well full-skirt plate (Axygen)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SEQUENCING RECOMMENDATIONS&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 250PE/300PE MiSeq&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INDEX AVAILABILITY&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 16 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 96 [[BioMicroCenter:DNA_HTL#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | INCLUDED&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Initial qPCR &amp;lt;BR&amp;gt; Library preparation &amp;lt;BR&amp;gt; Spot check of final libraries&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ADDITIONAL SERVICES AVAILABLE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Sample QC &amp;lt;BR&amp;gt; Sample cleaning &amp;lt;BR&amp;gt; Sample arraying &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SUBMISSION FORM&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=4110 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | PRICING&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [[BioMicroCenter:Pricing#ILLUMINA_LIBRARY_-_DNA|LINK]]&lt;br /&gt;
  |}&lt;br /&gt;
  |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[[image:16S_layout.jpg|thumb|200px|16S v4 region is amplified in standard BioMicro Center preps. Other regions can be substituted by submitting oligos with different variable regions. (Lopez-Aladid et al Sci. Rep. 2023)]] &lt;br /&gt;
:The BioMicro Center offers 16S and amplicon sequencing for metagenomics projects. Derived from the [http://be.mit.edu/directory/eric-alm Alm Lab] with support from a pilot grant from [http://cehs.mit.edu/ MIT CEHS], our protocol uses a two step amplification to first expand the 16S population and add defined 3&#039; and 5&#039; sequences which are then used to add Illumina anchors and sequences. This two step method allows easy multiplexing and the ability change the amplicon insert sequence at minimal cost. &lt;br /&gt;
[[image:16S_diagram.jpg|thumb|400px|Standard NGS amplicon design]]&lt;br /&gt;
:The same method used for 16S is also applicable to other amplicons as well with minor adaption. Because we use a nested PCR, only the internal sequences need to be modified. The adapter sequences - Green:Blue - are the key element of this method. On the 5&#039; end, they contain a &amp;quot;YRYR&amp;quot; sequence that introduces the complexity required for Illumina sequencing. &lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
::FORWARD: &amp;lt;font color=green&amp;gt;ACACGACGCTCTTCCGATCT&amp;lt;/font&amp;gt;&amp;lt;font color=orange&amp;gt;&#039;&#039;&#039;YRYR&#039;&#039;&#039;&amp;lt;/font&amp;gt;&amp;lt;font color=blue&amp;gt;XXXXXXX&amp;lt;/font&amp;gt;&lt;br /&gt;
::REVERSE: &amp;lt;font color=green&amp;gt;CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT&amp;lt;/font&amp;gt;&amp;lt;font color=blue&amp;gt;XXXXXXX&amp;lt;/font&amp;gt;&lt;br /&gt;
::(&amp;lt;font color=blue&amp;gt;X&amp;lt;/font&amp;gt; = insert element)&lt;br /&gt;
:{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;margin-left: auto; margin-right: auto; border: none;&amp;quot;&lt;br /&gt;
    |+ &#039;&#039;&#039;Regions&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2;&amp;quot; | Target Region&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2&amp;quot; | Forward Primer&lt;br /&gt;
    ! style=&amp;quot;text-align: center; width: 200px; background: #F2F2F2&amp;quot; | Reverse Primer&lt;br /&gt;
    |-&lt;br /&gt;
    | colspan=&amp;quot;3&amp;quot; style=&amp;quot;text-align: center; height: 0.5em; background: #d0e5f5;&amp;quot; |&#039;&#039;&#039;Standard Region&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |16S V4&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U515F&amp;lt;br&amp;gt;GTGCCAGCMGCCGCGGTAA&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: E786R&amp;lt;br&amp;gt;GGACTACHVGGGTWTCTAAT&lt;br /&gt;
    |-&lt;br /&gt;
    | colspan=&amp;quot;3&amp;quot; style=&amp;quot;text-align: center; height: 0.5em; background: #d0e5f5;&amp;quot; |&#039;&#039;&#039;Alternative Regions&#039;&#039;&#039;&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |16S V1-V3&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U24F&amp;lt;br&amp;gt;GAGTTTGATYMTGGCTCAG&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |Primer ID: U553R&amp;lt;br&amp;gt;GCGGCTGCTGGCACG&lt;br /&gt;
    |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |18S&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |-&lt;br /&gt;
    | style=&amp;quot;text-align: center; height: 2em; background: #f1f5fc;&amp;quot; |-&lt;br /&gt;
    |}&lt;br /&gt;
:The most common source of failures for amplicon sequencing are samples that fail to amplify in the initial qPCR. The first step of the process is a qPCR reaction using the forward and reverse primers of the specific target regions to determine the number of cycles to be used in library generation. Libraries that fail to amplify in 20 cycles generally perform poorly enough to be unusable. Removal of PCR inhibitors is critical to success of this protocol. We do attempt to do this by serially diluting the samples and testing dilutions in the initial qPCR.&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
= USEFUL INFORMATION =&lt;br /&gt;
== DNA Pre-load Submissions ==&lt;br /&gt;
:Describes samples that upon submission to the BMC can be immediately plugged into the preparatory method that has been specified in the project submission form. This option is provided to reduce library preparation costs and expedite sample processing by minimizing hands-on time by a BMC staff. The specific requirements are listed for each preparatory method (excluding 16S) in the tables above. These specifications must be met in order to qualify as a pre-load, submissions otherwise may be subject to additional charges.&amp;lt;br&amp;gt; &lt;br /&gt;
:Due to the nature of a pre-load submission, the entire volume of sample submitted will be used and as such, additional services are not typically offered unless coordinated with a BMC technician. It is important to keep this in mind when submitting precious samples and the BMC recommends to save a portion of sample when possibly.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Quadrant Layout ==&lt;br /&gt;
:At the BioMicro Center, we organize our high-throughput projects in 384-well plates using a quadrant layout. With quadrant 1 (Q1) representing one 96-well plate, quadrant 2 (Q2) representing a second 96-well plate and so on up to Q4. We ask that plates being submitted start with Q1 and arrayed column-wise. Below is a diagram illustrating the desired filled quadrant.&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
{|style=&amp;quot;background: white;&amp;quot; border=&amp;quot;0&amp;quot; height=&amp;quot;230&amp;quot; align=&amp;quot;center&amp;quot; valign=&amp;quot;bottom&amp;quot; cellpadding=10px cellspacing=30px&lt;br /&gt;
|-align=&amp;quot;center&amp;quot;&lt;br /&gt;
|&lt;br /&gt;
|&#039;&#039;&#039;Quadrant 1 of 384-well plate&#039;&#039;&#039; &amp;lt;br&amp;gt; [[IMAGE:Quadrant_1.jpg|400px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Normalization ==&lt;br /&gt;
:Normalization is referring to bringing all samples to a uniform concentration. For library preparation, uniform input mass is necessary for proper library generation and as such, calculations for normalization should be based upon concentration in ng/&amp;amp;micro;L. This is in contrast to normalization for pooling of final libraries, where calculations are based upon concentration in nM since the number of molecules is important to achieve a desired read distribution when sequencing.&lt;br /&gt;
&lt;br /&gt;
==Unique versus Combinatorial Dual Indexing==&lt;br /&gt;
:Combinatorial dual indexing is a technique that uses a set of Index 1 (denoted as i7) and Index 2(denoted as i5) barcodes that are combined in a manner such that it produces distinct i7 and i5 pairs which increases multiplexing capacity for sequencing. With combinatorial dual indexes, each i7 and i5 is shared among other samples on the same plate, typically with i5&#039;s repeating across rows and i7&#039;s down columns. &#039;&#039;These combinations are unique but individual indexes used are not&#039;&#039;. However, a phenomenon known as &#039;index hopping&#039; has been observed when sequencing multiplexed libraries that followed single or combinatorial indexing schemes with newer Illumina platforms utilizing ExAmp chemistry such as the NovaSeq ([[Media:Index_Hopping.pdf |Costello et al., 2018]]). This swapping of indexes causes reads to be mis-assigned and subsequently excluded from further analysis. The primary strategy employed to mitigate the effects of index hopping is through the utilization of unique dual indexes.&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Unique dual indexes (UDI) are non-redundant indexes where each i5 and i7 has a distinct index sequence. As opposed to combinatorial dual indexing, an i7 and i5 index is never repeated nor shared among other samples (i.e. for a 96-well UDI index plate, there are 96 unique i7&#039;s and 96 unique i5&#039;s). Both the combinations and individual indexes used are unique, and as a result the frequency of mis-assigned reads due to index hopping is greatly reduced. The BioMicro Center recommends that UDI&#039;s always be used when sequencing on the NovaSeq. The number of libraries that can be multiplexed and sequenced on a single lane is determined by the total number of UDI&#039;s provided for each library preparation method.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:RNA_LIB&amp;diff=131424</id>
		<title>BioMicroCenter:RNA LIB</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:RNA_LIB&amp;diff=131424"/>
		<updated>2026-04-30T14:33:34Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
&lt;br /&gt;
[[Image:RNA-Seq_pres.jpg|thumb|300px|right|Wang Z, et al. Nat Rev Genet 2009]]&lt;br /&gt;
The BioMicro Center supports a broad variety of standard library preparation methods for RNAseq. The choice of method is highly dependent on the type of input, the amount of input RNA available, and the quality of the input RNA. The key in all RNAseq methods is the avoidance of ribosomal RNA, which would dominate the library preparation. Below is a summary of the methods we utilize routinely in the core. For High-Throughput RNA library preparation, please see our page for [[BioMicroCenter:RNA_HTL|methods designed specifically for large sample batches.]]&lt;br /&gt;
&lt;br /&gt;
{| border=1&lt;br /&gt;
 ! Amount of total RNA&lt;br /&gt;
 ! Quality of RNA&lt;br /&gt;
 ! Method Recommended&lt;br /&gt;
 |-&lt;br /&gt;
 | &amp;gt;10ng || RIN:&amp;gt;8.0 || [[BioMicroCenter:RNA_LIB#NEB_Ultra_II_Directional_RNA_with_Poly(A)_Selection|NEB Poly A]] &lt;br /&gt;
 |-&lt;br /&gt;
 | &amp;gt;50ng || DV200&amp;gt;0.2 || NEB ribosomal depletion followed by NEB UltraII prep.&lt;br /&gt;
 |- &lt;br /&gt;
 | 10pg-25ng || RIN:9.0 || [[BioMicroCenter:RNA_LIB#Clontech_SMARTseq_Low-Input|Clontech SMARTer v4]]&lt;br /&gt;
 |- &lt;br /&gt;
 | 1ng-1ug || DV200&amp;gt;0.2  || [[BioMicroCenter:RNA_LIB#Clontech_SMARTer_Stranded_Total_RNA-Seq_Kit_-_Pico_Input_Mammalian_--_aka_Clontech_ZapR|Clontech Pico Ribosomal Depletion (ZapR).]]&lt;br /&gt;
 |-&lt;br /&gt;
 | smallRNA || NA || NEB small RNA&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
==[https://www.neb.com/products/e7760-nebnext-ultra-ii-directional-rna-library-prep-kit-for-illumina#Product%20Information NEB Ultra II Directional RNA with Poly(A) Selection] ==&lt;br /&gt;
{|&lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;text-align: center; width: 450px;&amp;quot;|&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !Service &lt;br /&gt;
  !Standard RNA Library Prep&lt;br /&gt;
  |-&lt;br /&gt;
  |SAMPLE INPUT || Intact total RNA ([[BioMicroCenter:RIN|RIN]] 7+) &lt;br /&gt;
  |-&lt;br /&gt;
  |RANGE OF INPUT || 10-100 ng&lt;br /&gt;
  |-&lt;br /&gt;
  |INCLUDED || Initial QC by Fragment Analyzer &amp;lt;BR&amp;gt; Library preparation &amp;lt;BR&amp;gt; Illumina QC&lt;br /&gt;
  |-&lt;br /&gt;
  |SEQUENCING RECOMMENDATIONS || All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  |INDEX AVAILABILITY || 112 [[BioMicroCenter:HTLR_TEST_HTLR_TEST#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 192 [[BioMicroCenter:HTLR_TEST_HTLR_TEST#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  |SUBMISSION || MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  |UNIT || Per sample&lt;br /&gt;
 |}&lt;br /&gt;
 |&lt;br /&gt;
The BioMicro Center utilizes the NEBNext Ultra II Directional RNA preparation with poly(A) selection kit to prepare standard RNA libraries. The selection of mRNA transcripts occurs by hybridization of the poly(A)-tail to magnetic oligo-d(T) beads. We can reliably generate RNA-Seq libraries with inputs ranging from 10ng to 100ng (recommended input of &amp;gt; 50ng). High-quality samples are required because the method is reliant on poly(A)-tails during RNA isolation. We also offer a [[BioMicroCenter:RNA_HTL|high-throughput protocol]].&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== [https://www.neb.com/products/e6310-nebnext-rrna-depletion-kit-human-mouse-rat#Product%20Information NEB Ultra II Directional RNA with rRNA Depletion (H/M/R)] ==&lt;br /&gt;
{|&lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;text-align: center; width: 450px;&amp;quot;|&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !Service &lt;br /&gt;
  !Standard RNA Library Prep&lt;br /&gt;
  |-&lt;br /&gt;
  |SAMPLE INPUT || [[BioMicroCenter:RIN|Intact]] or [[BioMicroCenter:RIN|degraded]] total RNA&lt;br /&gt;
  |-&lt;br /&gt;
  |RANGE OF INPUT || 5-100 ng&lt;br /&gt;
  |-&lt;br /&gt;
  |INCLUDED || Initial QC by Fragment Analyzer &amp;lt;BR&amp;gt; Library preparation &amp;lt;BR&amp;gt; Illumina QC&lt;br /&gt;
  |-&lt;br /&gt;
  |SEQUENCING RECOMMENDATIONS || All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  |INDEX AVAILABILITY || 112 [[BioMicroCenter:HTLR_TEST_HTLR_TEST#Unique_versus_Combinatorial_Dual_Indexing|Unique Dual Indexes]] &amp;lt;br&amp;gt; 192 [[BioMicroCenter:HTLR_TEST_HTLR_TEST#Unique_versus_Combinatorial_Dual_Indexing|Combinatorial Dual Indexes]]&lt;br /&gt;
  |-&lt;br /&gt;
  |SUBMISSION || MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  |UNIT || Per sample&lt;br /&gt;
 |}&lt;br /&gt;
 |&lt;br /&gt;
NEBNext Ultra II Directional RNA preparation with ribosomal RNA (rRNA) depletion is used to deplete rRNA by enzymatic degradation using single-stranded DNA probes that target rRNAs, leaving all other RNA species present and available for library preparation. This depletion method is agnostic to input sample quality and is the go-to method if samples don&#039;t meet quality requirements for poly(A) selection. This method is suited for inputs ranging from 5ng to 100ng (recommended input of &amp;gt; 50ng). Due to probe design used in the depletion, this method is currently only available for Human/Mouse/Rat samples. We also offer a [[BioMicroCenter:RNA_HTL|high-throughput protocol]].&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;!-- commenting Kapa out&lt;br /&gt;
==[https://sequencing.roche.com/en-us/products-solutions/by-category/library-preparation/rna-library-preparation/kapa-mrna-hyperprep-kits.html Kapa mRNA Hyperprep] ==&lt;br /&gt;
{|&lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;width: 300px;&amp;quot;|&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !Service &lt;br /&gt;
  !Standard RNA Library Prep&lt;br /&gt;
  |-&lt;br /&gt;
  |INPUT || Clean eukaryotic total RNA &amp;lt;BR&amp;gt; RIN 9+ &amp;lt;BR&amp;gt; &amp;gt;10ng/uL &amp;lt;BR&amp;gt; &amp;gt;10uL&lt;br /&gt;
  |-&lt;br /&gt;
  |INCLUDED || Initial QC by Fragment Analyzer &amp;lt;BR&amp;gt; Library preparation &amp;lt;BR&amp;gt; Illumina QC&lt;br /&gt;
  |-&lt;br /&gt;
  |INDEX AVAILABILITY || 96 UDI&lt;br /&gt;
  |-&lt;br /&gt;
  |SEQUENCING RECOMMENDATIONS || All platforms&lt;br /&gt;
  |-&lt;br /&gt;
  |SUBMISSION || MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  |UNIT || Per sample&lt;br /&gt;
 |}&lt;br /&gt;
 |&lt;br /&gt;
This workflow is very similar to Illumina&#039;s TruSeq chemistry at lower cost and is streamlined for automation. This chemistry uses polyT beads to isolate the mRNA from the rRNA and tRNA. The use of these beads requires that the RNA be of very high quality or only the 3&#039; end of transcripts will be isolated. Purified mRNA is then fragmented with metal and random priming is used to convert the sample to cDNA. Once double-stranded cDNA is generated, LMPCR is performed to create the indexed Illumina library. The BioMicro Center offers mRNA HyperPrep as a single sample reaction or in [[BioMicroCenter:RNA_HTL|batches of 24 done on the TecanEvo 150s.]] &lt;br /&gt;
|&lt;br /&gt;
&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== [https://sequencing.roche.com/en-us/products-solutions/by-category/library-preparation/rna-library-preparation/kapa-rna-hyperprep-kit-with-riboerasehmr.html Kapa RiboErase] &amp;amp; [https://www.illumina.com/products/by-type/accessory-products/ribo-zero-plus-rrna-depletion.html RiboZero] ==&lt;br /&gt;
{|&lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;width: 300px;&amp;quot;|&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !Service &lt;br /&gt;
  !rRNA depletion based RNA Library Prep&lt;br /&gt;
  |-&lt;br /&gt;
  |INPUT || Clean total RNA &amp;lt;BR&amp;gt; DV200&amp;gt;0.2 &amp;lt;BR&amp;gt; &lt;br /&gt;
Human/Mouse/Rat&lt;br /&gt;
* &amp;gt;10ng/uL &lt;br /&gt;
* &amp;gt;10uL&lt;br /&gt;
All others&lt;br /&gt;
* &amp;gt; 200ng/uL&lt;br /&gt;
* &amp;gt; 10uL&lt;br /&gt;
  |-&lt;br /&gt;
  |INCLUDED || Initial QC by Fragment Analyzer &amp;lt;BR&amp;gt; Library preparation &amp;lt;BR&amp;gt; Illumina QC&lt;br /&gt;
  |-&lt;br /&gt;
  |SUBMISSION || MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  |UNIT || Per sample&lt;br /&gt;
 |}&lt;br /&gt;
 |&lt;br /&gt;
For samples with degraded RNA or samples where you are interested in looking at non-polyA RNAs, the BioMicro Center utilizes the Kapa RNA RiboErase and Illumina RiboZero for Human/Mouse/Rat samples. RiboErase uses RNAseH to degrade rRNAs while RiboZero uses magnetic beads coupled to rRNA sequences to remove these sequences from the solution. The remaining mRNA fragments can then be converted in to cDNA and prepared using the NEB Ultra II Directional RNA or Kapa mRNA Hyperprep kit to produce the Illumina library.&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
end of kapa --&amp;gt;&lt;br /&gt;
== [http://www.clontech.com/US/Products/cDNA_Synthesis_and_Library_Construction/cDNA_Synthesis_Kits/Ultra_Low_Input_RNA_cDNA_Synthesis Clontech SMARTseq Low-Input] ==&lt;br /&gt;
{|&lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;width: 300px;&amp;quot;|&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !Service &lt;br /&gt;
  !Low input RNA Library Prep&lt;br /&gt;
  |-&lt;br /&gt;
  |INPUT || Clean eukaryotic total RNA &amp;lt;BR&amp;gt; RIN 9+ &amp;lt;BR&amp;gt; 10pg &amp;lt;BR&amp;gt; &amp;gt;10uL (where possible)&lt;br /&gt;
  |-&lt;br /&gt;
  |INCLUDED || Initial QC by FemtoPulse &amp;lt;BR&amp;gt; Library preparation &amp;lt;BR&amp;gt; Illumina QC&lt;br /&gt;
  |-&lt;br /&gt;
  |SUBMISSION || MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  |UNIT || Per sample&lt;br /&gt;
 |}&lt;br /&gt;
 |&lt;br /&gt;
For samples with less then 50ng of input, the BioMicro Center utilizes the [http://www.clontech.com/US/Products/cDNA_Synthesis_and_Library_Construction/cDNA_Synthesis_Kits/Ultra_Low_Input_RNA_cDNA_Synthesis Clontech SMARTseq v4 system]. This system differs from the TruSeq chemistry in that it begins with cDNA generation using polyT priming followed by strand switching oligos. The use of polyT priming requires the RNA to be of high quality. Full length double-stranded cDNAs are generated and amplified by PCR. These cDNAs can be prepared into NGS short-read libraries using the NexteraXT chemistry from Illumina. Data from this system is of similar quality to samples created with Illumina TruSeq chemistry but is not stranded. Single samples can be prepared by hand. [[BioMicroCenter:RNA_HTL|Batches of 24, 96 or 384 samples]] can be prepared using the older SMARTseq v2 chemistry on the Mosquito HV resulting in significantly lower costs/sample.&lt;br /&gt;
&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== [http://www.clontech.com/US/Products/cDNA_Synthesis_and_Library_Construction/Next_Gen_Sequencing_Kits/Total_RNA-Seq/Pico_Input_Total_RNA_Seq_Illumina Clontech SMARTer Stranded Total RNA-Seq Kit - Pico Input Mammalian -- aka Clontech ZapR] == &lt;br /&gt;
{|&lt;br /&gt;
 |- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
 |style=&amp;quot;width: 300px;&amp;quot;|&lt;br /&gt;
 {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  !Service &lt;br /&gt;
  !Low Input RNA Depletion Library Prep&lt;br /&gt;
  |-&lt;br /&gt;
  |INPUT || Clean Human/Mouse total RNA &amp;lt;BR&amp;gt; DV200&amp;gt;0.5 &amp;lt;BR&amp;gt; &amp;gt;1ng &amp;lt;BR&amp;gt; &amp;gt;10uL where possible&lt;br /&gt;
  |-&lt;br /&gt;
  |INCLUDED || Initial QC by FemtoPulse &amp;lt;BR&amp;gt; Library preparation &amp;lt;BR&amp;gt; Illumina QC&lt;br /&gt;
  |-&lt;br /&gt;
  |SUBMISSION || MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs] &amp;lt;BR&amp;gt; External - [[BioMicroCenter:Forms|form]]&lt;br /&gt;
  |-&lt;br /&gt;
  |UNIT || Per sample&lt;br /&gt;
 |}&lt;br /&gt;
 |&lt;br /&gt;
For samples with less then 100ng of input and restricted input amounts, our kit of choice is the Clontech SMARTer Stranded Total RNAseq Kit - Pico Input -- or more simply, Clontech ZapR . This kit utilizes the same template switching as the v4 kit but uses random primers on fragmented RNA. The key is the ZapR enzyme which is used post library production to, in a targeted manner, cause breaks in Illumina library molecules that contain rRNA reads. These breaks make the rRNA containing molecules unreadable. This chemistry can be utilized in HTL format as well. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
In analyzing data from this kit, we have observed that the first few nucleotides from many reads appear to have a very high mismatch rate, particularly from low input samples or samples that possibly may not be as clean as desired. We believe this is a results of the template switching and random priming. A 5nt trim from the 5&#039;end of the read can significantly improve data quality.&lt;br /&gt;
|&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Additional Chemistries Available in the BioMicro Center ==&lt;br /&gt;
&lt;br /&gt;
=== [[BioMicroCenter:PippinPrep|Size Selection]] ===&lt;br /&gt;
For some applications of RNAseq, such as splice choice determination, having a precise knowledge of the insert size is critical. While a standard SPRI clean does provide some size selection (typically restricting fragments to between 150 and 350bp), this can be too wide for some methodologies. In these cases, after libraries are amplified, they can be run on the [[BioMicroCenter:PippinPrep|Sage BluePippin]] (either singly or pooled). Here the size distribution can be much tighter, with most of the DNA fragments being within a 50nt range.&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Illumina_Library_Preparation&amp;diff=131423</id>
		<title>BioMicroCenter:Illumina Library Preparation</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Illumina_Library_Preparation&amp;diff=131423"/>
		<updated>2026-04-30T14:31:57Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* Short Read Library Prep Services */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
&lt;br /&gt;
Generating high-quality data on any short read sequencing platform requires high-quality libraries. The BMC currently offers library preparation services for a variety of starting materials. Prior to sequencing, all libraries must pass the BioMicro Center&#039;s Sequencing Quality Control process, which verifies selection of inserts of a desired size and correct ligation of short read sequencing adapters.&lt;br /&gt;
&lt;br /&gt;
== Short Read Library Prep Services==&lt;br /&gt;
Please follow the links in the table below for more information about our library preparation offerings.&lt;br /&gt;
&lt;br /&gt;
{| style=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
 !width=300| DNA&lt;br /&gt;
 !width=300| RNA&lt;br /&gt;
 |-&lt;br /&gt;
 | &#039;&#039;&#039;[[BioMicroCenter:DNA_LIB|Standard DNA Methods include]]&#039;&#039;&#039;&lt;br /&gt;
* LMPCR methods&lt;br /&gt;
** NEB UltraII&lt;br /&gt;
* Tagmentation Methods&lt;br /&gt;
** Nextera XT&lt;br /&gt;
** Illumina DNA Prep (Nextera Flex)&lt;br /&gt;
&lt;br /&gt;
 | &#039;&#039;&#039;[[BioMicroCenter:RNA_LIB|Standard RNA Methods include]]&#039;&#039;&#039;&lt;br /&gt;
* NEB UltraII &amp;lt;br&amp;gt; polyA stranded method&lt;br /&gt;
* NEB ribosomal depletion &amp;lt;br&amp;gt; stranded rRNA depletion&lt;br /&gt;
* Clontech SMARTseq &amp;lt;br&amp;gt; Low input polyA based&lt;br /&gt;
* Clontech ZapR &amp;lt;br&amp;gt; Low input rRNA depletion based&lt;br /&gt;
* NEB small RNA prep&lt;br /&gt;
 |-&lt;br /&gt;
 | &#039;&#039;&#039;[[BioMicroCenter:DNA_HTL|High Throughput DNA Methods include]]&#039;&#039;&#039;&lt;br /&gt;
* Amplicon / 16S&lt;br /&gt;
* NexteraXT&lt;br /&gt;
* Illumina DNA Prep (Nextera Flex)&lt;br /&gt;
* NEB UltraII&lt;br /&gt;
 | &#039;&#039;&#039;[[BioMicroCenter:RNA_HTL|High Throughput RNA Methods include]]&#039;&#039;&#039;&lt;br /&gt;
* PolyA (NEB UltraII)&lt;br /&gt;
* NEB ribosomal depletion&lt;br /&gt;
* High Throughput 3&#039; Digital Gene Expression (HT3DGE)&lt;br /&gt;
* SMARTseq v2&lt;br /&gt;
* ZapR&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Long Read Library Prep Services ==&lt;br /&gt;
&lt;br /&gt;
The BioMicro Center also supports library preparation for long-read sequencing on two platforms. See the [[BioMicroCenter:LongRead|Long Read Sequencing page]] for full details on sequencing services and platform comparison.&lt;br /&gt;
&lt;br /&gt;
{| style=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
 !width=300| Oxford Nanopore Technologies&lt;br /&gt;
 !width=300| PacBio&lt;br /&gt;
 |-&lt;br /&gt;
 | &#039;&#039;&#039;[[BioMicroCenter:LongRead#PromethION_Library_Preparation|Nanopore Library Methods include]]&#039;&#039;&#039;&lt;br /&gt;
* LSK114 — Ligation-based dsDNA&lt;br /&gt;
* RBK114 — Tagmentation-based / ultra-long&lt;br /&gt;
* RNA004 — Direct RNA sequencing&lt;br /&gt;
* Native barcoding available (up to 96 samples)&lt;br /&gt;
&lt;br /&gt;
 | &#039;&#039;&#039;[[BioMicroCenter:LongRead#Revio_.E2.80.94_Library_Preparation|PacBio Library Methods include]]&#039;&#039;&#039;&lt;br /&gt;
* SMRTbell Prep Kit v3.0&lt;br /&gt;
* Genomic DNA (HiFi, 10–20 kb reads)&lt;br /&gt;
* Size selection via PippinPrep available&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== OTHER SERVICES ==&lt;br /&gt;
=== SIZE SELECTION ===&lt;br /&gt;
The BMC offers standard SPRI cleans for NGS libraries and [[BioMicroCenter:PippinPrep|PippinPrep Size Selection]] post library construction if custom insert sizes are needed.&lt;br /&gt;
&lt;br /&gt;
=== QUALITY CONTROL ===&lt;br /&gt;
All NGS libraries are quality controlled prior to use. The BioMicro Center offers two &#039;flavors&#039; of quality control for NGS libraries.&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
Standard quality control includes analysis on the [[BioMicroCenter:QC#AATI_FRAGMENT_ANALYZER|Fragment Analyzer]] and quantification by four point [[BioMicroCenter:RTPCR|qPCR]] quantification for each sample. This confirms both the sizing as well as the presence of Illumina adapters on the libraries.&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
Rapid Quality Control is less expensive and quicker. It includes analysis on the [[BioMicroCenter:QC#AATI_FRAGMENT_ANALYZER|Fragment Analyzer]] and quantification by PicoGreen on the [[BioMicroCenter:Varioskan|Varioskan]] for each sample. Final pools are quantified by [[BioMicroCenter:RTPCR|qPCR]] before loading. While this method is significantly faster and less expensive, we cannot guarantee pool balance with it.&lt;br /&gt;
&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;[[BioMicroCenter:PREP_TEST]]&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Tecan_Freedom_Evo&amp;diff=131422</id>
		<title>BioMicroCenter:Tecan Freedom Evo</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Tecan_Freedom_Evo&amp;diff=131422"/>
		<updated>2026-04-30T14:27:20Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* Revvity Chemagic 360 */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039; ** All users must be trained before being allowed to use the equipment **&#039;&#039;&#039;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
The BioMicro Center currently hosts three automated liquid handlers: two [https://lifesciences.tecan.com/products/liquid_handling_and_automation/freedom_evo_series Tecan Freedom EVO 150s] and one [https://www.ttplabtech.com/products/liquid-handling/mosquito-hv/ SPT Labtech Mosquito HV]. One EVO is optimized for cherry picking applications while the other is optimized for sample processing and assay set-up. The Tecans and Mosquito in the BioMicro Center are available to MIT researchers for use in their research. The Tecans may be used for BL1 work but are not set up for doing work on tissue culture or other samples requiring sterile environments. For users requiring higher throughput or BL2/BL2+  a new High-Throughput core has been developed by the [http://ki.mit.edu/sbc Koch Institute.] &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The Tecans are offered as a walk up service or as an assisted service. Due to the steep learning curves on the robots, we strongly encourage users to allow BMC staff to assist them in automating protocols and programming the instruments and then simply execute the programs as a walk up. Machine downtime is extremely limited and there is minimal time for practice runs.&lt;br /&gt;
&lt;br /&gt;
== JOHNNY 5 ==&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:350px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Instrument&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | Tecan EVO 150&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | USAGE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Walkup - MIT only &amp;lt;br&amp;gt; Approval Required&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Per hour + Consumables&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ARMS&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* LiHa span8 (2&amp;amp;micro;L-200&amp;amp;micro;L)&lt;br /&gt;
* MCA96 (50&amp;amp;micro;L/200&amp;amp;micro;L tips)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | CARRIERS&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* 1 fixed tip washer &lt;br /&gt;
* 6 15ml tube carriers &lt;br /&gt;
* 3 temperature controlled SBS carriers &lt;br /&gt;
* 24 non-temperature controlled SBS carriers &lt;br /&gt;
&amp;lt;!-- * 4 racks for 1.5ml tubes (24 each) --&amp;gt;&lt;br /&gt;
&lt;br /&gt;
* UV light for decontamination &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SCHEDULE USAGE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [https://mit.ilabsolutions.com/equipment/show/262347/?tab=schedule ilabs]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | NEW USERS&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | New users should request training by emailing the [mailto:biomicro@mit.edu  BioMicro Center team].&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | DONATED BY&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Department of Biology&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:&amp;quot;Johnny5&amp;quot; or &amp;quot;J5&amp;quot; is the BioMicro Center robot optimized for cherry picking. It is a highly-versatile device equipped with a four-channel liquid handling arm (LiHa) and a 96-channel pipette arm (MCA96).  The instrument supports a wide variety of fluid transfer operations for all sizes of microplates as well as 150mm dishes and can perform operations including reagent addition, continuous reagent dispensing, sample transfer, plate replication, plate-to-plate transfer, serial dilutions, and within-well mixing.  &amp;lt;!-- The EVO can accurately handle volumes between 2 and 200 µl and has the ability to perform virtually any routine liquid transfer, replacing manual pipetting.--&amp;gt; &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:J5 is used by the BioMicro Center primarily for plate normalization as part of high-throughput library production. Users should plan experiments in advance to coordinate usage with BMC staff.&amp;lt;BR&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:::::::[[IMAGE:BMC_Johnny5.jpg | inline | 300px]] &lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== B9 ==&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:350px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Instrument&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 325px;&amp;quot; | Tecan EVO 150&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | USAGE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Walkup - MIT only &amp;lt;br&amp;gt; Approval Required&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Per hour + Consumables&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ARMS&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* MCA96 (50&amp;amp;micro;L/200&amp;amp;micro;L tips)&lt;br /&gt;
* RoMa (Robotic Manipulator)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | CARRIERS&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* 1 rack for 2 stacks of nested tips with chute&lt;br /&gt;
* 3 temperature controlled SBS format positions on one carrier.&lt;br /&gt;
* 16 SBS format positions on 4 carriers&lt;br /&gt;
&amp;lt;!-- * [http://www.tecan.com/platform/apps/product/index.asp?MenuID=3416&amp;amp;ID=7010&amp;amp;Menu=1&amp;amp;Item=21.1.9.26 TeVac vacuum manifold] &lt;br /&gt;
* [http://www.tecan.com/platform/apps/product/index.asp?MenuID=1399&amp;amp;ID=973&amp;amp;Menu=1&amp;amp;Item=21.1.9.11 Vortexer (Te-Shake)] --&amp;gt;&lt;br /&gt;
* 4 on deck racks for short plates&lt;br /&gt;
&amp;lt;!-- * Shaking Incubator&lt;br /&gt;
* [http://www.tecan.com/platform/apps/product/index.asp?MenuID=1214&amp;amp;ID=611&amp;amp;Menu=1&amp;amp;Item=21.1.9.13 4 Stackers (TeStack)] --&amp;gt;&lt;br /&gt;
* Alpaqua 96-well Magnets&lt;br /&gt;
* 384-well Magnets&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SCHEDULE USAGE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [https://mit.ilabsolutions.com/equipment/show/262347/?tab=schedule ilabs]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | NEW USERS&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | New users should request training by emailing the [mailto:biomicro@mit.edu  BioMicro Center team].&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | DONATED BY&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Dr. Wendy Gilbert (now at Yale)&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:&amp;quot;B9&amp;quot; is the BioMicro Center EVO150 optimized for nucleic acid cleans and quantification assays. B9 has a 96-channel pipette arm (MCA96) and a robotic manipulator (RoMa) arm for moving plates around the deck. This instrument supports a broad range of fluid transfer operations including reagent addition, sample transfer, plate-to-plate transfer, serial dilutions, and within-well mixing. This robot contains a waste chute and 4 plate stackers which combined with the RoMa arm can be used to add or remove plates makes B9 a highly dynamic automation platform. B9 was donated to the BioMicro Center by Dr. Wendy Gilbert through a shared instrumentation grant from the NIH. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:B9 is regularly used by the BioMicro Center for nucleic acid cleans, SYBR and qPCR assay setup, and Illumina Library preparation. &amp;lt;br&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:::::::[[IMAGE:BMC_B9.jpg | inline | 300px]] &lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SPT LABTECH MOSQUITO HV ==&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:350px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Instrument&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 325px;&amp;quot; | Mosquito HV&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | USAGE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Not available as a walkup service&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Included in high-throughput library preparation&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ARMS&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 8-tip disposable (0.2&amp;amp;micro;L - 5&amp;amp;micro;L)&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | CARRIERS&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* 5 SBS positions&lt;br /&gt;
* Humidifying chamber&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SCHEDULE USAGE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Contact [[BioMicroCenter:People|Avanyish Toniappa]] for special requests&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | DONATED BY&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SPT Labtech (on loan)&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:The SPT Labtech Mosquito HV is a critical instrument in the BioMicro Center&#039;s goal of automated high-throughput library production. The accurate low volume pipetting offered by this liquid handler has allowed for miniaturization of a number of protocols. While the instrument does not provide a &#039;walk away&#039; level of automation, programming the Mosquito is significantly easier than the Tecans and prototyping methods is much more rapid. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
:The Mosquito is used in all HTL protocols in the BioMicro Center. &lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[[Image:BMC_MOSQUITO.jpg | 300px]]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Revvity Chemagic 360 ==&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:350px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Instrument&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 325px;&amp;quot; | Chemagic360&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | USAGE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Available as a walkup service&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Consumables&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | chemagic dispenser&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 12-tip 3-row array&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Rod Head&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | 96 well EM head&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SCHEDULE USAGE BY PURIFICATION TYPE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Contact [[BioMicroCenter:People|Avanyish Toniappa]] a month ahead&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | DONATED BY&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | &lt;br /&gt;
* MIT Stem Cell Initiative&lt;br /&gt;
* Dr Jacqueline A. Lees&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:The Revvity (formerly Perkin-Elmer) Chemagic360 is a critical instrument in the BioMicro Center&#039;s goal of automated high-throughput library production. 96 tissue or cell lysates take up to 2 hours for a thorough bead based clean. This instrument provides &#039;walk away&#039; automation, but does require setup steps such as creating lysates before loading, and unloading the instrument properly. There are no optional programming options. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
:If a kit for a specific purification needs to be ordered, it will take a month to arrive.&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
[[Image:Chemagic360.jpg | 300px]]&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Walkup_Services&amp;diff=131421</id>
		<title>BioMicroCenter:Walkup Services</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Walkup_Services&amp;diff=131421"/>
		<updated>2026-04-30T14:25:18Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* Sonication */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
&lt;br /&gt;
== What are walk-up services? ==&lt;br /&gt;
&lt;br /&gt;
Walk-up services are those where the BioMicro Center provides training, maintenance, and scheduling of equipment, and may also provide consumables. Users operate the instruments themselves after completing a required training session with BMC staff. Walk-up services are almost exclusively limited to MIT users; non-MIT users should contact [mailto:biomicro@mit.edu biomicro@mit.edu] to discuss access.&lt;br /&gt;
&lt;br /&gt;
Walk-up services contrast with [[BioMicroCenter:FAQ#ASSISTED_versus_WALKUP_SERVICES|assisted services]], where samples are delivered to BMC staff for processing. See [[BioMicroCenter:FAQ]] for a full definition of both service types.&lt;br /&gt;
&lt;br /&gt;
== Scheduling and iLabs ==&lt;br /&gt;
&lt;br /&gt;
All walk-up equipment is scheduled through [https://mit-ki.ilabsolutions.com/sc/3381/ki-genomics-core-mit-biomicro-center?tab=equipment iLabs]. The equipment calendar lists instruments organized by category (BMC:qPCR, BMC:Varioskan, BMC:BioAnalyzer, BMC:Covaris, etc.).&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;Note: Items listed as $0 in iLabs are charged per use — you will be asked to enter the number of units when submitting your reservation. The number of units is cross-validated in the lab.&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
* Reservations on machines with heavy to regular usage must be made &#039;&#039;&#039;at least 4 hours in advance&#039;&#039;&#039;. For last-minute requests, email [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
* To arrange training, email [mailto:biomicro@mit.edu biomicro@mit.edu]. Depending on the instrument, staff will instruct you to book a time on the iLabs calendar or coordinate directly.&lt;br /&gt;
&lt;br /&gt;
== Training and access ==&lt;br /&gt;
&lt;br /&gt;
Training by BMC staff is required before using any walk-up instrument. Training sessions are typically one hour and cover instrument operation and best practices. To request training for any instrument, email [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
&lt;br /&gt;
Walk-up users may use equipment outside of regular business hours. After-hours access to the core requires a one-time sign-up — see the [[BioMicroCenter:Submission#Walk-up_services|Submission page]] for the after-hours access form.&lt;br /&gt;
&lt;br /&gt;
== Equipment available for walk-up ==&lt;br /&gt;
&lt;br /&gt;
Click any instrument name for full details, specifications, and scheduling links.&lt;br /&gt;
&lt;br /&gt;
=== Sample quantification and quality control ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:RTPCR|LightCycler 480 II (LC480)]]&#039;&#039;&#039;&lt;br /&gt;
| Real-time PCR for quantitative and qualitative detection of nucleic acids. Handles 96w and 384w plates; supports SYBR and TaqMan probes. Three units available (Thing 1 96w; Thing 2 &amp;amp; 3 384w). Maximum 4 hours/day during business hours (10 AM–5 PM); all slots available after hours. Donated by Prof. Laurie Boyer, Prof. Leonard Guarente, and the Dept. of Biology.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/261680/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Varioskan|Varioskan Flash]]&#039;&#039;&#039;&lt;br /&gt;
| Multimode plate reader for fluorometric, luminometric, and absorbance measurements in 96/384w format. Equipped with three onboard dispensers, incubator, and orbital shaker. Charged in 10-minute blocks. Donated by Prof. Jeroen Saeij.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262715/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Varioskan#Synergy_H1|Synergy H1 plate reader]]&#039;&#039;&#039;&lt;br /&gt;
| Hybrid multi-mode microplate reader (6w–384w). Supports UV-vis measurements via Take3 Trio plate module (48 × 2 µL samples; Nanodrop-equivalent). Can be signed out for use &#039;&#039;outside&#039;&#039; the BMC — sign out one week in advance. Charged in 10-minute blocks. Donated by Prof. Gene-Wei Li.&lt;br /&gt;
| [https://mit.ilabsolutions.com/service_center/3381?tab=equipment iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:2100BioAnalyzer|Agilent 2100 BioAnalyzer]]&#039;&#039;&#039;&lt;br /&gt;
| Nanofluidic sizing and quantification of DNA (25 bp–12 kb), RNA, and protein. Users must provide all reagents — BMC does not stock BioAnalyzer chips or reagents.&lt;br /&gt;
| [https://mit-ki.ilabsolutions.com/equipment/show/265040/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:NanoDrop_ND-1000|NanoDrop ND-1000]]&#039;&#039;&#039;&lt;br /&gt;
| Full-spectrum spectrophotometer (220–750 nm) for 1 µL samples. Measures nucleic acid and protein concentration and purity. Free for core department users. Located in 68-316.&lt;br /&gt;
| No scheduling required&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== DNA/RNA sizing ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:PippinPrep|BluePippin / Pippin Prep]]&#039;&#039;&#039;&lt;br /&gt;
| Automated preparative gel electrophoresis for DNA size selection. BluePippin: 50 bp–50 kb; Pippin Prep: 100 bp–1.5 kb. Charged per run. Donated by the Department of Biology.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262716/?tab=schedule iLabs]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Sonication ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Covaris|Covaris E220 Evolution]]&#039;&#039;&#039;&lt;br /&gt;
| Focused ultrasonicator for single-tube processing (1–96 samples per batch). Processes 25 µL–10 mL sample volumes. Shears DNA, RNA, chromatin; homogenizes tissue.&lt;br /&gt;
| [https://mit.ilabsolutions.com/schedules/261752# iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Covaris|Covaris R230]]&#039;&#039;&#039;&lt;br /&gt;
| High-throughput sonicator for 96 AFA-TUBE® TPX plates. Column sonication mode processes an entire 96-well plate 10× faster than E220. Funded by NIH grant R24OD035444 — must be included in publications if used.&lt;br /&gt;
| [https://mit.ilabsolutions.com/schedules/261752# iLabs]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Automation ===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;Note:&#039;&#039;&#039; All automation scripts must be written by BMC staff. Once a script has been programmed, users may run it independently as a walk-up service. Contact [mailto:biomicro@mit.edu biomicro@mit.edu] to initiate script development.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Tecan_Freedom_Evo#JOHNNY_5|Tecan EVO 150 — Johnny 5]]&#039;&#039;&#039;&lt;br /&gt;
| Liquid handler optimized for cherry picking and plate normalization. LiHa span8 (2–200 µL) + MCA96 (50/200 µL tips). 6× 15 mL tube carriers, 3 temperature-controlled + 24 non-temperature-controlled SBS carriers, UV decontamination. BL1 work only. Donated by the Department of Biology.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262347/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Tecan_Freedom_Evo#B9|Tecan EVO 150 — B9]]&#039;&#039;&#039;&lt;br /&gt;
| Liquid handler optimized for sample processing and assay setup. MCA96 + RoMa plate handler. 3 temperature-controlled + 24 non-temperature-controlled SBS carriers. BL1 work only.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262347/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Tecan_Freedom_Evo#Revvity_Chemagic_360|Revvity Chemagic 360]]&#039;&#039;&#039;&lt;br /&gt;
| Magnetic bead-based automated nucleic acid purification. 96-well EM rod head; 12-tip 3-row dispenser array. Processes 96 tissue or cell lysates in up to 5 hours. Charged by consumables. Requires setup steps (lysate preparation before loading). Contact [mailto:biomicro@mit.edu biomicro@mit.edu] at least one month in advance — purification-specific kits take approximately one month to arrive. Donated by the MIT Stem Cell Initiative and Dr. Jacqueline A. Lees.&lt;br /&gt;
| Contact BMC one month ahead of use&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Sequencing ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Illumina_Sequencing|Illumina MiSeq i100]]&#039;&#039;&#039;&lt;br /&gt;
| Walk-up short-read sequencing. A run charge must be added to each reservation (listed as $0 in iLabs but required). Reserve for the actual run duration: 100 nt = 5 h, 300 nt = 8 h, 600 nt = 16 h. Sequencing kits stocked by BMC; available during business hours as add-on charges or via the consumable request form. All data stored on BMC servers (BMC-PUB or BMC-LAB) — Illumina BaseSpace is not directly available from the instrument.&lt;br /&gt;
| [https://mit.ilabsolutions.com/schedules/555535# iLabs]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Single cell / spatial (walk-up option) ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:SingleCell|10x Chromium X]]&#039;&#039;&#039;&lt;br /&gt;
| Available as walk-up after training by BMC staff. Chips must be purchased through BMC. Reagents are also available through BMC. Contact [mailto:biomicro@mit.edu biomicro@mit.edu] to arrange training and initial access.&lt;br /&gt;
| [https://mit.ilabsolutions.com/schedules/380963# iLabs]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Policies ==&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;Training is mandatory.&#039;&#039;&#039; No use of any instrument is permitted without prior training by BMC staff. Untrained use will result in suspension of walk-up privileges for the entire laboratory.&lt;br /&gt;
&lt;br /&gt;
* BMC business has priority on all walk-up equipment at all times.&lt;br /&gt;
* Reservations must be made at least 4 hours in advance. Late requests should be emailed to [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
* Walk-up access is MIT only in almost all cases. Non-MIT users should contact [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
* For the MiSeq i100: violation of the access policy results in termination of walk-up privileges for the &#039;&#039;&#039;entire laboratory&#039;&#039;&#039;, not only the individual user.&lt;br /&gt;
* All automation scripts must be written by BMC staff before users may run them independently.&lt;br /&gt;
&lt;br /&gt;
== Getting help ==&lt;br /&gt;
&lt;br /&gt;
For general questions, training requests, or after-hours access:&lt;br /&gt;
&lt;br /&gt;
* &#039;&#039;&#039;Email:&#039;&#039;&#039; [mailto:biomicro@mit.edu biomicro@mit.edu]&lt;br /&gt;
* &#039;&#039;&#039;Phone:&#039;&#039;&#039; 617-715-4533&lt;br /&gt;
* &#039;&#039;&#039;After-hours access:&#039;&#039;&#039; [https://www.dropbox.com/scl/fi/nxdzbesvp2mab69wofotm/New_User_Sign_Up_Form.docx?rlkey=x9ftkatdlm897fbeol2ibv8tb&amp;amp;st=ag0jsvn9&amp;amp;dl=0 After-Hours Access Form] (one-time sign-up)&lt;br /&gt;
* &#039;&#039;&#039;Walk in:&#039;&#039;&#039; [http://whereis.mit.edu/?go=68 68-322, MIT campus]&lt;br /&gt;
&lt;br /&gt;
See also: [[BioMicroCenter:FAQ]] for definitions of walk-up vs. assisted services, core lab status, and billing.&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Walkup_Services&amp;diff=131420</id>
		<title>BioMicroCenter:Walkup Services</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Walkup_Services&amp;diff=131420"/>
		<updated>2026-04-30T14:22:53Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* Automation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
&lt;br /&gt;
== What are walk-up services? ==&lt;br /&gt;
&lt;br /&gt;
Walk-up services are those where the BioMicro Center provides training, maintenance, and scheduling of equipment, and may also provide consumables. Users operate the instruments themselves after completing a required training session with BMC staff. Walk-up services are almost exclusively limited to MIT users; non-MIT users should contact [mailto:biomicro@mit.edu biomicro@mit.edu] to discuss access.&lt;br /&gt;
&lt;br /&gt;
Walk-up services contrast with [[BioMicroCenter:FAQ#ASSISTED_versus_WALKUP_SERVICES|assisted services]], where samples are delivered to BMC staff for processing. See [[BioMicroCenter:FAQ]] for a full definition of both service types.&lt;br /&gt;
&lt;br /&gt;
== Scheduling and iLabs ==&lt;br /&gt;
&lt;br /&gt;
All walk-up equipment is scheduled through [https://mit-ki.ilabsolutions.com/sc/3381/ki-genomics-core-mit-biomicro-center?tab=equipment iLabs]. The equipment calendar lists instruments organized by category (BMC:qPCR, BMC:Varioskan, BMC:BioAnalyzer, BMC:Covaris, etc.).&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;Note: Items listed as $0 in iLabs are charged per use — you will be asked to enter the number of units when submitting your reservation. The number of units is cross-validated in the lab.&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
* Reservations on machines with heavy to regular usage must be made &#039;&#039;&#039;at least 4 hours in advance&#039;&#039;&#039;. For last-minute requests, email [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
* To arrange training, email [mailto:biomicro@mit.edu biomicro@mit.edu]. Depending on the instrument, staff will instruct you to book a time on the iLabs calendar or coordinate directly.&lt;br /&gt;
&lt;br /&gt;
== Training and access ==&lt;br /&gt;
&lt;br /&gt;
Training by BMC staff is required before using any walk-up instrument. Training sessions are typically one hour and cover instrument operation and best practices. To request training for any instrument, email [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
&lt;br /&gt;
Walk-up users may use equipment outside of regular business hours. After-hours access to the core requires a one-time sign-up — see the [[BioMicroCenter:Submission#Walk-up_services|Submission page]] for the after-hours access form.&lt;br /&gt;
&lt;br /&gt;
== Equipment available for walk-up ==&lt;br /&gt;
&lt;br /&gt;
Click any instrument name for full details, specifications, and scheduling links.&lt;br /&gt;
&lt;br /&gt;
=== Sample quantification and quality control ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:RTPCR|LightCycler 480 II (LC480)]]&#039;&#039;&#039;&lt;br /&gt;
| Real-time PCR for quantitative and qualitative detection of nucleic acids. Handles 96w and 384w plates; supports SYBR and TaqMan probes. Three units available (Thing 1 96w; Thing 2 &amp;amp; 3 384w). Maximum 4 hours/day during business hours (10 AM–5 PM); all slots available after hours. Donated by Prof. Laurie Boyer, Prof. Leonard Guarente, and the Dept. of Biology.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/261680/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Varioskan|Varioskan Flash]]&#039;&#039;&#039;&lt;br /&gt;
| Multimode plate reader for fluorometric, luminometric, and absorbance measurements in 96/384w format. Equipped with three onboard dispensers, incubator, and orbital shaker. Charged in 10-minute blocks. Donated by Prof. Jeroen Saeij.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262715/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Varioskan#Synergy_H1|Synergy H1 plate reader]]&#039;&#039;&#039;&lt;br /&gt;
| Hybrid multi-mode microplate reader (6w–384w). Supports UV-vis measurements via Take3 Trio plate module (48 × 2 µL samples; Nanodrop-equivalent). Can be signed out for use &#039;&#039;outside&#039;&#039; the BMC — sign out one week in advance. Charged in 10-minute blocks. Donated by Prof. Gene-Wei Li.&lt;br /&gt;
| [https://mit.ilabsolutions.com/service_center/3381?tab=equipment iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:2100BioAnalyzer|Agilent 2100 BioAnalyzer]]&#039;&#039;&#039;&lt;br /&gt;
| Nanofluidic sizing and quantification of DNA (25 bp–12 kb), RNA, and protein. Users must provide all reagents — BMC does not stock BioAnalyzer chips or reagents.&lt;br /&gt;
| [https://mit-ki.ilabsolutions.com/equipment/show/265040/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:NanoDrop_ND-1000|NanoDrop ND-1000]]&#039;&#039;&#039;&lt;br /&gt;
| Full-spectrum spectrophotometer (220–750 nm) for 1 µL samples. Measures nucleic acid and protein concentration and purity. Free for core department users. Located in 68-316.&lt;br /&gt;
| No scheduling required&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== DNA/RNA sizing ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:PippinPrep|BluePippin / Pippin Prep]]&#039;&#039;&#039;&lt;br /&gt;
| Automated preparative gel electrophoresis for DNA size selection. BluePippin: 50 bp–50 kb; Pippin Prep: 100 bp–1.5 kb. Charged per run. Donated by the Department of Biology.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262716/?tab=schedule iLabs]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Sonication ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Covaris|Covaris E220 Evolution]]&#039;&#039;&#039;&lt;br /&gt;
| Focused ultrasonicator for single-tube processing (1–96 samples per batch). Processes 25 µL–10 mL sample volumes. Shears DNA, RNA, chromatin; homogenizes tissue.&lt;br /&gt;
| (see instrument page)&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Covaris|Covaris R230]]&#039;&#039;&#039;&lt;br /&gt;
| High-throughput sonicator for 96 AFA-TUBE® TPX plates. Column sonication mode processes an entire 96-well plate 10× faster than E220. Funded by NIH grant R24OD035444 — include in publications.&lt;br /&gt;
| (see instrument page)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Automation ===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;Note:&#039;&#039;&#039; All automation scripts must be written by BMC staff. Once a script has been programmed, users may run it independently as a walk-up service. Contact [mailto:biomicro@mit.edu biomicro@mit.edu] to initiate script development.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Tecan_Freedom_Evo#JOHNNY_5|Tecan EVO 150 — Johnny 5]]&#039;&#039;&#039;&lt;br /&gt;
| Liquid handler optimized for cherry picking and plate normalization. LiHa span8 (2–200 µL) + MCA96 (50/200 µL tips). 6× 15 mL tube carriers, 3 temperature-controlled + 24 non-temperature-controlled SBS carriers, UV decontamination. BL1 work only. Donated by the Department of Biology.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262347/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Tecan_Freedom_Evo#B9|Tecan EVO 150 — B9]]&#039;&#039;&#039;&lt;br /&gt;
| Liquid handler optimized for sample processing and assay setup. MCA96 + RoMa plate handler. 3 temperature-controlled + 24 non-temperature-controlled SBS carriers. BL1 work only.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262347/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Tecan_Freedom_Evo#Revvity_Chemagic_360|Revvity Chemagic 360]]&#039;&#039;&#039;&lt;br /&gt;
| Magnetic bead-based automated nucleic acid purification. 96-well EM rod head; 12-tip 3-row dispenser array. Processes 96 tissue or cell lysates in up to 5 hours. Charged by consumables. Requires setup steps (lysate preparation before loading). Contact [mailto:biomicro@mit.edu biomicro@mit.edu] at least one month in advance — purification-specific kits take approximately one month to arrive. Donated by the MIT Stem Cell Initiative and Dr. Jacqueline A. Lees.&lt;br /&gt;
| Contact BMC one month ahead of use&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Sequencing ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Illumina_Sequencing|Illumina MiSeq i100]]&#039;&#039;&#039;&lt;br /&gt;
| Walk-up short-read sequencing. A run charge must be added to each reservation (listed as $0 in iLabs but required). Reserve for the actual run duration: 100 nt = 5 h, 300 nt = 8 h, 600 nt = 16 h. Sequencing kits stocked by BMC; available during business hours as add-on charges or via the consumable request form. All data stored on BMC servers (BMC-PUB or BMC-LAB) — Illumina BaseSpace is not directly available from the instrument.&lt;br /&gt;
| [https://mit.ilabsolutions.com/schedules/555535# iLabs]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Single cell / spatial (walk-up option) ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:SingleCell|10x Chromium X]]&#039;&#039;&#039;&lt;br /&gt;
| Available as walk-up after training by BMC staff. Chips must be purchased through BMC. Reagents are also available through BMC. Contact [mailto:biomicro@mit.edu biomicro@mit.edu] to arrange training and initial access.&lt;br /&gt;
| [https://mit.ilabsolutions.com/schedules/380963# iLabs]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Policies ==&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;Training is mandatory.&#039;&#039;&#039; No use of any instrument is permitted without prior training by BMC staff. Untrained use will result in suspension of walk-up privileges for the entire laboratory.&lt;br /&gt;
&lt;br /&gt;
* BMC business has priority on all walk-up equipment at all times.&lt;br /&gt;
* Reservations must be made at least 4 hours in advance. Late requests should be emailed to [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
* Walk-up access is MIT only in almost all cases. Non-MIT users should contact [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
* For the MiSeq i100: violation of the access policy results in termination of walk-up privileges for the &#039;&#039;&#039;entire laboratory&#039;&#039;&#039;, not only the individual user.&lt;br /&gt;
* All automation scripts must be written by BMC staff before users may run them independently.&lt;br /&gt;
&lt;br /&gt;
== Getting help ==&lt;br /&gt;
&lt;br /&gt;
For general questions, training requests, or after-hours access:&lt;br /&gt;
&lt;br /&gt;
* &#039;&#039;&#039;Email:&#039;&#039;&#039; [mailto:biomicro@mit.edu biomicro@mit.edu]&lt;br /&gt;
* &#039;&#039;&#039;Phone:&#039;&#039;&#039; 617-715-4533&lt;br /&gt;
* &#039;&#039;&#039;After-hours access:&#039;&#039;&#039; [https://www.dropbox.com/scl/fi/nxdzbesvp2mab69wofotm/New_User_Sign_Up_Form.docx?rlkey=x9ftkatdlm897fbeol2ibv8tb&amp;amp;st=ag0jsvn9&amp;amp;dl=0 After-Hours Access Form] (one-time sign-up)&lt;br /&gt;
* &#039;&#039;&#039;Walk in:&#039;&#039;&#039; [http://whereis.mit.edu/?go=68 68-322, MIT campus]&lt;br /&gt;
&lt;br /&gt;
See also: [[BioMicroCenter:FAQ]] for definitions of walk-up vs. assisted services, core lab status, and billing.&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Walkup_Services&amp;diff=131419</id>
		<title>BioMicroCenter:Walkup Services</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Walkup_Services&amp;diff=131419"/>
		<updated>2026-04-30T14:22:34Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* Automation */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
&lt;br /&gt;
== What are walk-up services? ==&lt;br /&gt;
&lt;br /&gt;
Walk-up services are those where the BioMicro Center provides training, maintenance, and scheduling of equipment, and may also provide consumables. Users operate the instruments themselves after completing a required training session with BMC staff. Walk-up services are almost exclusively limited to MIT users; non-MIT users should contact [mailto:biomicro@mit.edu biomicro@mit.edu] to discuss access.&lt;br /&gt;
&lt;br /&gt;
Walk-up services contrast with [[BioMicroCenter:FAQ#ASSISTED_versus_WALKUP_SERVICES|assisted services]], where samples are delivered to BMC staff for processing. See [[BioMicroCenter:FAQ]] for a full definition of both service types.&lt;br /&gt;
&lt;br /&gt;
== Scheduling and iLabs ==&lt;br /&gt;
&lt;br /&gt;
All walk-up equipment is scheduled through [https://mit-ki.ilabsolutions.com/sc/3381/ki-genomics-core-mit-biomicro-center?tab=equipment iLabs]. The equipment calendar lists instruments organized by category (BMC:qPCR, BMC:Varioskan, BMC:BioAnalyzer, BMC:Covaris, etc.).&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;Note: Items listed as $0 in iLabs are charged per use — you will be asked to enter the number of units when submitting your reservation. The number of units is cross-validated in the lab.&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
* Reservations on machines with heavy to regular usage must be made &#039;&#039;&#039;at least 4 hours in advance&#039;&#039;&#039;. For last-minute requests, email [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
* To arrange training, email [mailto:biomicro@mit.edu biomicro@mit.edu]. Depending on the instrument, staff will instruct you to book a time on the iLabs calendar or coordinate directly.&lt;br /&gt;
&lt;br /&gt;
== Training and access ==&lt;br /&gt;
&lt;br /&gt;
Training by BMC staff is required before using any walk-up instrument. Training sessions are typically one hour and cover instrument operation and best practices. To request training for any instrument, email [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
&lt;br /&gt;
Walk-up users may use equipment outside of regular business hours. After-hours access to the core requires a one-time sign-up — see the [[BioMicroCenter:Submission#Walk-up_services|Submission page]] for the after-hours access form.&lt;br /&gt;
&lt;br /&gt;
== Equipment available for walk-up ==&lt;br /&gt;
&lt;br /&gt;
Click any instrument name for full details, specifications, and scheduling links.&lt;br /&gt;
&lt;br /&gt;
=== Sample quantification and quality control ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:RTPCR|LightCycler 480 II (LC480)]]&#039;&#039;&#039;&lt;br /&gt;
| Real-time PCR for quantitative and qualitative detection of nucleic acids. Handles 96w and 384w plates; supports SYBR and TaqMan probes. Three units available (Thing 1 96w; Thing 2 &amp;amp; 3 384w). Maximum 4 hours/day during business hours (10 AM–5 PM); all slots available after hours. Donated by Prof. Laurie Boyer, Prof. Leonard Guarente, and the Dept. of Biology.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/261680/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Varioskan|Varioskan Flash]]&#039;&#039;&#039;&lt;br /&gt;
| Multimode plate reader for fluorometric, luminometric, and absorbance measurements in 96/384w format. Equipped with three onboard dispensers, incubator, and orbital shaker. Charged in 10-minute blocks. Donated by Prof. Jeroen Saeij.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262715/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Varioskan#Synergy_H1|Synergy H1 plate reader]]&#039;&#039;&#039;&lt;br /&gt;
| Hybrid multi-mode microplate reader (6w–384w). Supports UV-vis measurements via Take3 Trio plate module (48 × 2 µL samples; Nanodrop-equivalent). Can be signed out for use &#039;&#039;outside&#039;&#039; the BMC — sign out one week in advance. Charged in 10-minute blocks. Donated by Prof. Gene-Wei Li.&lt;br /&gt;
| [https://mit.ilabsolutions.com/service_center/3381?tab=equipment iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:2100BioAnalyzer|Agilent 2100 BioAnalyzer]]&#039;&#039;&#039;&lt;br /&gt;
| Nanofluidic sizing and quantification of DNA (25 bp–12 kb), RNA, and protein. Users must provide all reagents — BMC does not stock BioAnalyzer chips or reagents.&lt;br /&gt;
| [https://mit-ki.ilabsolutions.com/equipment/show/265040/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:NanoDrop_ND-1000|NanoDrop ND-1000]]&#039;&#039;&#039;&lt;br /&gt;
| Full-spectrum spectrophotometer (220–750 nm) for 1 µL samples. Measures nucleic acid and protein concentration and purity. Free for core department users. Located in 68-316.&lt;br /&gt;
| No scheduling required&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== DNA/RNA sizing ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:PippinPrep|BluePippin / Pippin Prep]]&#039;&#039;&#039;&lt;br /&gt;
| Automated preparative gel electrophoresis for DNA size selection. BluePippin: 50 bp–50 kb; Pippin Prep: 100 bp–1.5 kb. Charged per run. Donated by the Department of Biology.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262716/?tab=schedule iLabs]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Sonication ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Covaris|Covaris E220 Evolution]]&#039;&#039;&#039;&lt;br /&gt;
| Focused ultrasonicator for single-tube processing (1–96 samples per batch). Processes 25 µL–10 mL sample volumes. Shears DNA, RNA, chromatin; homogenizes tissue.&lt;br /&gt;
| (see instrument page)&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Covaris|Covaris R230]]&#039;&#039;&#039;&lt;br /&gt;
| High-throughput sonicator for 96 AFA-TUBE® TPX plates. Column sonication mode processes an entire 96-well plate 10× faster than E220. Funded by NIH grant R24OD035444 — include in publications.&lt;br /&gt;
| (see instrument page)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Automation ===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;Note:&#039;&#039;&#039; All automation scripts must be written by BMC staff. Once a script has been programmed, users may run it independently as a walk-up service. Contact [mailto:biomicro@mit.edu biomicro@mit.edu] to initiate script development.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Tecan_Freedom_Evo#JOHNNY_5|Tecan EVO 150 — Johnny 5]]&#039;&#039;&#039;&lt;br /&gt;
| Liquid handler optimized for cherry picking and plate normalization. LiHa span8 (2–200 µL) + MCA96 (50/200 µL tips). 6× 15 mL tube carriers, 3 temperature-controlled + 24 non-temperature-controlled SBS carriers, UV decontamination. BL1 work only. Donated by the Department of Biology.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262347/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Tecan_Freedom_Evo#B9|Tecan EVO 150 — B9]]&#039;&#039;&#039;&lt;br /&gt;
| Liquid handler optimized for sample processing and assay setup. MCA96 + RoMa plate handler. 3 temperature-controlled + 24 non-temperature-controlled SBS carriers. BL1 work only.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262347/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Tecan_Freedom_Evo#Revvity_Chemagic_360|Revvity Chemagic 360]]&#039;&#039;&#039;&lt;br /&gt;
| Magnetic bead-based automated nucleic acid purification. 96-well EM rod head; 12-tip 3-row dispenser array. Processes 96 tissue or cell lysates in up to 5 hours. Charged by consumables. Requires setup steps (lysate preparation before loading). Contact [mailto:biomicro@mit.edu biomicro@mit.edu] at least one month in advance — purification-specific kits take approximately one month to arrive. Donated by the MIT Stem Cell Initiative and Dr. Jacqueline A. Lees.&lt;br /&gt;
| Contact BMC 1 month ahead&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Sequencing ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Illumina_Sequencing|Illumina MiSeq i100]]&#039;&#039;&#039;&lt;br /&gt;
| Walk-up short-read sequencing. A run charge must be added to each reservation (listed as $0 in iLabs but required). Reserve for the actual run duration: 100 nt = 5 h, 300 nt = 8 h, 600 nt = 16 h. Sequencing kits stocked by BMC; available during business hours as add-on charges or via the consumable request form. All data stored on BMC servers (BMC-PUB or BMC-LAB) — Illumina BaseSpace is not directly available from the instrument.&lt;br /&gt;
| [https://mit.ilabsolutions.com/schedules/555535# iLabs]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Single cell / spatial (walk-up option) ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:SingleCell|10x Chromium X]]&#039;&#039;&#039;&lt;br /&gt;
| Available as walk-up after training by BMC staff. Chips must be purchased through BMC. Reagents are also available through BMC. Contact [mailto:biomicro@mit.edu biomicro@mit.edu] to arrange training and initial access.&lt;br /&gt;
| [https://mit.ilabsolutions.com/schedules/380963# iLabs]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Policies ==&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;Training is mandatory.&#039;&#039;&#039; No use of any instrument is permitted without prior training by BMC staff. Untrained use will result in suspension of walk-up privileges for the entire laboratory.&lt;br /&gt;
&lt;br /&gt;
* BMC business has priority on all walk-up equipment at all times.&lt;br /&gt;
* Reservations must be made at least 4 hours in advance. Late requests should be emailed to [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
* Walk-up access is MIT only in almost all cases. Non-MIT users should contact [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
* For the MiSeq i100: violation of the access policy results in termination of walk-up privileges for the &#039;&#039;&#039;entire laboratory&#039;&#039;&#039;, not only the individual user.&lt;br /&gt;
* All automation scripts must be written by BMC staff before users may run them independently.&lt;br /&gt;
&lt;br /&gt;
== Getting help ==&lt;br /&gt;
&lt;br /&gt;
For general questions, training requests, or after-hours access:&lt;br /&gt;
&lt;br /&gt;
* &#039;&#039;&#039;Email:&#039;&#039;&#039; [mailto:biomicro@mit.edu biomicro@mit.edu]&lt;br /&gt;
* &#039;&#039;&#039;Phone:&#039;&#039;&#039; 617-715-4533&lt;br /&gt;
* &#039;&#039;&#039;After-hours access:&#039;&#039;&#039; [https://www.dropbox.com/scl/fi/nxdzbesvp2mab69wofotm/New_User_Sign_Up_Form.docx?rlkey=x9ftkatdlm897fbeol2ibv8tb&amp;amp;st=ag0jsvn9&amp;amp;dl=0 After-Hours Access Form] (one-time sign-up)&lt;br /&gt;
* &#039;&#039;&#039;Walk in:&#039;&#039;&#039; [http://whereis.mit.edu/?go=68 68-322, MIT campus]&lt;br /&gt;
&lt;br /&gt;
See also: [[BioMicroCenter:FAQ]] for definitions of walk-up vs. assisted services, core lab status, and billing.&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Walkup_Services&amp;diff=131418</id>
		<title>BioMicroCenter:Walkup Services</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Walkup_Services&amp;diff=131418"/>
		<updated>2026-04-30T14:21:34Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* Sequencing */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
&lt;br /&gt;
== What are walk-up services? ==&lt;br /&gt;
&lt;br /&gt;
Walk-up services are those where the BioMicro Center provides training, maintenance, and scheduling of equipment, and may also provide consumables. Users operate the instruments themselves after completing a required training session with BMC staff. Walk-up services are almost exclusively limited to MIT users; non-MIT users should contact [mailto:biomicro@mit.edu biomicro@mit.edu] to discuss access.&lt;br /&gt;
&lt;br /&gt;
Walk-up services contrast with [[BioMicroCenter:FAQ#ASSISTED_versus_WALKUP_SERVICES|assisted services]], where samples are delivered to BMC staff for processing. See [[BioMicroCenter:FAQ]] for a full definition of both service types.&lt;br /&gt;
&lt;br /&gt;
== Scheduling and iLabs ==&lt;br /&gt;
&lt;br /&gt;
All walk-up equipment is scheduled through [https://mit-ki.ilabsolutions.com/sc/3381/ki-genomics-core-mit-biomicro-center?tab=equipment iLabs]. The equipment calendar lists instruments organized by category (BMC:qPCR, BMC:Varioskan, BMC:BioAnalyzer, BMC:Covaris, etc.).&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;Note: Items listed as $0 in iLabs are charged per use — you will be asked to enter the number of units when submitting your reservation. The number of units is cross-validated in the lab.&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
* Reservations on machines with heavy to regular usage must be made &#039;&#039;&#039;at least 4 hours in advance&#039;&#039;&#039;. For last-minute requests, email [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
* To arrange training, email [mailto:biomicro@mit.edu biomicro@mit.edu]. Depending on the instrument, staff will instruct you to book a time on the iLabs calendar or coordinate directly.&lt;br /&gt;
&lt;br /&gt;
== Training and access ==&lt;br /&gt;
&lt;br /&gt;
Training by BMC staff is required before using any walk-up instrument. Training sessions are typically one hour and cover instrument operation and best practices. To request training for any instrument, email [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
&lt;br /&gt;
Walk-up users may use equipment outside of regular business hours. After-hours access to the core requires a one-time sign-up — see the [[BioMicroCenter:Submission#Walk-up_services|Submission page]] for the after-hours access form.&lt;br /&gt;
&lt;br /&gt;
== Equipment available for walk-up ==&lt;br /&gt;
&lt;br /&gt;
Click any instrument name for full details, specifications, and scheduling links.&lt;br /&gt;
&lt;br /&gt;
=== Sample quantification and quality control ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:RTPCR|LightCycler 480 II (LC480)]]&#039;&#039;&#039;&lt;br /&gt;
| Real-time PCR for quantitative and qualitative detection of nucleic acids. Handles 96w and 384w plates; supports SYBR and TaqMan probes. Three units available (Thing 1 96w; Thing 2 &amp;amp; 3 384w). Maximum 4 hours/day during business hours (10 AM–5 PM); all slots available after hours. Donated by Prof. Laurie Boyer, Prof. Leonard Guarente, and the Dept. of Biology.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/261680/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Varioskan|Varioskan Flash]]&#039;&#039;&#039;&lt;br /&gt;
| Multimode plate reader for fluorometric, luminometric, and absorbance measurements in 96/384w format. Equipped with three onboard dispensers, incubator, and orbital shaker. Charged in 10-minute blocks. Donated by Prof. Jeroen Saeij.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262715/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Varioskan#Synergy_H1|Synergy H1 plate reader]]&#039;&#039;&#039;&lt;br /&gt;
| Hybrid multi-mode microplate reader (6w–384w). Supports UV-vis measurements via Take3 Trio plate module (48 × 2 µL samples; Nanodrop-equivalent). Can be signed out for use &#039;&#039;outside&#039;&#039; the BMC — sign out one week in advance. Charged in 10-minute blocks. Donated by Prof. Gene-Wei Li.&lt;br /&gt;
| [https://mit.ilabsolutions.com/service_center/3381?tab=equipment iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:2100BioAnalyzer|Agilent 2100 BioAnalyzer]]&#039;&#039;&#039;&lt;br /&gt;
| Nanofluidic sizing and quantification of DNA (25 bp–12 kb), RNA, and protein. Users must provide all reagents — BMC does not stock BioAnalyzer chips or reagents.&lt;br /&gt;
| [https://mit-ki.ilabsolutions.com/equipment/show/265040/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:NanoDrop_ND-1000|NanoDrop ND-1000]]&#039;&#039;&#039;&lt;br /&gt;
| Full-spectrum spectrophotometer (220–750 nm) for 1 µL samples. Measures nucleic acid and protein concentration and purity. Free for core department users. Located in 68-316.&lt;br /&gt;
| No scheduling required&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== DNA/RNA sizing ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:PippinPrep|BluePippin / Pippin Prep]]&#039;&#039;&#039;&lt;br /&gt;
| Automated preparative gel electrophoresis for DNA size selection. BluePippin: 50 bp–50 kb; Pippin Prep: 100 bp–1.5 kb. Charged per run. Donated by the Department of Biology.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262716/?tab=schedule iLabs]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Sonication ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Covaris|Covaris E220 Evolution]]&#039;&#039;&#039;&lt;br /&gt;
| Focused ultrasonicator for single-tube processing (1–96 samples per batch). Processes 25 µL–10 mL sample volumes. Shears DNA, RNA, chromatin; homogenizes tissue.&lt;br /&gt;
| (see instrument page)&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Covaris|Covaris R230]]&#039;&#039;&#039;&lt;br /&gt;
| High-throughput sonicator for 96 AFA-TUBE® TPX plates. Column sonication mode processes an entire 96-well plate 10× faster than E220. Funded by NIH grant R24OD035444 — include in publications.&lt;br /&gt;
| (see instrument page)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Automation ===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;Note:&#039;&#039;&#039; All automation scripts must be written by BMC staff. Once a script has been programmed, users may run it independently as a walk-up service. Contact [mailto:biomicro@mit.edu biomicro@mit.edu] to initiate script development.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Tecan_Freedom_Evo#JOHNNY_5|Tecan EVO 150 — Johnny 5]]&#039;&#039;&#039;&lt;br /&gt;
| Liquid handler optimized for cherry picking and plate normalization. LiHa span8 (2–200 µL) + MCA96 (50/200 µL tips). 6× 15 mL tube carriers, 3 temperature-controlled + 24 non-temperature-controlled SBS carriers, UV decontamination. BL1 work only. Donated by the Department of Biology.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262347/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Tecan_Freedom_Evo#B9|Tecan EVO 150 — B9]]&#039;&#039;&#039;&lt;br /&gt;
| Liquid handler optimized for sample processing and assay setup. MCA96 + RoMa plate handler. 3 temperature-controlled + 24 non-temperature-controlled SBS carriers. BL1 work only.&lt;br /&gt;
| (see instrument page)&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Tecan_Freedom_Evo#Revvity_Chemagic_360|Revvity Chemagic 360]]&#039;&#039;&#039;&lt;br /&gt;
| Magnetic bead-based automated nucleic acid purification. 96-well EM rod head; 12-tip 3-row dispenser array. Processes 96 tissue or cell lysates in up to 5 hours. Charged by consumables. Requires setup steps (lysate preparation before loading). Contact [mailto:biomicro@mit.edu biomicro@mit.edu] at least one month in advance — purification-specific kits take approximately one month to arrive. Donated by the MIT Stem Cell Initiative and Dr. Jacqueline A. Lees.&lt;br /&gt;
| Contact BMC 1 month ahead&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Sequencing ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Illumina_Sequencing|Illumina MiSeq i100]]&#039;&#039;&#039;&lt;br /&gt;
| Walk-up short-read sequencing. A run charge must be added to each reservation (listed as $0 in iLabs but required). Reserve for the actual run duration: 100 nt = 5 h, 300 nt = 8 h, 600 nt = 16 h. Sequencing kits stocked by BMC; available during business hours as add-on charges or via the consumable request form. All data stored on BMC servers (BMC-PUB or BMC-LAB) — Illumina BaseSpace is not directly available from the instrument.&lt;br /&gt;
| [https://mit.ilabsolutions.com/schedules/555535# iLabs]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Single cell / spatial (walk-up option) ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:SingleCell|10x Chromium X]]&#039;&#039;&#039;&lt;br /&gt;
| Available as walk-up after training by BMC staff. Chips must be purchased through BMC. Reagents are also available through BMC. Contact [mailto:biomicro@mit.edu biomicro@mit.edu] to arrange training and initial access.&lt;br /&gt;
| [https://mit.ilabsolutions.com/schedules/380963# iLabs]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Policies ==&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;Training is mandatory.&#039;&#039;&#039; No use of any instrument is permitted without prior training by BMC staff. Untrained use will result in suspension of walk-up privileges for the entire laboratory.&lt;br /&gt;
&lt;br /&gt;
* BMC business has priority on all walk-up equipment at all times.&lt;br /&gt;
* Reservations must be made at least 4 hours in advance. Late requests should be emailed to [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
* Walk-up access is MIT only in almost all cases. Non-MIT users should contact [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
* For the MiSeq i100: violation of the access policy results in termination of walk-up privileges for the &#039;&#039;&#039;entire laboratory&#039;&#039;&#039;, not only the individual user.&lt;br /&gt;
* All automation scripts must be written by BMC staff before users may run them independently.&lt;br /&gt;
&lt;br /&gt;
== Getting help ==&lt;br /&gt;
&lt;br /&gt;
For general questions, training requests, or after-hours access:&lt;br /&gt;
&lt;br /&gt;
* &#039;&#039;&#039;Email:&#039;&#039;&#039; [mailto:biomicro@mit.edu biomicro@mit.edu]&lt;br /&gt;
* &#039;&#039;&#039;Phone:&#039;&#039;&#039; 617-715-4533&lt;br /&gt;
* &#039;&#039;&#039;After-hours access:&#039;&#039;&#039; [https://www.dropbox.com/scl/fi/nxdzbesvp2mab69wofotm/New_User_Sign_Up_Form.docx?rlkey=x9ftkatdlm897fbeol2ibv8tb&amp;amp;st=ag0jsvn9&amp;amp;dl=0 After-Hours Access Form] (one-time sign-up)&lt;br /&gt;
* &#039;&#039;&#039;Walk in:&#039;&#039;&#039; [http://whereis.mit.edu/?go=68 68-322, MIT campus]&lt;br /&gt;
&lt;br /&gt;
See also: [[BioMicroCenter:FAQ]] for definitions of walk-up vs. assisted services, core lab status, and billing.&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Walkup_Services&amp;diff=131417</id>
		<title>BioMicroCenter:Walkup Services</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Walkup_Services&amp;diff=131417"/>
		<updated>2026-04-30T14:20:46Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* Single cell / spatial (walk-up option) */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
&lt;br /&gt;
== What are walk-up services? ==&lt;br /&gt;
&lt;br /&gt;
Walk-up services are those where the BioMicro Center provides training, maintenance, and scheduling of equipment, and may also provide consumables. Users operate the instruments themselves after completing a required training session with BMC staff. Walk-up services are almost exclusively limited to MIT users; non-MIT users should contact [mailto:biomicro@mit.edu biomicro@mit.edu] to discuss access.&lt;br /&gt;
&lt;br /&gt;
Walk-up services contrast with [[BioMicroCenter:FAQ#ASSISTED_versus_WALKUP_SERVICES|assisted services]], where samples are delivered to BMC staff for processing. See [[BioMicroCenter:FAQ]] for a full definition of both service types.&lt;br /&gt;
&lt;br /&gt;
== Scheduling and iLabs ==&lt;br /&gt;
&lt;br /&gt;
All walk-up equipment is scheduled through [https://mit-ki.ilabsolutions.com/sc/3381/ki-genomics-core-mit-biomicro-center?tab=equipment iLabs]. The equipment calendar lists instruments organized by category (BMC:qPCR, BMC:Varioskan, BMC:BioAnalyzer, BMC:Covaris, etc.).&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;Note: Items listed as $0 in iLabs are charged per use — you will be asked to enter the number of units when submitting your reservation. The number of units is cross-validated in the lab.&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
* Reservations on machines with heavy to regular usage must be made &#039;&#039;&#039;at least 4 hours in advance&#039;&#039;&#039;. For last-minute requests, email [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
* To arrange training, email [mailto:biomicro@mit.edu biomicro@mit.edu]. Depending on the instrument, staff will instruct you to book a time on the iLabs calendar or coordinate directly.&lt;br /&gt;
&lt;br /&gt;
== Training and access ==&lt;br /&gt;
&lt;br /&gt;
Training by BMC staff is required before using any walk-up instrument. Training sessions are typically one hour and cover instrument operation and best practices. To request training for any instrument, email [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
&lt;br /&gt;
Walk-up users may use equipment outside of regular business hours. After-hours access to the core requires a one-time sign-up — see the [[BioMicroCenter:Submission#Walk-up_services|Submission page]] for the after-hours access form.&lt;br /&gt;
&lt;br /&gt;
== Equipment available for walk-up ==&lt;br /&gt;
&lt;br /&gt;
Click any instrument name for full details, specifications, and scheduling links.&lt;br /&gt;
&lt;br /&gt;
=== Sample quantification and quality control ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:RTPCR|LightCycler 480 II (LC480)]]&#039;&#039;&#039;&lt;br /&gt;
| Real-time PCR for quantitative and qualitative detection of nucleic acids. Handles 96w and 384w plates; supports SYBR and TaqMan probes. Three units available (Thing 1 96w; Thing 2 &amp;amp; 3 384w). Maximum 4 hours/day during business hours (10 AM–5 PM); all slots available after hours. Donated by Prof. Laurie Boyer, Prof. Leonard Guarente, and the Dept. of Biology.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/261680/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Varioskan|Varioskan Flash]]&#039;&#039;&#039;&lt;br /&gt;
| Multimode plate reader for fluorometric, luminometric, and absorbance measurements in 96/384w format. Equipped with three onboard dispensers, incubator, and orbital shaker. Charged in 10-minute blocks. Donated by Prof. Jeroen Saeij.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262715/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Varioskan#Synergy_H1|Synergy H1 plate reader]]&#039;&#039;&#039;&lt;br /&gt;
| Hybrid multi-mode microplate reader (6w–384w). Supports UV-vis measurements via Take3 Trio plate module (48 × 2 µL samples; Nanodrop-equivalent). Can be signed out for use &#039;&#039;outside&#039;&#039; the BMC — sign out one week in advance. Charged in 10-minute blocks. Donated by Prof. Gene-Wei Li.&lt;br /&gt;
| [https://mit.ilabsolutions.com/service_center/3381?tab=equipment iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:2100BioAnalyzer|Agilent 2100 BioAnalyzer]]&#039;&#039;&#039;&lt;br /&gt;
| Nanofluidic sizing and quantification of DNA (25 bp–12 kb), RNA, and protein. Users must provide all reagents — BMC does not stock BioAnalyzer chips or reagents.&lt;br /&gt;
| [https://mit-ki.ilabsolutions.com/equipment/show/265040/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:NanoDrop_ND-1000|NanoDrop ND-1000]]&#039;&#039;&#039;&lt;br /&gt;
| Full-spectrum spectrophotometer (220–750 nm) for 1 µL samples. Measures nucleic acid and protein concentration and purity. Free for core department users. Located in 68-316.&lt;br /&gt;
| No scheduling required&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== DNA/RNA sizing ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:PippinPrep|BluePippin / Pippin Prep]]&#039;&#039;&#039;&lt;br /&gt;
| Automated preparative gel electrophoresis for DNA size selection. BluePippin: 50 bp–50 kb; Pippin Prep: 100 bp–1.5 kb. Charged per run. Donated by the Department of Biology.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262716/?tab=schedule iLabs]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Sonication ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Covaris|Covaris E220 Evolution]]&#039;&#039;&#039;&lt;br /&gt;
| Focused ultrasonicator for single-tube processing (1–96 samples per batch). Processes 25 µL–10 mL sample volumes. Shears DNA, RNA, chromatin; homogenizes tissue.&lt;br /&gt;
| (see instrument page)&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Covaris|Covaris R230]]&#039;&#039;&#039;&lt;br /&gt;
| High-throughput sonicator for 96 AFA-TUBE® TPX plates. Column sonication mode processes an entire 96-well plate 10× faster than E220. Funded by NIH grant R24OD035444 — include in publications.&lt;br /&gt;
| (see instrument page)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Automation ===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;Note:&#039;&#039;&#039; All automation scripts must be written by BMC staff. Once a script has been programmed, users may run it independently as a walk-up service. Contact [mailto:biomicro@mit.edu biomicro@mit.edu] to initiate script development.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Tecan_Freedom_Evo#JOHNNY_5|Tecan EVO 150 — Johnny 5]]&#039;&#039;&#039;&lt;br /&gt;
| Liquid handler optimized for cherry picking and plate normalization. LiHa span8 (2–200 µL) + MCA96 (50/200 µL tips). 6× 15 mL tube carriers, 3 temperature-controlled + 24 non-temperature-controlled SBS carriers, UV decontamination. BL1 work only. Donated by the Department of Biology.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262347/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Tecan_Freedom_Evo#B9|Tecan EVO 150 — B9]]&#039;&#039;&#039;&lt;br /&gt;
| Liquid handler optimized for sample processing and assay setup. MCA96 + RoMa plate handler. 3 temperature-controlled + 24 non-temperature-controlled SBS carriers. BL1 work only.&lt;br /&gt;
| (see instrument page)&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Tecan_Freedom_Evo#Revvity_Chemagic_360|Revvity Chemagic 360]]&#039;&#039;&#039;&lt;br /&gt;
| Magnetic bead-based automated nucleic acid purification. 96-well EM rod head; 12-tip 3-row dispenser array. Processes 96 tissue or cell lysates in up to 5 hours. Charged by consumables. Requires setup steps (lysate preparation before loading). Contact [mailto:biomicro@mit.edu biomicro@mit.edu] at least one month in advance — purification-specific kits take approximately one month to arrive. Donated by the MIT Stem Cell Initiative and Dr. Jacqueline A. Lees.&lt;br /&gt;
| Contact BMC 1 month ahead&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Sequencing ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Illumina_Sequencing|Illumina MiSeq i100]]&#039;&#039;&#039;&lt;br /&gt;
| Walk-up short-read sequencing. A run charge must be added to each reservation (listed as $0 in iLabs but required). Reserve for the actual run duration: 100 nt = 5 h, 300 nt = 8 h, 600 nt = 16 h. Sequencing kits stocked by BMC; available during business hours as add-on charges or via the consumable request form. All data stored on BMC servers (BMC-PUB or BMC-LAB) — Illumina BaseSpace is not directly available from the instrument.&lt;br /&gt;
| (see iLabs equipment tab)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Single cell / spatial (walk-up option) ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:SingleCell|10x Chromium X]]&#039;&#039;&#039;&lt;br /&gt;
| Available as walk-up after training by BMC staff. Chips must be purchased through BMC. Reagents are also available through BMC. Contact [mailto:biomicro@mit.edu biomicro@mit.edu] to arrange training and initial access.&lt;br /&gt;
| [https://mit.ilabsolutions.com/schedules/380963# iLabs]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Policies ==&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;Training is mandatory.&#039;&#039;&#039; No use of any instrument is permitted without prior training by BMC staff. Untrained use will result in suspension of walk-up privileges for the entire laboratory.&lt;br /&gt;
&lt;br /&gt;
* BMC business has priority on all walk-up equipment at all times.&lt;br /&gt;
* Reservations must be made at least 4 hours in advance. Late requests should be emailed to [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
* Walk-up access is MIT only in almost all cases. Non-MIT users should contact [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
* For the MiSeq i100: violation of the access policy results in termination of walk-up privileges for the &#039;&#039;&#039;entire laboratory&#039;&#039;&#039;, not only the individual user.&lt;br /&gt;
* All automation scripts must be written by BMC staff before users may run them independently.&lt;br /&gt;
&lt;br /&gt;
== Getting help ==&lt;br /&gt;
&lt;br /&gt;
For general questions, training requests, or after-hours access:&lt;br /&gt;
&lt;br /&gt;
* &#039;&#039;&#039;Email:&#039;&#039;&#039; [mailto:biomicro@mit.edu biomicro@mit.edu]&lt;br /&gt;
* &#039;&#039;&#039;Phone:&#039;&#039;&#039; 617-715-4533&lt;br /&gt;
* &#039;&#039;&#039;After-hours access:&#039;&#039;&#039; [https://www.dropbox.com/scl/fi/nxdzbesvp2mab69wofotm/New_User_Sign_Up_Form.docx?rlkey=x9ftkatdlm897fbeol2ibv8tb&amp;amp;st=ag0jsvn9&amp;amp;dl=0 After-Hours Access Form] (one-time sign-up)&lt;br /&gt;
* &#039;&#039;&#039;Walk in:&#039;&#039;&#039; [http://whereis.mit.edu/?go=68 68-322, MIT campus]&lt;br /&gt;
&lt;br /&gt;
See also: [[BioMicroCenter:FAQ]] for definitions of walk-up vs. assisted services, core lab status, and billing.&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Walkup_Services&amp;diff=131416</id>
		<title>BioMicroCenter:Walkup Services</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Walkup_Services&amp;diff=131416"/>
		<updated>2026-04-30T14:09:30Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* Scheduling and iLabs */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
&lt;br /&gt;
== What are walk-up services? ==&lt;br /&gt;
&lt;br /&gt;
Walk-up services are those where the BioMicro Center provides training, maintenance, and scheduling of equipment, and may also provide consumables. Users operate the instruments themselves after completing a required training session with BMC staff. Walk-up services are almost exclusively limited to MIT users; non-MIT users should contact [mailto:biomicro@mit.edu biomicro@mit.edu] to discuss access.&lt;br /&gt;
&lt;br /&gt;
Walk-up services contrast with [[BioMicroCenter:FAQ#ASSISTED_versus_WALKUP_SERVICES|assisted services]], where samples are delivered to BMC staff for processing. See [[BioMicroCenter:FAQ]] for a full definition of both service types.&lt;br /&gt;
&lt;br /&gt;
== Scheduling and iLabs ==&lt;br /&gt;
&lt;br /&gt;
All walk-up equipment is scheduled through [https://mit-ki.ilabsolutions.com/sc/3381/ki-genomics-core-mit-biomicro-center?tab=equipment iLabs]. The equipment calendar lists instruments organized by category (BMC:qPCR, BMC:Varioskan, BMC:BioAnalyzer, BMC:Covaris, etc.).&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;Note: Items listed as $0 in iLabs are charged per use — you will be asked to enter the number of units when submitting your reservation. The number of units is cross-validated in the lab.&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
* Reservations on machines with heavy to regular usage must be made &#039;&#039;&#039;at least 4 hours in advance&#039;&#039;&#039;. For last-minute requests, email [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
* To arrange training, email [mailto:biomicro@mit.edu biomicro@mit.edu]. Depending on the instrument, staff will instruct you to book a time on the iLabs calendar or coordinate directly.&lt;br /&gt;
&lt;br /&gt;
== Training and access ==&lt;br /&gt;
&lt;br /&gt;
Training by BMC staff is required before using any walk-up instrument. Training sessions are typically one hour and cover instrument operation and best practices. To request training for any instrument, email [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
&lt;br /&gt;
Walk-up users may use equipment outside of regular business hours. After-hours access to the core requires a one-time sign-up — see the [[BioMicroCenter:Submission#Walk-up_services|Submission page]] for the after-hours access form.&lt;br /&gt;
&lt;br /&gt;
== Equipment available for walk-up ==&lt;br /&gt;
&lt;br /&gt;
Click any instrument name for full details, specifications, and scheduling links.&lt;br /&gt;
&lt;br /&gt;
=== Sample quantification and quality control ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:RTPCR|LightCycler 480 II (LC480)]]&#039;&#039;&#039;&lt;br /&gt;
| Real-time PCR for quantitative and qualitative detection of nucleic acids. Handles 96w and 384w plates; supports SYBR and TaqMan probes. Three units available (Thing 1 96w; Thing 2 &amp;amp; 3 384w). Maximum 4 hours/day during business hours (10 AM–5 PM); all slots available after hours. Donated by Prof. Laurie Boyer, Prof. Leonard Guarente, and the Dept. of Biology.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/261680/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Varioskan|Varioskan Flash]]&#039;&#039;&#039;&lt;br /&gt;
| Multimode plate reader for fluorometric, luminometric, and absorbance measurements in 96/384w format. Equipped with three onboard dispensers, incubator, and orbital shaker. Charged in 10-minute blocks. Donated by Prof. Jeroen Saeij.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262715/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Varioskan#Synergy_H1|Synergy H1 plate reader]]&#039;&#039;&#039;&lt;br /&gt;
| Hybrid multi-mode microplate reader (6w–384w). Supports UV-vis measurements via Take3 Trio plate module (48 × 2 µL samples; Nanodrop-equivalent). Can be signed out for use &#039;&#039;outside&#039;&#039; the BMC — sign out one week in advance. Charged in 10-minute blocks. Donated by Prof. Gene-Wei Li.&lt;br /&gt;
| [https://mit.ilabsolutions.com/service_center/3381?tab=equipment iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:2100BioAnalyzer|Agilent 2100 BioAnalyzer]]&#039;&#039;&#039;&lt;br /&gt;
| Nanofluidic sizing and quantification of DNA (25 bp–12 kb), RNA, and protein. Users must provide all reagents — BMC does not stock BioAnalyzer chips or reagents.&lt;br /&gt;
| [https://mit-ki.ilabsolutions.com/equipment/show/265040/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:NanoDrop_ND-1000|NanoDrop ND-1000]]&#039;&#039;&#039;&lt;br /&gt;
| Full-spectrum spectrophotometer (220–750 nm) for 1 µL samples. Measures nucleic acid and protein concentration and purity. Free for core department users. Located in 68-316.&lt;br /&gt;
| No scheduling required&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== DNA/RNA sizing ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:PippinPrep|BluePippin / Pippin Prep]]&#039;&#039;&#039;&lt;br /&gt;
| Automated preparative gel electrophoresis for DNA size selection. BluePippin: 50 bp–50 kb; Pippin Prep: 100 bp–1.5 kb. Charged per run. Donated by the Department of Biology.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262716/?tab=schedule iLabs]&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Sonication ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Covaris|Covaris E220 Evolution]]&#039;&#039;&#039;&lt;br /&gt;
| Focused ultrasonicator for single-tube processing (1–96 samples per batch). Processes 25 µL–10 mL sample volumes. Shears DNA, RNA, chromatin; homogenizes tissue.&lt;br /&gt;
| (see instrument page)&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Covaris|Covaris R230]]&#039;&#039;&#039;&lt;br /&gt;
| High-throughput sonicator for 96 AFA-TUBE® TPX plates. Column sonication mode processes an entire 96-well plate 10× faster than E220. Funded by NIH grant R24OD035444 — include in publications.&lt;br /&gt;
| (see instrument page)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Automation ===&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;Note:&#039;&#039;&#039; All automation scripts must be written by BMC staff. Once a script has been programmed, users may run it independently as a walk-up service. Contact [mailto:biomicro@mit.edu biomicro@mit.edu] to initiate script development.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Tecan_Freedom_Evo#JOHNNY_5|Tecan EVO 150 — Johnny 5]]&#039;&#039;&#039;&lt;br /&gt;
| Liquid handler optimized for cherry picking and plate normalization. LiHa span8 (2–200 µL) + MCA96 (50/200 µL tips). 6× 15 mL tube carriers, 3 temperature-controlled + 24 non-temperature-controlled SBS carriers, UV decontamination. BL1 work only. Donated by the Department of Biology.&lt;br /&gt;
| [https://mit.ilabsolutions.com/equipment/show/262347/?tab=schedule iLabs]&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Tecan_Freedom_Evo#B9|Tecan EVO 150 — B9]]&#039;&#039;&#039;&lt;br /&gt;
| Liquid handler optimized for sample processing and assay setup. MCA96 + RoMa plate handler. 3 temperature-controlled + 24 non-temperature-controlled SBS carriers. BL1 work only.&lt;br /&gt;
| (see instrument page)&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Tecan_Freedom_Evo#Revvity_Chemagic_360|Revvity Chemagic 360]]&#039;&#039;&#039;&lt;br /&gt;
| Magnetic bead-based automated nucleic acid purification. 96-well EM rod head; 12-tip 3-row dispenser array. Processes 96 tissue or cell lysates in up to 5 hours. Charged by consumables. Requires setup steps (lysate preparation before loading). Contact [mailto:biomicro@mit.edu biomicro@mit.edu] at least one month in advance — purification-specific kits take approximately one month to arrive. Donated by the MIT Stem Cell Initiative and Dr. Jacqueline A. Lees.&lt;br /&gt;
| Contact BMC 1 month ahead&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Sequencing ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:Illumina_Sequencing|Illumina MiSeq i100]]&#039;&#039;&#039;&lt;br /&gt;
| Walk-up short-read sequencing. A run charge must be added to each reservation (listed as $0 in iLabs but required). Reserve for the actual run duration: 100 nt = 5 h, 300 nt = 8 h, 600 nt = 16 h. Sequencing kits stocked by BMC; available during business hours as add-on charges or via the consumable request form. All data stored on BMC servers (BMC-PUB or BMC-LAB) — Illumina BaseSpace is not directly available from the instrument.&lt;br /&gt;
| (see iLabs equipment tab)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== Single cell / spatial (walk-up option) ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot; style=&amp;quot;width:100%;&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! style=&amp;quot;width:200px;&amp;quot; | Instrument !! Summary !! style=&amp;quot;width:110px;&amp;quot; | Schedule&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;[[BioMicroCenter:SingleCell|10x Chromium X]]&#039;&#039;&#039;&lt;br /&gt;
| Available as walk-up after training by BMC staff. Chips must be purchased through BMC. Reagents are also available through BMC. Contact [mailto:biomicro@mit.edu biomicro@mit.edu] to arrange training and initial access.&lt;br /&gt;
| (see iLabs equipment tab)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== Policies ==&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039;Training is mandatory.&#039;&#039;&#039; No use of any instrument is permitted without prior training by BMC staff. Untrained use will result in suspension of walk-up privileges for the entire laboratory.&lt;br /&gt;
&lt;br /&gt;
* BMC business has priority on all walk-up equipment at all times.&lt;br /&gt;
* Reservations must be made at least 4 hours in advance. Late requests should be emailed to [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
* Walk-up access is MIT only in almost all cases. Non-MIT users should contact [mailto:biomicro@mit.edu biomicro@mit.edu].&lt;br /&gt;
* For the MiSeq i100: violation of the access policy results in termination of walk-up privileges for the &#039;&#039;&#039;entire laboratory&#039;&#039;&#039;, not only the individual user.&lt;br /&gt;
* All automation scripts must be written by BMC staff before users may run them independently.&lt;br /&gt;
&lt;br /&gt;
== Getting help ==&lt;br /&gt;
&lt;br /&gt;
For general questions, training requests, or after-hours access:&lt;br /&gt;
&lt;br /&gt;
* &#039;&#039;&#039;Email:&#039;&#039;&#039; [mailto:biomicro@mit.edu biomicro@mit.edu]&lt;br /&gt;
* &#039;&#039;&#039;Phone:&#039;&#039;&#039; 617-715-4533&lt;br /&gt;
* &#039;&#039;&#039;After-hours access:&#039;&#039;&#039; [https://www.dropbox.com/scl/fi/nxdzbesvp2mab69wofotm/New_User_Sign_Up_Form.docx?rlkey=x9ftkatdlm897fbeol2ibv8tb&amp;amp;st=ag0jsvn9&amp;amp;dl=0 After-Hours Access Form] (one-time sign-up)&lt;br /&gt;
* &#039;&#039;&#039;Walk in:&#039;&#039;&#039; [http://whereis.mit.edu/?go=68 68-322, MIT campus]&lt;br /&gt;
&lt;br /&gt;
See also: [[BioMicroCenter:FAQ]] for definitions of walk-up vs. assisted services, core lab status, and billing.&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Oligo_Synthesis&amp;diff=131415</id>
		<title>BioMicroCenter:Oligo Synthesis</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Oligo_Synthesis&amp;diff=131415"/>
		<updated>2026-04-30T14:07:35Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* STX-200 */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039; ** All users must be trained before being allowed to use the equipment **&#039;&#039;&#039;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
The BioMicro Center currently hosts the Syntax STX-200 (DNAScript), an oligo synthesizer. &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The Syntax utilizes enzymatic chemistry to create a set of 96 phosphorylated ready to go oligos utilizing the platform solely in about a day. Plates may be ordered through ilabs. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== STX-200 ==&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:350px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Instrument&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 325px;&amp;quot; | Syntax STX-200&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | USAGE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [https://mit-ki.ilabsolutions.com/sc/3381/ki-genomics-core-mit-biomicro-center?tab=services Order through iLab]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Setup + oligo charge&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Chemistry&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* Enzymatic&lt;br /&gt;
* 5&#039; phosphorylated end&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Number of Oligos per Run&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* 24 or 96&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ON LOAN THROUGH&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | DNAScript&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:&amp;quot;The Syntax&amp;quot; platform employs enzymatic DNA synthesis. All chemistry is handled within the Syntax machine-final elution of the oligos occurs in a 96 well deep well plate. Final concentration is usable for standard PCR reactions. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
:::::::[[IMAGE:syntax.jpg | inline | 400px]] &lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;!--comment out&lt;br /&gt;
Dr Oligo is optimized for higher concentrations of oligos made through polyamidite synthesis. For ready to use oligos a series of steps must be completed using the other related machines in the Center including the column presser, the heated pressure chamber and the processor: each individual step utilizing a machine takes a few hours of setup, processing and completion. These tools are available to MIT researchers for use in their research and may be signed out using iLabs after training is complete.&lt;br /&gt;
&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
== Dr Oligo 96 ==&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:350px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Instrument&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | Dr Oligo 96&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | USAGE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Walkup - MIT only &amp;lt;br&amp;gt; Approval Required&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Per hour + Consumables&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Number of oligos per run&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* 24&lt;br /&gt;
* 96&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Hazards&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* Pressurized Synthesis &lt;br /&gt;
* Heated Pressure Chamber with Ammonium&lt;br /&gt;
* &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SCHEDULE USAGE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [https://mit.ilabsolutions.com/equipment/show/262347/?tab=schedule ilabs]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | NEW USERS&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | New users should request training by emailing the [mailto:biomicro@mit.edu  BioMicro Center team].&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | DONATED BY&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Dr Mark Bathe, CEHS&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:&amp;quot;Dr Oligo&amp;quot; is the BioMicro Center oligo synthesizer optimized for high concentration. A 24 or 96 column plate can be loaded on the synthesizer--it is recommended to duplicate oligo sequences and not necessarily use dummy columns since oligo synthesis can fail for some columns during polyamidite synthesis.  This synthesis adds 3&#039; to 5&#039;, and each subsequent base addition reduces yield. Synthesis of oligos lower than 50 bp on this platform is typically short and high yield, oligos longer than 100 or 150 bp have a higher likelihood of failure. Post processing, size selection is recommended since shorter non-ideal oligos may also be eluted. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Users should plan synthesis in advance to coordinate usage with other users.&amp;lt;BR&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:::::::[[IMAGE:DrOligo.jpg | synth| 400px]] [[IMAGE:droligoprocess.jpg | process| 400px]] &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;  [[IMAGE:chamber.jpg | heat| 400px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
--&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Oligo_Synthesis&amp;diff=131414</id>
		<title>BioMicroCenter:Oligo Synthesis</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Oligo_Synthesis&amp;diff=131414"/>
		<updated>2026-04-30T14:07:19Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* STX-200 */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039; ** All users must be trained before being allowed to use the equipment **&#039;&#039;&#039;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
The BioMicro Center currently hosts the Syntax STX-200 (DNAScript), an oligo synthesizer. &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The Syntax utilizes enzymatic chemistry to create a set of 96 phosphorylated ready to go oligos utilizing the platform solely in about a day. Plates may be ordered through ilabs. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== STX-200 ==&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:350px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Instrument&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 325px;&amp;quot; | Syntax STX-200&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | USAGE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [https://mit-ki.ilabsolutions.com/sc/3381/ki-genomics-core-mit-biomicro-center?tab=services Order through iLab]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Setup + oligo charge&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Chemistry&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* Enzymatic&lt;br /&gt;
* 5&#039; phosphorylated end&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Number of Oligos per Run&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* 24 or 96&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ON LOAN THROUGH&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | DNAScript&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:&amp;quot;The Syntax&amp;quot; platform employs enzymatic DNA synthesis. All chemistry is handled within the Syntax machine-final elution of the oligos occurs in a 96 well deep well plate. Final concentration is usable for standard PCR. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
:::::::[[IMAGE:syntax.jpg | inline | 400px]] &lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;!--comment out&lt;br /&gt;
Dr Oligo is optimized for higher concentrations of oligos made through polyamidite synthesis. For ready to use oligos a series of steps must be completed using the other related machines in the Center including the column presser, the heated pressure chamber and the processor: each individual step utilizing a machine takes a few hours of setup, processing and completion. These tools are available to MIT researchers for use in their research and may be signed out using iLabs after training is complete.&lt;br /&gt;
&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
== Dr Oligo 96 ==&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:350px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Instrument&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | Dr Oligo 96&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | USAGE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Walkup - MIT only &amp;lt;br&amp;gt; Approval Required&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Per hour + Consumables&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Number of oligos per run&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* 24&lt;br /&gt;
* 96&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Hazards&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* Pressurized Synthesis &lt;br /&gt;
* Heated Pressure Chamber with Ammonium&lt;br /&gt;
* &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SCHEDULE USAGE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [https://mit.ilabsolutions.com/equipment/show/262347/?tab=schedule ilabs]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | NEW USERS&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | New users should request training by emailing the [mailto:biomicro@mit.edu  BioMicro Center team].&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | DONATED BY&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Dr Mark Bathe, CEHS&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:&amp;quot;Dr Oligo&amp;quot; is the BioMicro Center oligo synthesizer optimized for high concentration. A 24 or 96 column plate can be loaded on the synthesizer--it is recommended to duplicate oligo sequences and not necessarily use dummy columns since oligo synthesis can fail for some columns during polyamidite synthesis.  This synthesis adds 3&#039; to 5&#039;, and each subsequent base addition reduces yield. Synthesis of oligos lower than 50 bp on this platform is typically short and high yield, oligos longer than 100 or 150 bp have a higher likelihood of failure. Post processing, size selection is recommended since shorter non-ideal oligos may also be eluted. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Users should plan synthesis in advance to coordinate usage with other users.&amp;lt;BR&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:::::::[[IMAGE:DrOligo.jpg | synth| 400px]] [[IMAGE:droligoprocess.jpg | process| 400px]] &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;  [[IMAGE:chamber.jpg | heat| 400px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
--&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Oligo_Synthesis&amp;diff=131413</id>
		<title>BioMicroCenter:Oligo Synthesis</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Oligo_Synthesis&amp;diff=131413"/>
		<updated>2026-04-30T14:06:28Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039; ** All users must be trained before being allowed to use the equipment **&#039;&#039;&#039;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
The BioMicro Center currently hosts the Syntax STX-200 (DNAScript), an oligo synthesizer. &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The Syntax utilizes enzymatic chemistry to create a set of 96 phosphorylated ready to go oligos utilizing the platform solely in about a day. Plates may be ordered through ilabs. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== STX-200 ==&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:350px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Instrument&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 325px;&amp;quot; | Syntax STX-200&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | USAGE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [https://mit-ki.ilabsolutions.com/sc/3381/ki-genomics-core-mit-biomicro-center?tab=services Order through iLab]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Setup + oligo charge&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Chemistry&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* Enzymatic&lt;br /&gt;
* 5&#039; phosphorylated end&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Number of Oligos per Run&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* 24 or 96&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ON LOAN THROUGH&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | DNAScript&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:&amp;quot;The Syntax&amp;quot; platform employs enzymatic DNA synthesis. All chemistry is handled within the Syntax machine-final elution of the oligos occurs in a 96 well deep well plate. Final concentration is at least 10x lower than mid-yield Dr Oligo products. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
:::::::[[IMAGE:syntax.jpg | inline | 400px]] &lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;!--comment out&lt;br /&gt;
Dr Oligo is optimized for higher concentrations of oligos made through polyamidite synthesis. For ready to use oligos a series of steps must be completed using the other related machines in the Center including the column presser, the heated pressure chamber and the processor: each individual step utilizing a machine takes a few hours of setup, processing and completion. These tools are available to MIT researchers for use in their research and may be signed out using iLabs after training is complete.&lt;br /&gt;
&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
== Dr Oligo 96 ==&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:350px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Instrument&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | Dr Oligo 96&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | USAGE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Walkup - MIT only &amp;lt;br&amp;gt; Approval Required&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Per hour + Consumables&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Number of oligos per run&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* 24&lt;br /&gt;
* 96&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Hazards&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* Pressurized Synthesis &lt;br /&gt;
* Heated Pressure Chamber with Ammonium&lt;br /&gt;
* &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SCHEDULE USAGE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [https://mit.ilabsolutions.com/equipment/show/262347/?tab=schedule ilabs]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | NEW USERS&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | New users should request training by emailing the [mailto:biomicro@mit.edu  BioMicro Center team].&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | DONATED BY&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Dr Mark Bathe, CEHS&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:&amp;quot;Dr Oligo&amp;quot; is the BioMicro Center oligo synthesizer optimized for high concentration. A 24 or 96 column plate can be loaded on the synthesizer--it is recommended to duplicate oligo sequences and not necessarily use dummy columns since oligo synthesis can fail for some columns during polyamidite synthesis.  This synthesis adds 3&#039; to 5&#039;, and each subsequent base addition reduces yield. Synthesis of oligos lower than 50 bp on this platform is typically short and high yield, oligos longer than 100 or 150 bp have a higher likelihood of failure. Post processing, size selection is recommended since shorter non-ideal oligos may also be eluted. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Users should plan synthesis in advance to coordinate usage with other users.&amp;lt;BR&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:::::::[[IMAGE:DrOligo.jpg | synth| 400px]] [[IMAGE:droligoprocess.jpg | process| 400px]] &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;  [[IMAGE:chamber.jpg | heat| 400px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
--&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Oligo_Synthesis&amp;diff=131412</id>
		<title>BioMicroCenter:Oligo Synthesis</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Oligo_Synthesis&amp;diff=131412"/>
		<updated>2026-04-30T14:05:45Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: &lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
&lt;br /&gt;
&#039;&#039;&#039; ** All users must be trained before being allowed to use the equipment **&#039;&#039;&#039;&amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
The BioMicro Center currently hosts two oligo synthesizers: one Dr Oligo 96 (Biolytic) and one Syntax STX-200 (DNAScript). &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
Dr Oligo is optimized for higher concentrations of oligos made through polyamidite synthesis. For ready to use oligos a series of steps must be completed using the other related machines in the Center including the column presser, the heated pressure chamber and the processor: each individual step utilizing a machine takes a few hours of setup, processing and completion. These tools are available to MIT researchers for use in their research and may be signed out using iLabs after training is complete.&lt;br /&gt;
&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
The Syntax utilizes enzymatic chemistry to create a set of 96 phosphorylated ready to go oligos utilizing the platform solely in about a day. Plates may be ordered through ilabs. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== STX-200 ==&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:350px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Instrument&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 325px;&amp;quot; | Syntax STX-200&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | USAGE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [https://mit-ki.ilabsolutions.com/sc/3381/ki-genomics-core-mit-biomicro-center?tab=services Order through iLab]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Setup + oligo charge&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Chemistry&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* Enzymatic&lt;br /&gt;
* 5&#039; phosphorylated end&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Number of Oligos per Run&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* 24 or 96&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | ON LOAN THROUGH&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | DNAScript&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:&amp;quot;The Syntax&amp;quot; platform employs enzymatic DNA synthesis. All chemistry is handled within the Syntax machine-final elution of the oligos occurs in a 96 well deep well plate. Final concentration is at least 10x lower than mid-yield Dr Oligo products. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
:::::::[[IMAGE:syntax.jpg | inline | 400px]] &lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;!--comment out&lt;br /&gt;
== Dr Oligo 96 ==&lt;br /&gt;
{|&lt;br /&gt;
|- style=&amp;quot;vertical-align: top;&amp;quot;&lt;br /&gt;
| style=&amp;quot;width:350px;&amp;quot; |&lt;br /&gt;
  {| class=&amp;quot;wikitable&amp;quot; border=1&lt;br /&gt;
  |-&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 150px;&amp;quot; | Instrument&lt;br /&gt;
  ! style=&amp;quot;text-align: center; width: 300px;&amp;quot; | Dr Oligo 96&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | USAGE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Walkup - MIT only &amp;lt;br&amp;gt; Approval Required&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | UNIT&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Per hour + Consumables&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Number of oligos per run&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* 24&lt;br /&gt;
* 96&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Hazards&lt;br /&gt;
  | style=&amp;quot;text-align: left; height: 2em;&amp;quot; | &lt;br /&gt;
* Pressurized Synthesis &lt;br /&gt;
* Heated Pressure Chamber with Ammonium&lt;br /&gt;
* &lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | SCHEDULE USAGE&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | [https://mit.ilabsolutions.com/equipment/show/262347/?tab=schedule ilabs]&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | NEW USERS&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | New users should request training by emailing the [mailto:biomicro@mit.edu  BioMicro Center team].&lt;br /&gt;
  |-&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | DONATED BY&lt;br /&gt;
  | style=&amp;quot;text-align: center; height: 2em;&amp;quot; | Dr Mark Bathe, CEHS&lt;br /&gt;
  |}&lt;br /&gt;
 |&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:&amp;quot;Dr Oligo&amp;quot; is the BioMicro Center oligo synthesizer optimized for high concentration. A 24 or 96 column plate can be loaded on the synthesizer--it is recommended to duplicate oligo sequences and not necessarily use dummy columns since oligo synthesis can fail for some columns during polyamidite synthesis.  This synthesis adds 3&#039; to 5&#039;, and each subsequent base addition reduces yield. Synthesis of oligos lower than 50 bp on this platform is typically short and high yield, oligos longer than 100 or 150 bp have a higher likelihood of failure. Post processing, size selection is recommended since shorter non-ideal oligos may also be eluted. &amp;lt;BR&amp;gt;&amp;lt;BR&amp;gt;&lt;br /&gt;
&lt;br /&gt;
:Users should plan synthesis in advance to coordinate usage with other users.&amp;lt;BR&amp;gt;&lt;br /&gt;
&amp;lt;br&amp;gt;&lt;br /&gt;
:::::::[[IMAGE:DrOligo.jpg | synth| 400px]] [[IMAGE:droligoprocess.jpg | process| 400px]] &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;  [[IMAGE:chamber.jpg | heat| 400px]]&lt;br /&gt;
 |&lt;br /&gt;
|}&lt;br /&gt;
--&amp;gt;&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131411</id>
		<title>MIT:Pricing</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131411"/>
		<updated>2026-04-27T17:27:20Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* OTHER LAB SERVICES */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&#039;&#039;&#039;PRICING UPDATE 7/1/2025&#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - HIGH OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== NOVASEQX / NOVASEQ6000 SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! NOVASEQ SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 150PE Lane^^ || $1,850 || $2,000 || rowspan=&amp;quot;2&amp;quot; | Per Lane || rowspan=&amp;quot;5&amp;quot; | Through collaboration with nearby academic shared resources&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 150PE Lane^^ || $2,600 || $2,860&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 300nt^^ || $12,160 || $13,376 || rowspan=&amp;quot;3&amp;quot; | Per Flowcell&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 300nt^^ || $16,200 || $17,820&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 100nt^^ || $5,750 || $6,325&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - MID OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Element_Sequencing ELEMENT AVITI24] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ELEMENT AVITI SEQUENCING !! Lane/Flowcell !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 75 PE || Full flowcell (2 lane, 800m read) || $1,900 || $2,090 || per flowcell || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| One lane (~400m read) || $1,000 || $1,100 || per lane&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 150 PE || Full flowcell (2 lane, ~800m read) || $2,650 || $2,915 || per flowcell&lt;br /&gt;
|-&lt;br /&gt;
| One lane (~400m read) || $1,375 || $1,513 || per lane&lt;br /&gt;
|-&lt;br /&gt;
| 300 PE || Full flowcell (~200m reads) || $3,500 || $3,850 || per lane&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - LOW OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Singular_Sequencing#Requirements%2FThings_to_Consider SINGULAR G4] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SINGULAR G4 SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 50 PE: F3 Lane (~100m reads) || $300 || $330 || per lane || rowspan=&amp;quot;3&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| Rapid 300nt: F3 flowcell (~400m reads)* || $1,800 || $1,980 || per flowcell&lt;br /&gt;
|-&lt;br /&gt;
| 150 PE: F3 Lane (~100m reads) || $450 || $495 || per lane&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
* Rapid flowcells are required for adapted Illumina libraries.&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== MISEQ SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Assisted ====&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Length !! Reads !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || rowspan=&amp;quot;2&amp;quot; | 5M || $715 || $786.50 || rowspan=&amp;quot;9&amp;quot; | per kit || rowspan=&amp;quot;9&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $1,040 || $1,144&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;4&amp;quot; | 25M || $925 || $1,017.50&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $1,334 || $1,467.40&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $1,570 || $1,727&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;1000nt&#039;&#039;&#039; || $2,590 || $2,849&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;2&amp;quot; | 100M || $1,540 || $1,694&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $2,125 || $2,337.50&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || 50M || $2,125 || $2,337.50&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Walkup ====&lt;br /&gt;
Training and lab storage on BMC servers required. Run must be scheduled in the [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar.]&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Length !! Reads !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! RunTime !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Machine usage || — || $120 || $132 || per run || — || training and lab storage on BMC servers required.&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || rowspan=&amp;quot;2&amp;quot; | 5M || $381 || $419.10 || rowspan=&amp;quot;9&amp;quot; | per kit || 8h || rowspan=&amp;quot;9&amp;quot; |&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $665 || $731.50 || 16h&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;4&amp;quot; | 25M || $565 || $621.50 || 5h&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $920 || $1,012 || 8h&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $1,125 || $1,238 || 16h&lt;br /&gt;
|-&lt;br /&gt;
| 1000nt || $1,921 || $2,113.10 || 24h&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;2&amp;quot; | 100M || $1,130 || $1,243 || 5h&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $1,638.50 || $1,802.35 || 8h&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || 50M || $1,638.50 || $1,802.35 || 16h&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq classic ====&lt;br /&gt;
&lt;br /&gt;
* MiSeq is off contract and will be retired upon instrument failure&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Length !! Reads !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 70nt || 15M || $1,320 || $1,452 || rowspan=&amp;quot;6&amp;quot; | per kit || rowspan=&amp;quot;6&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| 150nt || 25M || $1,430 || $1,573&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || 15M || $1,595 || $1,754.50&lt;br /&gt;
|-&lt;br /&gt;
| 500nt || 15M || $1,760 || $1,936&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || 25M || $2,200 || $2,420&lt;br /&gt;
|-&lt;br /&gt;
| 500nt || 1M &amp;amp;nbsp;&#039;&#039;&#039;NANO&#039;&#039;&#039; || $770 || $847&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OTHER SHORT READ SERVICES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SHORT READ SUPPORTING SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Quality Control Only -only one QC is included per sequencing lane. || $35 || $38.50 || per sample || Includes RT-PCR and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Quality Control - Use SYBR for sample quantification for pooling instead of qPCR. Only available for pooling. || $15 || $16.50 || per sample || Includes Fluorometric quantification and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (short read) || $25 || $27.50 || per sample || Includes qPCR values from standard QC only&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only - full plate(short read) || $400 || $440 || per plate || excludes column 1 (used for controls)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LONG READ SEQUENCING ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PROMETHION SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $1,200 || $1,320 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PACBIO REVIO SEQUENCING^^ !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| SMRT Cell || $2,900 || $3,190 || per SMRT Cell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== LIBRARY GENERATION ==&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - DNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! colspan=&amp;quot;3&amp;quot; | ILLUMINA Sample Preparation !! colspan=&amp;quot;3&amp;quot; style=&amp;quot;color:blue;&amp;quot; | &amp;amp;nbsp;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;STANDARD THROUGHPUT DNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for individual samples. Repreps will typically be attempted on failed samples without charge. || colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center; color:blue;&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT DNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for sample batches. Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included.&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | LIGATION BASED NEB UltraII || STD || per sample || $105 || $115 || Includes QC, adapter ligation, size selection, barcoding, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 24 || style=&amp;quot;color:blue;&amp;quot; | $900 || style=&amp;quot;color:blue;&amp;quot; | $990 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes adapter ligation, size selection, barcoding, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 96 || style=&amp;quot;color:blue;&amp;quot; | $1,800 || style=&amp;quot;color:blue;&amp;quot; | $1,980&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation &amp;amp;nbsp;&amp;amp;nbsp;NEXTERA-XT || rowspan=&amp;quot;2&amp;quot; | STD || rowspan=&amp;quot;2&amp;quot; | per Sample || $105 || $115 || rowspan=&amp;quot;2&amp;quot; | Includes set-up, tagmentation, indexing, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation &amp;amp;nbsp;&amp;amp;nbsp;NEXTERA-FLEX || $157 || $173&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | NEXTERA-XT OR FLEX || style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $900 || style=&amp;quot;color:blue;&amp;quot; | $990 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes tagmentation, indexing, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,800 || style=&amp;quot;color:blue;&amp;quot; | $1,980&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 16S Amplicon || style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 48 || style=&amp;quot;color:blue;&amp;quot; | $1,900 || style=&amp;quot;color:blue;&amp;quot; | $2,090 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes normalization, enrichment, pooling and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | add&#039;l 48 || style=&amp;quot;color:blue;&amp;quot; | $650 || style=&amp;quot;color:blue;&amp;quot; | $715&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Other Amplicon || style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 48 || style=&amp;quot;color:blue;&amp;quot; | $1,600 || style=&amp;quot;color:blue;&amp;quot; | $1,760 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes normalization, enrichment, pooling and quality control (SYBR and FA). &amp;amp;nbsp;&amp;amp;nbsp;Samples *must* be submitted amplified with appropriate linkers.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | add&#039;l 48 || style=&amp;quot;color:blue;&amp;quot; | $630 || style=&amp;quot;color:blue;&amp;quot; | $693&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Samples not in proper input format will be subject to these additional charges.&lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || || 48 samples || $60 || $66 ||&lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || || per sample || $5 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || || per sample || $10 || $11 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - RNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! colspan=&amp;quot;3&amp;quot; | ILLUMINA Sample Preparation !! colspan=&amp;quot;3&amp;quot; style=&amp;quot;color:blue;&amp;quot; | &amp;amp;nbsp;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;STANDARD RNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for individual samples. Repreps will typically be attempted on failed samples without charge. || colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center; color:blue;&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT RNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. Mixing of multiple projects not recommended.&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | polyA based isolation &amp;amp;nbsp;&amp;amp;nbsp;NEB UltraII RNAseq || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $157 || $173 || Includes QC, polyA isolation, generation of cDNA, library construction, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,500 || style=&amp;quot;color:blue;&amp;quot; | $1,650 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,000 || style=&amp;quot;color:blue;&amp;quot; | $3,300&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | High Throughput 3&#039; Digital Gene Expression (HT3DGE) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,050 || style=&amp;quot;color:blue;&amp;quot; | $1,155 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes generation of cDNA, library construction, indexing and library quality control. Does not include sample QC.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,100 || style=&amp;quot;color:blue;&amp;quot; | $2,310&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Total RNA sequencing &amp;amp;nbsp;&amp;amp;nbsp;NEB RNAseq +Ribodepletion || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $235 || $258.50 || Includes sample QC, ribosomal depletion, generation of cDNA, library construction, indexing and library quality control.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,500 || style=&amp;quot;color:blue;&amp;quot; | $2,750 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $5,000 || style=&amp;quot;color:blue;&amp;quot; | $5,500&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Low Input polyA+ &amp;amp;nbsp;&amp;amp;nbsp;Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;STD&#039;&#039;&#039; v4 || per sample || $262 || $289 || rowspan=&amp;quot;3&amp;quot; | Includes generation of cDNA, amplification, library construction, indexing and quality control (SYBR + FA). Single sample includes initial QC.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,000 || style=&amp;quot;color:blue;&amp;quot; | $2,200&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,200 || style=&amp;quot;color:blue;&amp;quot; | $3,520&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Low Input Mammalian Total &amp;amp;nbsp;&amp;amp;nbsp;Clontech ZapR Kit || STD || per sample || $210 || $231 || Includes generation of cDNA, amplification, library construction, rRNA degradation, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,000 || style=&amp;quot;color:blue;&amp;quot; | $3,300 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $5,000 || style=&amp;quot;color:blue;&amp;quot; | $5,500&lt;br /&gt;
|-&lt;br /&gt;
| Small RNA || STD || per sample || $289 || $318 || Uses NEB, BIOO or QIAGEN small RNA kit&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Samples not in proper input format will be subject to these additional charges.&lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || || 48 samples || $60 || $66 ||&lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || || per sample || $5 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || || per sample || $10 || $11 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
=== LONG READ LIBRARIES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Oxford Nanopore Sample Preparation !! Nanopore Kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit&lt;br /&gt;
|-&lt;br /&gt;
| Standard Ligation || LSK || $160 || $176 || per sample/pool&lt;br /&gt;
|-&lt;br /&gt;
| Native Barcoding &amp;amp;nbsp;&amp;amp;nbsp;(ligation indexing) || - || $50 || $55 || rowspan=&amp;quot;5&amp;quot; | per sample&lt;br /&gt;
|-&lt;br /&gt;
| SMARTseq -&amp;gt; Ligation || Cv4+LSK || $300 || $330&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Prep (tagment - ~10-20kb) || RAD || $150 || $165&lt;br /&gt;
|-&lt;br /&gt;
| Long Insert Prep || RAD (modified, target &amp;gt;100kb) || $262 || $289&lt;br /&gt;
|-&lt;br /&gt;
| Direct RNA || RNA004 || $160 || $176&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PacBio Sample Preparation !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Basic Library || $315 || $346 || Per Library&lt;br /&gt;
|-&lt;br /&gt;
| $157 || $173 || Per add&#039;l Sample&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Genomic Library || $472 || $520 || Per Library&lt;br /&gt;
|-&lt;br /&gt;
| $235 || $258 || Per add&#039;l Sample&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SAMPLE EXTRACTION ==&lt;br /&gt;
&lt;br /&gt;
=== CHEMAGIC360 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! TYPE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| DNA || 96 || $700 || $770 &lt;br /&gt;
|-&lt;br /&gt;
| RNA || 96 || $800 || $880 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 12 samples || $300 || $330 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 96 samples || $1,000 || $1,100 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SINGLE CELL &amp;amp; SPATIAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== 10X CHROMIUM ===&lt;br /&gt;
&lt;br /&gt;
Please email biomicro@mit.edu two weeks prior to desired submission date so we will have reagents ready for you.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! 10X USAGE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Assisted Service&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;DIGITAL GENE EXPRESSION&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 5&#039; RNA &amp;amp;nbsp;&amp;amp;nbsp;3&#039; RNA || setup || $1,015 || $1,116.50 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $1,750 || $1,925 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 5&#039; RNA &amp;amp;nbsp;&amp;amp;nbsp;3&#039; RNA - on chip multiplexing || setup || $1,150 || $1,265 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per 4 samples || $2,305 || $2,535 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Fixed RNA (Flex v2) &amp;amp;nbsp;&amp;amp;nbsp;probe based. human/mouse only || setup || $2,700 || $2,970 || charge per submission - up to 48 samples&lt;br /&gt;
|-&lt;br /&gt;
| per sample (1-plex) || $270 || $297 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Amplicon (CITE-SEQ, TCR, BCR, antibody barcode, etc // per amplicon) || setup || $470 || $517 || additional prep beyond DGE&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $45 || $50 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;scATACseq&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | ATACseq || setup || $880 || $968 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $1,675 || $1,843 || Includes QC and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;Multiome (ATAC+3&#039;RNA)&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | MULTI || setup || $1,800 || $1,980 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $3,100 || $3,410 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;CANCELLATION&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| per session ||  || $200 || $220 || &amp;lt;24h notice&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=== VISIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SLIDES !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| HD: polyA or FFPE (hs/mm only) || 1 slide / 2 tiles || $7,850 || $8,596 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| QC - FFPE Scroll || per scroll || $60 || $66 || RNA isolation from FFPE scroll&lt;br /&gt;
|-&lt;br /&gt;
| QC - Fresh Frozen Scroll || per scroll || $40 || $44 || RNA isolation from FF scroll&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== AVITI24 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! AVITI24 SPATIAL !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Slide Only || rowspan=&amp;quot;5&amp;quot; | per slide || $150 || $165 || slide: 1, 12, or 48 well&lt;br /&gt;
|-&lt;br /&gt;
| Optimization Only || $800 || $880 || used when the run fails&lt;br /&gt;
|-&lt;br /&gt;
| [https://www.elementbiosciences.com/products/aviti24/cytoprofiling Teton Defined Panel] || $7,200 || $7,920 || scroll to predefined panels&lt;br /&gt;
|-&lt;br /&gt;
| Atlas Short || $5,500 || $6,050 || for CRISPR screens / short sequencing&lt;br /&gt;
|-&lt;br /&gt;
| [https://www.elementbiosciences.com/products/aviti24/cytoprofiling Antibody Add-on] || $360 || $396 || scroll to flexible protein customization&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== OTHER GENOMICS SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== [[BioMicroCenter:QC|QUALITY CONTROL]] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! QUALITY CONTROL !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: RNA or DNA || per sample || $15 || $16.50 ||&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: Preloaded row || per row (12) || $80 || $88 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: RNA or DNA || per sample || $30 || $33 ||&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: Preloaded Row || per row (12) || $160 || $176 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| BioAnalyzer: Walkup Service || per chip || $50 || $55 ||&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (Short read quantification test) || per sample || $25 || $27.50 || 4 point serial dilution&lt;br /&gt;
|-&lt;br /&gt;
| Full plate qPCR (short read quantification test) || per plate || $400 || $440 || full plate only (exclude column 1 for standards) - must be to BMC specifications.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Sample QC services:&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Fresh Frozen Curl || per curl || $40 || $44 ||&lt;br /&gt;
|-&lt;br /&gt;
| FFPE Curl || per curl || $60 || $66 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OLIGO SYNTHESIS ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Platform !! Service !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;6&amp;quot; | DNAscript Syntax || Setup (per run) || $1,000 || $1,100 || Per run cost&lt;br /&gt;
|-&lt;br /&gt;
| 2000 nucleotide synthesis || $500 || $550 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
| 8000 nucleotide synthesis || $1,500 || $1,650 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
| add Biotin (max48) || $115 || $126 || max 48 per run and 2 per oligo. Couple to T only.&lt;br /&gt;
|-&lt;br /&gt;
| add Fluor || $300 || $330 ||&lt;br /&gt;
|-&lt;br /&gt;
| add quench || $100 || $110 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== [[BioMicroCenter:RTPCR|REAL TIME PCR]] ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Roche LightCycler 480 || $15 || per plate || [https://mit.ilabsolutions.com/schedules/261680#/schedule/ CALENDAR] *available for CORE only || Email biomicro@mit.edu for training&lt;br /&gt;
|-&lt;br /&gt;
| SYBR Green (KAPA/Roche) || $45 || per ml ||  || Available for MIT only&lt;br /&gt;
|-&lt;br /&gt;
| 96-well PLATES || $10 || per plate ||  || Available for MIT only&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
== OTHER LAB SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;COVARIS SONICATOR&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| COVARIS E220 || $20 || per hour || [https://mit.ilabsolutions.com/equipment/261752/?tab=schedule ilab calendar] || tubes available for purchase.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PIPPIN PREP&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Gel Isolation || $75 || per gel (5 lanes) || TBA ||&lt;br /&gt;
|-&lt;br /&gt;
| Training || $25 || per session || TBA || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PLATE READER&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Varioskan || $18 || per hour || [https://mit.ilabsolutions.com/schedules/262715#/schedule/ CALENDAR] || Email biomicro@mit.edu for training&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;ROBOTICS&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Tecan EVO 150 || $75 || per 1h block - based on scheduled time. || [https://mit.ilabsolutions.com/schedules/262347#/schedule/ CALENDAR] ||&lt;br /&gt;
|-&lt;br /&gt;
| non-filter tips || $8 || per box ||  || ** Please let us know if there is additional plasticware you would like us to stock.&lt;br /&gt;
|-&lt;br /&gt;
| Filter tips || $12.00 || per box ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| Training || $65 || per hour || Email biomicro@mit.edu ||&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;NANODROP&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Nanodrop || -- ||  || Walk up service || * no charge&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== COMPUTATIONAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! COMPUTATIONAL SERVICES !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! Other MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Support || per hour || $90 || $125 || Very limited support for non-MIT users&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Share || per 0.1FTE || $1,250 || N/A || MIT only. Priority access to informatics.&lt;br /&gt;
|-&lt;br /&gt;
| Ingenuity Pathway Analysis || per dataset || $100 || $110 || Recovery of licence cost.&lt;br /&gt;
|-&lt;br /&gt;
| Active Data storage || per TB per year || $100 || $300 ||&lt;br /&gt;
|-&lt;br /&gt;
| Tape Archive / Recovery || per tape || $60 || $70 ||&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Training Classes || per session || $50 || $100 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
OLD&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2025 | FY2025 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023b | FY2023-Feb Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023 | FY2023 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2022 | FY2022 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2021 | FY2021 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2019 | FY2019 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2017 | FY2017 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2016 | FY2016 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2015 | FY2015 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2014 | FY2014 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2013 | FY2013 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2012 | FY2012 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2011 | FY2011 Pricing]]&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131410</id>
		<title>MIT:Pricing</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131410"/>
		<updated>2026-04-27T17:12:46Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* OTHER LAB SERVICES */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&#039;&#039;&#039;PRICING UPDATE 7/1/2025&#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - HIGH OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== NOVASEQX / NOVASEQ6000 SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! NOVASEQ SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 150PE Lane^^ || $1,850 || $2,000 || rowspan=&amp;quot;2&amp;quot; | Per Lane || rowspan=&amp;quot;5&amp;quot; | Through collaboration with nearby academic shared resources&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 150PE Lane^^ || $2,600 || $2,860&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 300nt^^ || $12,160 || $13,376 || rowspan=&amp;quot;3&amp;quot; | Per Flowcell&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 300nt^^ || $16,200 || $17,820&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 100nt^^ || $5,750 || $6,325&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - MID OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Element_Sequencing ELEMENT AVITI24] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ELEMENT AVITI SEQUENCING !! Lane/Flowcell !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 75 PE || Full flowcell (2 lane, 800m read) || $1,900 || $2,090 || per flowcell || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| One lane (~400m read) || $1,000 || $1,100 || per lane&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 150 PE || Full flowcell (2 lane, ~800m read) || $2,650 || $2,915 || per flowcell&lt;br /&gt;
|-&lt;br /&gt;
| One lane (~400m read) || $1,375 || $1,513 || per lane&lt;br /&gt;
|-&lt;br /&gt;
| 300 PE || Full flowcell (~200m reads) || $3,500 || $3,850 || per lane&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - LOW OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Singular_Sequencing#Requirements%2FThings_to_Consider SINGULAR G4] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SINGULAR G4 SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 50 PE: F3 Lane (~100m reads) || $300 || $330 || per lane || rowspan=&amp;quot;3&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| Rapid 300nt: F3 flowcell (~400m reads)* || $1,800 || $1,980 || per flowcell&lt;br /&gt;
|-&lt;br /&gt;
| 150 PE: F3 Lane (~100m reads) || $450 || $495 || per lane&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
* Rapid flowcells are required for adapted Illumina libraries.&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== MISEQ SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Assisted ====&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Length !! Reads !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || rowspan=&amp;quot;2&amp;quot; | 5M || $715 || $786.50 || rowspan=&amp;quot;9&amp;quot; | per kit || rowspan=&amp;quot;9&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $1,040 || $1,144&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;4&amp;quot; | 25M || $925 || $1,017.50&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $1,334 || $1,467.40&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $1,570 || $1,727&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;1000nt&#039;&#039;&#039; || $2,590 || $2,849&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;2&amp;quot; | 100M || $1,540 || $1,694&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $2,125 || $2,337.50&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || 50M || $2,125 || $2,337.50&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Walkup ====&lt;br /&gt;
Training and lab storage on BMC servers required. Run must be scheduled in the [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar.]&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Length !! Reads !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! RunTime !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Machine usage || — || $120 || $132 || per run || — || training and lab storage on BMC servers required.&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || rowspan=&amp;quot;2&amp;quot; | 5M || $381 || $419.10 || rowspan=&amp;quot;9&amp;quot; | per kit || 8h || rowspan=&amp;quot;9&amp;quot; |&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $665 || $731.50 || 16h&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;4&amp;quot; | 25M || $565 || $621.50 || 5h&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $920 || $1,012 || 8h&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $1,125 || $1,238 || 16h&lt;br /&gt;
|-&lt;br /&gt;
| 1000nt || $1,921 || $2,113.10 || 24h&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;2&amp;quot; | 100M || $1,130 || $1,243 || 5h&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $1,638.50 || $1,802.35 || 8h&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || 50M || $1,638.50 || $1,802.35 || 16h&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq classic ====&lt;br /&gt;
&lt;br /&gt;
* MiSeq is off contract and will be retired upon instrument failure&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Length !! Reads !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 70nt || 15M || $1,320 || $1,452 || rowspan=&amp;quot;6&amp;quot; | per kit || rowspan=&amp;quot;6&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| 150nt || 25M || $1,430 || $1,573&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || 15M || $1,595 || $1,754.50&lt;br /&gt;
|-&lt;br /&gt;
| 500nt || 15M || $1,760 || $1,936&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || 25M || $2,200 || $2,420&lt;br /&gt;
|-&lt;br /&gt;
| 500nt || 1M &amp;amp;nbsp;&#039;&#039;&#039;NANO&#039;&#039;&#039; || $770 || $847&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OTHER SHORT READ SERVICES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SHORT READ SUPPORTING SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Quality Control Only -only one QC is included per sequencing lane. || $35 || $38.50 || per sample || Includes RT-PCR and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Quality Control - Use SYBR for sample quantification for pooling instead of qPCR. Only available for pooling. || $15 || $16.50 || per sample || Includes Fluorometric quantification and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (short read) || $25 || $27.50 || per sample || Includes qPCR values from standard QC only&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only - full plate(short read) || $400 || $440 || per plate || excludes column 1 (used for controls)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LONG READ SEQUENCING ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PROMETHION SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $1,200 || $1,320 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PACBIO REVIO SEQUENCING^^ !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| SMRT Cell || $2,900 || $3,190 || per SMRT Cell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== LIBRARY GENERATION ==&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - DNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! colspan=&amp;quot;3&amp;quot; | ILLUMINA Sample Preparation !! colspan=&amp;quot;3&amp;quot; style=&amp;quot;color:blue;&amp;quot; | &amp;amp;nbsp;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;STANDARD THROUGHPUT DNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for individual samples. Repreps will typically be attempted on failed samples without charge. || colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center; color:blue;&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT DNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for sample batches. Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included.&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | LIGATION BASED NEB UltraII || STD || per sample || $105 || $115 || Includes QC, adapter ligation, size selection, barcoding, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 24 || style=&amp;quot;color:blue;&amp;quot; | $900 || style=&amp;quot;color:blue;&amp;quot; | $990 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes adapter ligation, size selection, barcoding, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 96 || style=&amp;quot;color:blue;&amp;quot; | $1,800 || style=&amp;quot;color:blue;&amp;quot; | $1,980&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation &amp;amp;nbsp;&amp;amp;nbsp;NEXTERA-XT || rowspan=&amp;quot;2&amp;quot; | STD || rowspan=&amp;quot;2&amp;quot; | per Sample || $105 || $115 || rowspan=&amp;quot;2&amp;quot; | Includes set-up, tagmentation, indexing, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation &amp;amp;nbsp;&amp;amp;nbsp;NEXTERA-FLEX || $157 || $173&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | NEXTERA-XT OR FLEX || style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $900 || style=&amp;quot;color:blue;&amp;quot; | $990 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes tagmentation, indexing, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,800 || style=&amp;quot;color:blue;&amp;quot; | $1,980&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 16S Amplicon || style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 48 || style=&amp;quot;color:blue;&amp;quot; | $1,900 || style=&amp;quot;color:blue;&amp;quot; | $2,090 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes normalization, enrichment, pooling and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | add&#039;l 48 || style=&amp;quot;color:blue;&amp;quot; | $650 || style=&amp;quot;color:blue;&amp;quot; | $715&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Other Amplicon || style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 48 || style=&amp;quot;color:blue;&amp;quot; | $1,600 || style=&amp;quot;color:blue;&amp;quot; | $1,760 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes normalization, enrichment, pooling and quality control (SYBR and FA). &amp;amp;nbsp;&amp;amp;nbsp;Samples *must* be submitted amplified with appropriate linkers.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | add&#039;l 48 || style=&amp;quot;color:blue;&amp;quot; | $630 || style=&amp;quot;color:blue;&amp;quot; | $693&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Samples not in proper input format will be subject to these additional charges.&lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || || 48 samples || $60 || $66 ||&lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || || per sample || $5 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || || per sample || $10 || $11 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - RNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! colspan=&amp;quot;3&amp;quot; | ILLUMINA Sample Preparation !! colspan=&amp;quot;3&amp;quot; style=&amp;quot;color:blue;&amp;quot; | &amp;amp;nbsp;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;STANDARD RNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for individual samples. Repreps will typically be attempted on failed samples without charge. || colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center; color:blue;&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT RNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. Mixing of multiple projects not recommended.&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | polyA based isolation &amp;amp;nbsp;&amp;amp;nbsp;NEB UltraII RNAseq || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $157 || $173 || Includes QC, polyA isolation, generation of cDNA, library construction, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,500 || style=&amp;quot;color:blue;&amp;quot; | $1,650 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,000 || style=&amp;quot;color:blue;&amp;quot; | $3,300&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | High Throughput 3&#039; Digital Gene Expression (HT3DGE) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,050 || style=&amp;quot;color:blue;&amp;quot; | $1,155 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes generation of cDNA, library construction, indexing and library quality control. Does not include sample QC.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,100 || style=&amp;quot;color:blue;&amp;quot; | $2,310&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Total RNA sequencing &amp;amp;nbsp;&amp;amp;nbsp;NEB RNAseq +Ribodepletion || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $235 || $258.50 || Includes sample QC, ribosomal depletion, generation of cDNA, library construction, indexing and library quality control.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,500 || style=&amp;quot;color:blue;&amp;quot; | $2,750 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $5,000 || style=&amp;quot;color:blue;&amp;quot; | $5,500&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Low Input polyA+ &amp;amp;nbsp;&amp;amp;nbsp;Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;STD&#039;&#039;&#039; v4 || per sample || $262 || $289 || rowspan=&amp;quot;3&amp;quot; | Includes generation of cDNA, amplification, library construction, indexing and quality control (SYBR + FA). Single sample includes initial QC.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,000 || style=&amp;quot;color:blue;&amp;quot; | $2,200&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,200 || style=&amp;quot;color:blue;&amp;quot; | $3,520&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Low Input Mammalian Total &amp;amp;nbsp;&amp;amp;nbsp;Clontech ZapR Kit || STD || per sample || $210 || $231 || Includes generation of cDNA, amplification, library construction, rRNA degradation, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,000 || style=&amp;quot;color:blue;&amp;quot; | $3,300 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $5,000 || style=&amp;quot;color:blue;&amp;quot; | $5,500&lt;br /&gt;
|-&lt;br /&gt;
| Small RNA || STD || per sample || $289 || $318 || Uses NEB, BIOO or QIAGEN small RNA kit&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Samples not in proper input format will be subject to these additional charges.&lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || || 48 samples || $60 || $66 ||&lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || || per sample || $5 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || || per sample || $10 || $11 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
=== LONG READ LIBRARIES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Oxford Nanopore Sample Preparation !! Nanopore Kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit&lt;br /&gt;
|-&lt;br /&gt;
| Standard Ligation || LSK || $160 || $176 || per sample/pool&lt;br /&gt;
|-&lt;br /&gt;
| Native Barcoding &amp;amp;nbsp;&amp;amp;nbsp;(ligation indexing) || - || $50 || $55 || rowspan=&amp;quot;5&amp;quot; | per sample&lt;br /&gt;
|-&lt;br /&gt;
| SMARTseq -&amp;gt; Ligation || Cv4+LSK || $300 || $330&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Prep (tagment - ~10-20kb) || RAD || $150 || $165&lt;br /&gt;
|-&lt;br /&gt;
| Long Insert Prep || RAD (modified, target &amp;gt;100kb) || $262 || $289&lt;br /&gt;
|-&lt;br /&gt;
| Direct RNA || RNA004 || $160 || $176&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PacBio Sample Preparation !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Basic Library || $315 || $346 || Per Library&lt;br /&gt;
|-&lt;br /&gt;
| $157 || $173 || Per add&#039;l Sample&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Genomic Library || $472 || $520 || Per Library&lt;br /&gt;
|-&lt;br /&gt;
| $235 || $258 || Per add&#039;l Sample&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SAMPLE EXTRACTION ==&lt;br /&gt;
&lt;br /&gt;
=== CHEMAGIC360 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! TYPE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| DNA || 96 || $700 || $770 &lt;br /&gt;
|-&lt;br /&gt;
| RNA || 96 || $800 || $880 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 12 samples || $300 || $330 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 96 samples || $1,000 || $1,100 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SINGLE CELL &amp;amp; SPATIAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== 10X CHROMIUM ===&lt;br /&gt;
&lt;br /&gt;
Please email biomicro@mit.edu two weeks prior to desired submission date so we will have reagents ready for you.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! 10X USAGE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Assisted Service&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;DIGITAL GENE EXPRESSION&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 5&#039; RNA &amp;amp;nbsp;&amp;amp;nbsp;3&#039; RNA || setup || $1,015 || $1,116.50 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $1,750 || $1,925 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 5&#039; RNA &amp;amp;nbsp;&amp;amp;nbsp;3&#039; RNA - on chip multiplexing || setup || $1,150 || $1,265 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per 4 samples || $2,305 || $2,535 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Fixed RNA (Flex v2) &amp;amp;nbsp;&amp;amp;nbsp;probe based. human/mouse only || setup || $2,700 || $2,970 || charge per submission - up to 48 samples&lt;br /&gt;
|-&lt;br /&gt;
| per sample (1-plex) || $270 || $297 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Amplicon (CITE-SEQ, TCR, BCR, antibody barcode, etc // per amplicon) || setup || $470 || $517 || additional prep beyond DGE&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $45 || $50 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;scATACseq&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | ATACseq || setup || $880 || $968 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $1,675 || $1,843 || Includes QC and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;Multiome (ATAC+3&#039;RNA)&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | MULTI || setup || $1,800 || $1,980 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $3,100 || $3,410 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;CANCELLATION&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| per session ||  || $200 || $220 || &amp;lt;24h notice&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=== VISIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SLIDES !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| HD: polyA or FFPE (hs/mm only) || 1 slide / 2 tiles || $7,850 || $8,596 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| QC - FFPE Scroll || per scroll || $60 || $66 || RNA isolation from FFPE scroll&lt;br /&gt;
|-&lt;br /&gt;
| QC - Fresh Frozen Scroll || per scroll || $40 || $44 || RNA isolation from FF scroll&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== AVITI24 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! AVITI24 SPATIAL !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Slide Only || rowspan=&amp;quot;5&amp;quot; | per slide || $150 || $165 || slide: 1, 12, or 48 well&lt;br /&gt;
|-&lt;br /&gt;
| Optimization Only || $800 || $880 || used when the run fails&lt;br /&gt;
|-&lt;br /&gt;
| [https://www.elementbiosciences.com/products/aviti24/cytoprofiling Teton Defined Panel] || $7,200 || $7,920 || scroll to predefined panels&lt;br /&gt;
|-&lt;br /&gt;
| Atlas Short || $5,500 || $6,050 || for CRISPR screens / short sequencing&lt;br /&gt;
|-&lt;br /&gt;
| [https://www.elementbiosciences.com/products/aviti24/cytoprofiling Antibody Add-on] || $360 || $396 || scroll to flexible protein customization&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== OTHER GENOMICS SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== [[BioMicroCenter:QC|QUALITY CONTROL]] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! QUALITY CONTROL !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: RNA or DNA || per sample || $15 || $16.50 ||&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: Preloaded row || per row (12) || $80 || $88 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: RNA or DNA || per sample || $30 || $33 ||&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: Preloaded Row || per row (12) || $160 || $176 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| BioAnalyzer: Walkup Service || per chip || $50 || $55 ||&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (Short read quantification test) || per sample || $25 || $27.50 || 4 point serial dilution&lt;br /&gt;
|-&lt;br /&gt;
| Full plate qPCR (short read quantification test) || per plate || $400 || $440 || full plate only (exclude column 1 for standards) - must be to BMC specifications.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Sample QC services:&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Fresh Frozen Curl || per curl || $40 || $44 ||&lt;br /&gt;
|-&lt;br /&gt;
| FFPE Curl || per curl || $60 || $66 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OLIGO SYNTHESIS ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Platform !! Service !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;6&amp;quot; | DNAscript Syntax || Setup (per run) || $1,000 || $1,100 || Per run cost&lt;br /&gt;
|-&lt;br /&gt;
| 2000 nucleotide synthesis || $500 || $550 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
| 8000 nucleotide synthesis || $1,500 || $1,650 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
| add Biotin (max48) || $115 || $126 || max 48 per run and 2 per oligo. Couple to T only.&lt;br /&gt;
|-&lt;br /&gt;
| add Fluor || $300 || $330 ||&lt;br /&gt;
|-&lt;br /&gt;
| add quench || $100 || $110 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== [[BioMicroCenter:RTPCR|REAL TIME PCR]] ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Roche LightCycler 480 || $15 || per plate || [https://mit.ilabsolutions.com/schedules/261680#/schedule/ CALENDAR] *available for CORE only || Email biomicro@mit.edu for training&lt;br /&gt;
|-&lt;br /&gt;
| SYBR Green (KAPA/Roche) || $45 || per ml ||  || Available for MIT only&lt;br /&gt;
|-&lt;br /&gt;
| 96-well PLATES || $10 || per plate ||  || Available for MIT only&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
== OTHER LAB SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;COVARIS SONICATOR&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| COVARIS E220 || $20 || per hour || [https://mit.ilabsolutions.com/equipment/261752/?tab=schedule ilab calendar] || tubes available for purchase.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PIPPIN PREP&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Gel Isolation || $75 || per gel (5 lanes) || TBA ||&lt;br /&gt;
|-&lt;br /&gt;
| Training || $25 || per session || TBA || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PLATE READER&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Varioskan || $18 || per hour || [https://mit.ilabsolutions.com/schedules/262715#/schedule/ CALENDAR] || Email biomicro@mit.edu for training&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;ROBOTICS&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Tecan EVO 150 || $75 || per 1h block - based on scheduled time. || [https://mit.ilabsolutions.com/schedules/262347#/schedule/ CALENDAR] ||&lt;br /&gt;
|-&lt;br /&gt;
| non-filter tips || $8 || per box ||  || ** Please let us know if there is additional plasticware you would like us to stock.&lt;br /&gt;
|-&lt;br /&gt;
| Filter tips || $12.00 || per box ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| Training || $65 || per hour || Contact [[BioMicroCenter:People|Tatum Murdock]] ||&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;NANODROP&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Nanodrop || -- ||  || Walk up service || * no charge&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== COMPUTATIONAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! COMPUTATIONAL SERVICES !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! Other MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Support || per hour || $90 || $125 || Very limited support for non-MIT users&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Share || per 0.1FTE || $1,250 || N/A || MIT only. Priority access to informatics.&lt;br /&gt;
|-&lt;br /&gt;
| Ingenuity Pathway Analysis || per dataset || $100 || $110 || Recovery of licence cost.&lt;br /&gt;
|-&lt;br /&gt;
| Active Data storage || per TB per year || $100 || $300 ||&lt;br /&gt;
|-&lt;br /&gt;
| Tape Archive / Recovery || per tape || $60 || $70 ||&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Training Classes || per session || $50 || $100 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
OLD&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2025 | FY2025 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023b | FY2023-Feb Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023 | FY2023 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2022 | FY2022 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2021 | FY2021 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2019 | FY2019 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2017 | FY2017 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2016 | FY2016 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2015 | FY2015 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2014 | FY2014 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2013 | FY2013 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2012 | FY2012 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2011 | FY2011 Pricing]]&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131409</id>
		<title>MIT:Pricing</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131409"/>
		<updated>2026-04-27T17:12:20Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* REAL TIME PCR */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&#039;&#039;&#039;PRICING UPDATE 7/1/2025&#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - HIGH OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== NOVASEQX / NOVASEQ6000 SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! NOVASEQ SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 150PE Lane^^ || $1,850 || $2,000 || rowspan=&amp;quot;2&amp;quot; | Per Lane || rowspan=&amp;quot;5&amp;quot; | Through collaboration with nearby academic shared resources&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 150PE Lane^^ || $2,600 || $2,860&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 300nt^^ || $12,160 || $13,376 || rowspan=&amp;quot;3&amp;quot; | Per Flowcell&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 300nt^^ || $16,200 || $17,820&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 100nt^^ || $5,750 || $6,325&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - MID OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Element_Sequencing ELEMENT AVITI24] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ELEMENT AVITI SEQUENCING !! Lane/Flowcell !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 75 PE || Full flowcell (2 lane, 800m read) || $1,900 || $2,090 || per flowcell || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| One lane (~400m read) || $1,000 || $1,100 || per lane&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 150 PE || Full flowcell (2 lane, ~800m read) || $2,650 || $2,915 || per flowcell&lt;br /&gt;
|-&lt;br /&gt;
| One lane (~400m read) || $1,375 || $1,513 || per lane&lt;br /&gt;
|-&lt;br /&gt;
| 300 PE || Full flowcell (~200m reads) || $3,500 || $3,850 || per lane&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - LOW OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Singular_Sequencing#Requirements%2FThings_to_Consider SINGULAR G4] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SINGULAR G4 SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 50 PE: F3 Lane (~100m reads) || $300 || $330 || per lane || rowspan=&amp;quot;3&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| Rapid 300nt: F3 flowcell (~400m reads)* || $1,800 || $1,980 || per flowcell&lt;br /&gt;
|-&lt;br /&gt;
| 150 PE: F3 Lane (~100m reads) || $450 || $495 || per lane&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
* Rapid flowcells are required for adapted Illumina libraries.&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== MISEQ SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Assisted ====&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Length !! Reads !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || rowspan=&amp;quot;2&amp;quot; | 5M || $715 || $786.50 || rowspan=&amp;quot;9&amp;quot; | per kit || rowspan=&amp;quot;9&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $1,040 || $1,144&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;4&amp;quot; | 25M || $925 || $1,017.50&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $1,334 || $1,467.40&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $1,570 || $1,727&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;1000nt&#039;&#039;&#039; || $2,590 || $2,849&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;2&amp;quot; | 100M || $1,540 || $1,694&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $2,125 || $2,337.50&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || 50M || $2,125 || $2,337.50&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Walkup ====&lt;br /&gt;
Training and lab storage on BMC servers required. Run must be scheduled in the [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar.]&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Length !! Reads !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! RunTime !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Machine usage || — || $120 || $132 || per run || — || training and lab storage on BMC servers required.&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || rowspan=&amp;quot;2&amp;quot; | 5M || $381 || $419.10 || rowspan=&amp;quot;9&amp;quot; | per kit || 8h || rowspan=&amp;quot;9&amp;quot; |&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $665 || $731.50 || 16h&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;4&amp;quot; | 25M || $565 || $621.50 || 5h&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $920 || $1,012 || 8h&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $1,125 || $1,238 || 16h&lt;br /&gt;
|-&lt;br /&gt;
| 1000nt || $1,921 || $2,113.10 || 24h&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;2&amp;quot; | 100M || $1,130 || $1,243 || 5h&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $1,638.50 || $1,802.35 || 8h&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || 50M || $1,638.50 || $1,802.35 || 16h&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq classic ====&lt;br /&gt;
&lt;br /&gt;
* MiSeq is off contract and will be retired upon instrument failure&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Length !! Reads !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 70nt || 15M || $1,320 || $1,452 || rowspan=&amp;quot;6&amp;quot; | per kit || rowspan=&amp;quot;6&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| 150nt || 25M || $1,430 || $1,573&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || 15M || $1,595 || $1,754.50&lt;br /&gt;
|-&lt;br /&gt;
| 500nt || 15M || $1,760 || $1,936&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || 25M || $2,200 || $2,420&lt;br /&gt;
|-&lt;br /&gt;
| 500nt || 1M &amp;amp;nbsp;&#039;&#039;&#039;NANO&#039;&#039;&#039; || $770 || $847&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OTHER SHORT READ SERVICES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SHORT READ SUPPORTING SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Quality Control Only -only one QC is included per sequencing lane. || $35 || $38.50 || per sample || Includes RT-PCR and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Quality Control - Use SYBR for sample quantification for pooling instead of qPCR. Only available for pooling. || $15 || $16.50 || per sample || Includes Fluorometric quantification and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (short read) || $25 || $27.50 || per sample || Includes qPCR values from standard QC only&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only - full plate(short read) || $400 || $440 || per plate || excludes column 1 (used for controls)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LONG READ SEQUENCING ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PROMETHION SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $1,200 || $1,320 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PACBIO REVIO SEQUENCING^^ !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| SMRT Cell || $2,900 || $3,190 || per SMRT Cell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== LIBRARY GENERATION ==&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - DNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! colspan=&amp;quot;3&amp;quot; | ILLUMINA Sample Preparation !! colspan=&amp;quot;3&amp;quot; style=&amp;quot;color:blue;&amp;quot; | &amp;amp;nbsp;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;STANDARD THROUGHPUT DNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for individual samples. Repreps will typically be attempted on failed samples without charge. || colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center; color:blue;&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT DNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for sample batches. Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included.&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | LIGATION BASED NEB UltraII || STD || per sample || $105 || $115 || Includes QC, adapter ligation, size selection, barcoding, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 24 || style=&amp;quot;color:blue;&amp;quot; | $900 || style=&amp;quot;color:blue;&amp;quot; | $990 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes adapter ligation, size selection, barcoding, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 96 || style=&amp;quot;color:blue;&amp;quot; | $1,800 || style=&amp;quot;color:blue;&amp;quot; | $1,980&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation &amp;amp;nbsp;&amp;amp;nbsp;NEXTERA-XT || rowspan=&amp;quot;2&amp;quot; | STD || rowspan=&amp;quot;2&amp;quot; | per Sample || $105 || $115 || rowspan=&amp;quot;2&amp;quot; | Includes set-up, tagmentation, indexing, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation &amp;amp;nbsp;&amp;amp;nbsp;NEXTERA-FLEX || $157 || $173&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | NEXTERA-XT OR FLEX || style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $900 || style=&amp;quot;color:blue;&amp;quot; | $990 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes tagmentation, indexing, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,800 || style=&amp;quot;color:blue;&amp;quot; | $1,980&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 16S Amplicon || style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 48 || style=&amp;quot;color:blue;&amp;quot; | $1,900 || style=&amp;quot;color:blue;&amp;quot; | $2,090 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes normalization, enrichment, pooling and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | add&#039;l 48 || style=&amp;quot;color:blue;&amp;quot; | $650 || style=&amp;quot;color:blue;&amp;quot; | $715&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Other Amplicon || style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 48 || style=&amp;quot;color:blue;&amp;quot; | $1,600 || style=&amp;quot;color:blue;&amp;quot; | $1,760 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes normalization, enrichment, pooling and quality control (SYBR and FA). &amp;amp;nbsp;&amp;amp;nbsp;Samples *must* be submitted amplified with appropriate linkers.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | add&#039;l 48 || style=&amp;quot;color:blue;&amp;quot; | $630 || style=&amp;quot;color:blue;&amp;quot; | $693&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Samples not in proper input format will be subject to these additional charges.&lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || || 48 samples || $60 || $66 ||&lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || || per sample || $5 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || || per sample || $10 || $11 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - RNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! colspan=&amp;quot;3&amp;quot; | ILLUMINA Sample Preparation !! colspan=&amp;quot;3&amp;quot; style=&amp;quot;color:blue;&amp;quot; | &amp;amp;nbsp;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;STANDARD RNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for individual samples. Repreps will typically be attempted on failed samples without charge. || colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center; color:blue;&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT RNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. Mixing of multiple projects not recommended.&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | polyA based isolation &amp;amp;nbsp;&amp;amp;nbsp;NEB UltraII RNAseq || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $157 || $173 || Includes QC, polyA isolation, generation of cDNA, library construction, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,500 || style=&amp;quot;color:blue;&amp;quot; | $1,650 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,000 || style=&amp;quot;color:blue;&amp;quot; | $3,300&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | High Throughput 3&#039; Digital Gene Expression (HT3DGE) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,050 || style=&amp;quot;color:blue;&amp;quot; | $1,155 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes generation of cDNA, library construction, indexing and library quality control. Does not include sample QC.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,100 || style=&amp;quot;color:blue;&amp;quot; | $2,310&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Total RNA sequencing &amp;amp;nbsp;&amp;amp;nbsp;NEB RNAseq +Ribodepletion || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $235 || $258.50 || Includes sample QC, ribosomal depletion, generation of cDNA, library construction, indexing and library quality control.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,500 || style=&amp;quot;color:blue;&amp;quot; | $2,750 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $5,000 || style=&amp;quot;color:blue;&amp;quot; | $5,500&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Low Input polyA+ &amp;amp;nbsp;&amp;amp;nbsp;Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;STD&#039;&#039;&#039; v4 || per sample || $262 || $289 || rowspan=&amp;quot;3&amp;quot; | Includes generation of cDNA, amplification, library construction, indexing and quality control (SYBR + FA). Single sample includes initial QC.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,000 || style=&amp;quot;color:blue;&amp;quot; | $2,200&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,200 || style=&amp;quot;color:blue;&amp;quot; | $3,520&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Low Input Mammalian Total &amp;amp;nbsp;&amp;amp;nbsp;Clontech ZapR Kit || STD || per sample || $210 || $231 || Includes generation of cDNA, amplification, library construction, rRNA degradation, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,000 || style=&amp;quot;color:blue;&amp;quot; | $3,300 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $5,000 || style=&amp;quot;color:blue;&amp;quot; | $5,500&lt;br /&gt;
|-&lt;br /&gt;
| Small RNA || STD || per sample || $289 || $318 || Uses NEB, BIOO or QIAGEN small RNA kit&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Samples not in proper input format will be subject to these additional charges.&lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || || 48 samples || $60 || $66 ||&lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || || per sample || $5 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || || per sample || $10 || $11 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
=== LONG READ LIBRARIES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Oxford Nanopore Sample Preparation !! Nanopore Kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit&lt;br /&gt;
|-&lt;br /&gt;
| Standard Ligation || LSK || $160 || $176 || per sample/pool&lt;br /&gt;
|-&lt;br /&gt;
| Native Barcoding &amp;amp;nbsp;&amp;amp;nbsp;(ligation indexing) || - || $50 || $55 || rowspan=&amp;quot;5&amp;quot; | per sample&lt;br /&gt;
|-&lt;br /&gt;
| SMARTseq -&amp;gt; Ligation || Cv4+LSK || $300 || $330&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Prep (tagment - ~10-20kb) || RAD || $150 || $165&lt;br /&gt;
|-&lt;br /&gt;
| Long Insert Prep || RAD (modified, target &amp;gt;100kb) || $262 || $289&lt;br /&gt;
|-&lt;br /&gt;
| Direct RNA || RNA004 || $160 || $176&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PacBio Sample Preparation !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Basic Library || $315 || $346 || Per Library&lt;br /&gt;
|-&lt;br /&gt;
| $157 || $173 || Per add&#039;l Sample&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Genomic Library || $472 || $520 || Per Library&lt;br /&gt;
|-&lt;br /&gt;
| $235 || $258 || Per add&#039;l Sample&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SAMPLE EXTRACTION ==&lt;br /&gt;
&lt;br /&gt;
=== CHEMAGIC360 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! TYPE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| DNA || 96 || $700 || $770 &lt;br /&gt;
|-&lt;br /&gt;
| RNA || 96 || $800 || $880 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 12 samples || $300 || $330 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 96 samples || $1,000 || $1,100 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SINGLE CELL &amp;amp; SPATIAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== 10X CHROMIUM ===&lt;br /&gt;
&lt;br /&gt;
Please email biomicro@mit.edu two weeks prior to desired submission date so we will have reagents ready for you.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! 10X USAGE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Assisted Service&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;DIGITAL GENE EXPRESSION&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 5&#039; RNA &amp;amp;nbsp;&amp;amp;nbsp;3&#039; RNA || setup || $1,015 || $1,116.50 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $1,750 || $1,925 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 5&#039; RNA &amp;amp;nbsp;&amp;amp;nbsp;3&#039; RNA - on chip multiplexing || setup || $1,150 || $1,265 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per 4 samples || $2,305 || $2,535 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Fixed RNA (Flex v2) &amp;amp;nbsp;&amp;amp;nbsp;probe based. human/mouse only || setup || $2,700 || $2,970 || charge per submission - up to 48 samples&lt;br /&gt;
|-&lt;br /&gt;
| per sample (1-plex) || $270 || $297 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Amplicon (CITE-SEQ, TCR, BCR, antibody barcode, etc // per amplicon) || setup || $470 || $517 || additional prep beyond DGE&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $45 || $50 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;scATACseq&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | ATACseq || setup || $880 || $968 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $1,675 || $1,843 || Includes QC and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;Multiome (ATAC+3&#039;RNA)&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | MULTI || setup || $1,800 || $1,980 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $3,100 || $3,410 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;CANCELLATION&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| per session ||  || $200 || $220 || &amp;lt;24h notice&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=== VISIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SLIDES !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| HD: polyA or FFPE (hs/mm only) || 1 slide / 2 tiles || $7,850 || $8,596 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| QC - FFPE Scroll || per scroll || $60 || $66 || RNA isolation from FFPE scroll&lt;br /&gt;
|-&lt;br /&gt;
| QC - Fresh Frozen Scroll || per scroll || $40 || $44 || RNA isolation from FF scroll&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== AVITI24 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! AVITI24 SPATIAL !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Slide Only || rowspan=&amp;quot;5&amp;quot; | per slide || $150 || $165 || slide: 1, 12, or 48 well&lt;br /&gt;
|-&lt;br /&gt;
| Optimization Only || $800 || $880 || used when the run fails&lt;br /&gt;
|-&lt;br /&gt;
| [https://www.elementbiosciences.com/products/aviti24/cytoprofiling Teton Defined Panel] || $7,200 || $7,920 || scroll to predefined panels&lt;br /&gt;
|-&lt;br /&gt;
| Atlas Short || $5,500 || $6,050 || for CRISPR screens / short sequencing&lt;br /&gt;
|-&lt;br /&gt;
| [https://www.elementbiosciences.com/products/aviti24/cytoprofiling Antibody Add-on] || $360 || $396 || scroll to flexible protein customization&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== OTHER GENOMICS SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== [[BioMicroCenter:QC|QUALITY CONTROL]] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! QUALITY CONTROL !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: RNA or DNA || per sample || $15 || $16.50 ||&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: Preloaded row || per row (12) || $80 || $88 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: RNA or DNA || per sample || $30 || $33 ||&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: Preloaded Row || per row (12) || $160 || $176 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| BioAnalyzer: Walkup Service || per chip || $50 || $55 ||&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (Short read quantification test) || per sample || $25 || $27.50 || 4 point serial dilution&lt;br /&gt;
|-&lt;br /&gt;
| Full plate qPCR (short read quantification test) || per plate || $400 || $440 || full plate only (exclude column 1 for standards) - must be to BMC specifications.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Sample QC services:&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Fresh Frozen Curl || per curl || $40 || $44 ||&lt;br /&gt;
|-&lt;br /&gt;
| FFPE Curl || per curl || $60 || $66 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OLIGO SYNTHESIS ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Platform !! Service !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;6&amp;quot; | DNAscript Syntax || Setup (per run) || $1,000 || $1,100 || Per run cost&lt;br /&gt;
|-&lt;br /&gt;
| 2000 nucleotide synthesis || $500 || $550 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
| 8000 nucleotide synthesis || $1,500 || $1,650 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
| add Biotin (max48) || $115 || $126 || max 48 per run and 2 per oligo. Couple to T only.&lt;br /&gt;
|-&lt;br /&gt;
| add Fluor || $300 || $330 ||&lt;br /&gt;
|-&lt;br /&gt;
| add quench || $100 || $110 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== [[BioMicroCenter:RTPCR|REAL TIME PCR]] ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Roche LightCycler 480 || $15 || per plate || [https://mit.ilabsolutions.com/schedules/261680#/schedule/ CALENDAR] *available for CORE only || Email biomicro@mit.edu for training&lt;br /&gt;
|-&lt;br /&gt;
| SYBR Green (KAPA/Roche) || $45 || per ml ||  || Available for MIT only&lt;br /&gt;
|-&lt;br /&gt;
| 96-well PLATES || $10 || per plate ||  || Available for MIT only&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
== OTHER LAB SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;COVARIS SONICATOR&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| COVARIS E220 || $20 || per hour || [https://mit.ilabsolutions.com/equipment/261752/?tab=schedule ilab calendar] || tubes available for purchase.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PIPPIN PREP&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Gel Isolation || $75 || per gel (5 lanes) || TBA ||&lt;br /&gt;
|-&lt;br /&gt;
| Training || $25 || per session || TBA || Contact [[BioMicroCenter:People|Noelani Kamelamela]] for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PLATE READER&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Varioskan || $18 || per hour || [https://mit.ilabsolutions.com/schedules/262715#/schedule/ CALENDAR] || Contact [[BioMicroCenter:People|Noelani Kamelamela]] for training&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;ROBOTICS&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Tecan EVO 150 || $75 || per 1h block - based on scheduled time. || [https://mit.ilabsolutions.com/schedules/262347#/schedule/ CALENDAR] ||&lt;br /&gt;
|-&lt;br /&gt;
| non-filter tips || $8 || per box ||  || ** Please let us know if there is additional plasticware you would like us to stock.&lt;br /&gt;
|-&lt;br /&gt;
| Filter tips || $12.00 || per box ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| Training || $65 || per hour || Contact [[BioMicroCenter:People|Tatum Murdock]] ||&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;NANODROP&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Nanodrop || -- ||  || Walk up service || * no charge&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== COMPUTATIONAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! COMPUTATIONAL SERVICES !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! Other MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Support || per hour || $90 || $125 || Very limited support for non-MIT users&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Share || per 0.1FTE || $1,250 || N/A || MIT only. Priority access to informatics.&lt;br /&gt;
|-&lt;br /&gt;
| Ingenuity Pathway Analysis || per dataset || $100 || $110 || Recovery of licence cost.&lt;br /&gt;
|-&lt;br /&gt;
| Active Data storage || per TB per year || $100 || $300 ||&lt;br /&gt;
|-&lt;br /&gt;
| Tape Archive / Recovery || per tape || $60 || $70 ||&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Training Classes || per session || $50 || $100 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
OLD&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2025 | FY2025 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023b | FY2023-Feb Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023 | FY2023 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2022 | FY2022 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2021 | FY2021 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2019 | FY2019 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2017 | FY2017 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2016 | FY2016 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2015 | FY2015 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2014 | FY2014 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2013 | FY2013 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2012 | FY2012 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2011 | FY2011 Pricing]]&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131408</id>
		<title>MIT:Pricing</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131408"/>
		<updated>2026-04-27T17:11:41Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* CHEMAGIC360 */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&#039;&#039;&#039;PRICING UPDATE 7/1/2025&#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - HIGH OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== NOVASEQX / NOVASEQ6000 SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! NOVASEQ SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 150PE Lane^^ || $1,850 || $2,000 || rowspan=&amp;quot;2&amp;quot; | Per Lane || rowspan=&amp;quot;5&amp;quot; | Through collaboration with nearby academic shared resources&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 150PE Lane^^ || $2,600 || $2,860&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 300nt^^ || $12,160 || $13,376 || rowspan=&amp;quot;3&amp;quot; | Per Flowcell&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 300nt^^ || $16,200 || $17,820&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 100nt^^ || $5,750 || $6,325&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - MID OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Element_Sequencing ELEMENT AVITI24] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ELEMENT AVITI SEQUENCING !! Lane/Flowcell !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 75 PE || Full flowcell (2 lane, 800m read) || $1,900 || $2,090 || per flowcell || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| One lane (~400m read) || $1,000 || $1,100 || per lane&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 150 PE || Full flowcell (2 lane, ~800m read) || $2,650 || $2,915 || per flowcell&lt;br /&gt;
|-&lt;br /&gt;
| One lane (~400m read) || $1,375 || $1,513 || per lane&lt;br /&gt;
|-&lt;br /&gt;
| 300 PE || Full flowcell (~200m reads) || $3,500 || $3,850 || per lane&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - LOW OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Singular_Sequencing#Requirements%2FThings_to_Consider SINGULAR G4] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SINGULAR G4 SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 50 PE: F3 Lane (~100m reads) || $300 || $330 || per lane || rowspan=&amp;quot;3&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| Rapid 300nt: F3 flowcell (~400m reads)* || $1,800 || $1,980 || per flowcell&lt;br /&gt;
|-&lt;br /&gt;
| 150 PE: F3 Lane (~100m reads) || $450 || $495 || per lane&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
* Rapid flowcells are required for adapted Illumina libraries.&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== MISEQ SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Assisted ====&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Length !! Reads !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || rowspan=&amp;quot;2&amp;quot; | 5M || $715 || $786.50 || rowspan=&amp;quot;9&amp;quot; | per kit || rowspan=&amp;quot;9&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $1,040 || $1,144&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;4&amp;quot; | 25M || $925 || $1,017.50&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $1,334 || $1,467.40&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $1,570 || $1,727&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;1000nt&#039;&#039;&#039; || $2,590 || $2,849&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;2&amp;quot; | 100M || $1,540 || $1,694&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $2,125 || $2,337.50&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || 50M || $2,125 || $2,337.50&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Walkup ====&lt;br /&gt;
Training and lab storage on BMC servers required. Run must be scheduled in the [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar.]&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Length !! Reads !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! RunTime !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Machine usage || — || $120 || $132 || per run || — || training and lab storage on BMC servers required.&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || rowspan=&amp;quot;2&amp;quot; | 5M || $381 || $419.10 || rowspan=&amp;quot;9&amp;quot; | per kit || 8h || rowspan=&amp;quot;9&amp;quot; |&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $665 || $731.50 || 16h&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;4&amp;quot; | 25M || $565 || $621.50 || 5h&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $920 || $1,012 || 8h&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $1,125 || $1,238 || 16h&lt;br /&gt;
|-&lt;br /&gt;
| 1000nt || $1,921 || $2,113.10 || 24h&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;2&amp;quot; | 100M || $1,130 || $1,243 || 5h&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $1,638.50 || $1,802.35 || 8h&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || 50M || $1,638.50 || $1,802.35 || 16h&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq classic ====&lt;br /&gt;
&lt;br /&gt;
* MiSeq is off contract and will be retired upon instrument failure&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Length !! Reads !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 70nt || 15M || $1,320 || $1,452 || rowspan=&amp;quot;6&amp;quot; | per kit || rowspan=&amp;quot;6&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| 150nt || 25M || $1,430 || $1,573&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || 15M || $1,595 || $1,754.50&lt;br /&gt;
|-&lt;br /&gt;
| 500nt || 15M || $1,760 || $1,936&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || 25M || $2,200 || $2,420&lt;br /&gt;
|-&lt;br /&gt;
| 500nt || 1M &amp;amp;nbsp;&#039;&#039;&#039;NANO&#039;&#039;&#039; || $770 || $847&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OTHER SHORT READ SERVICES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SHORT READ SUPPORTING SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Quality Control Only -only one QC is included per sequencing lane. || $35 || $38.50 || per sample || Includes RT-PCR and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Quality Control - Use SYBR for sample quantification for pooling instead of qPCR. Only available for pooling. || $15 || $16.50 || per sample || Includes Fluorometric quantification and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (short read) || $25 || $27.50 || per sample || Includes qPCR values from standard QC only&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only - full plate(short read) || $400 || $440 || per plate || excludes column 1 (used for controls)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LONG READ SEQUENCING ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PROMETHION SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $1,200 || $1,320 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PACBIO REVIO SEQUENCING^^ !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| SMRT Cell || $2,900 || $3,190 || per SMRT Cell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== LIBRARY GENERATION ==&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - DNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! colspan=&amp;quot;3&amp;quot; | ILLUMINA Sample Preparation !! colspan=&amp;quot;3&amp;quot; style=&amp;quot;color:blue;&amp;quot; | &amp;amp;nbsp;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;STANDARD THROUGHPUT DNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for individual samples. Repreps will typically be attempted on failed samples without charge. || colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center; color:blue;&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT DNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for sample batches. Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included.&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | LIGATION BASED NEB UltraII || STD || per sample || $105 || $115 || Includes QC, adapter ligation, size selection, barcoding, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 24 || style=&amp;quot;color:blue;&amp;quot; | $900 || style=&amp;quot;color:blue;&amp;quot; | $990 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes adapter ligation, size selection, barcoding, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 96 || style=&amp;quot;color:blue;&amp;quot; | $1,800 || style=&amp;quot;color:blue;&amp;quot; | $1,980&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation &amp;amp;nbsp;&amp;amp;nbsp;NEXTERA-XT || rowspan=&amp;quot;2&amp;quot; | STD || rowspan=&amp;quot;2&amp;quot; | per Sample || $105 || $115 || rowspan=&amp;quot;2&amp;quot; | Includes set-up, tagmentation, indexing, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation &amp;amp;nbsp;&amp;amp;nbsp;NEXTERA-FLEX || $157 || $173&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | NEXTERA-XT OR FLEX || style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $900 || style=&amp;quot;color:blue;&amp;quot; | $990 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes tagmentation, indexing, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,800 || style=&amp;quot;color:blue;&amp;quot; | $1,980&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 16S Amplicon || style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 48 || style=&amp;quot;color:blue;&amp;quot; | $1,900 || style=&amp;quot;color:blue;&amp;quot; | $2,090 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes normalization, enrichment, pooling and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | add&#039;l 48 || style=&amp;quot;color:blue;&amp;quot; | $650 || style=&amp;quot;color:blue;&amp;quot; | $715&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Other Amplicon || style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 48 || style=&amp;quot;color:blue;&amp;quot; | $1,600 || style=&amp;quot;color:blue;&amp;quot; | $1,760 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes normalization, enrichment, pooling and quality control (SYBR and FA). &amp;amp;nbsp;&amp;amp;nbsp;Samples *must* be submitted amplified with appropriate linkers.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | add&#039;l 48 || style=&amp;quot;color:blue;&amp;quot; | $630 || style=&amp;quot;color:blue;&amp;quot; | $693&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Samples not in proper input format will be subject to these additional charges.&lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || || 48 samples || $60 || $66 ||&lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || || per sample || $5 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || || per sample || $10 || $11 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - RNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! colspan=&amp;quot;3&amp;quot; | ILLUMINA Sample Preparation !! colspan=&amp;quot;3&amp;quot; style=&amp;quot;color:blue;&amp;quot; | &amp;amp;nbsp;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;STANDARD RNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for individual samples. Repreps will typically be attempted on failed samples without charge. || colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center; color:blue;&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT RNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. Mixing of multiple projects not recommended.&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | polyA based isolation &amp;amp;nbsp;&amp;amp;nbsp;NEB UltraII RNAseq || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $157 || $173 || Includes QC, polyA isolation, generation of cDNA, library construction, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,500 || style=&amp;quot;color:blue;&amp;quot; | $1,650 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,000 || style=&amp;quot;color:blue;&amp;quot; | $3,300&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | High Throughput 3&#039; Digital Gene Expression (HT3DGE) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,050 || style=&amp;quot;color:blue;&amp;quot; | $1,155 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes generation of cDNA, library construction, indexing and library quality control. Does not include sample QC.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,100 || style=&amp;quot;color:blue;&amp;quot; | $2,310&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Total RNA sequencing &amp;amp;nbsp;&amp;amp;nbsp;NEB RNAseq +Ribodepletion || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $235 || $258.50 || Includes sample QC, ribosomal depletion, generation of cDNA, library construction, indexing and library quality control.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,500 || style=&amp;quot;color:blue;&amp;quot; | $2,750 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $5,000 || style=&amp;quot;color:blue;&amp;quot; | $5,500&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Low Input polyA+ &amp;amp;nbsp;&amp;amp;nbsp;Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;STD&#039;&#039;&#039; v4 || per sample || $262 || $289 || rowspan=&amp;quot;3&amp;quot; | Includes generation of cDNA, amplification, library construction, indexing and quality control (SYBR + FA). Single sample includes initial QC.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,000 || style=&amp;quot;color:blue;&amp;quot; | $2,200&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,200 || style=&amp;quot;color:blue;&amp;quot; | $3,520&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Low Input Mammalian Total &amp;amp;nbsp;&amp;amp;nbsp;Clontech ZapR Kit || STD || per sample || $210 || $231 || Includes generation of cDNA, amplification, library construction, rRNA degradation, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,000 || style=&amp;quot;color:blue;&amp;quot; | $3,300 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $5,000 || style=&amp;quot;color:blue;&amp;quot; | $5,500&lt;br /&gt;
|-&lt;br /&gt;
| Small RNA || STD || per sample || $289 || $318 || Uses NEB, BIOO or QIAGEN small RNA kit&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Samples not in proper input format will be subject to these additional charges.&lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || || 48 samples || $60 || $66 ||&lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || || per sample || $5 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || || per sample || $10 || $11 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
=== LONG READ LIBRARIES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Oxford Nanopore Sample Preparation !! Nanopore Kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit&lt;br /&gt;
|-&lt;br /&gt;
| Standard Ligation || LSK || $160 || $176 || per sample/pool&lt;br /&gt;
|-&lt;br /&gt;
| Native Barcoding &amp;amp;nbsp;&amp;amp;nbsp;(ligation indexing) || - || $50 || $55 || rowspan=&amp;quot;5&amp;quot; | per sample&lt;br /&gt;
|-&lt;br /&gt;
| SMARTseq -&amp;gt; Ligation || Cv4+LSK || $300 || $330&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Prep (tagment - ~10-20kb) || RAD || $150 || $165&lt;br /&gt;
|-&lt;br /&gt;
| Long Insert Prep || RAD (modified, target &amp;gt;100kb) || $262 || $289&lt;br /&gt;
|-&lt;br /&gt;
| Direct RNA || RNA004 || $160 || $176&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PacBio Sample Preparation !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Basic Library || $315 || $346 || Per Library&lt;br /&gt;
|-&lt;br /&gt;
| $157 || $173 || Per add&#039;l Sample&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Genomic Library || $472 || $520 || Per Library&lt;br /&gt;
|-&lt;br /&gt;
| $235 || $258 || Per add&#039;l Sample&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SAMPLE EXTRACTION ==&lt;br /&gt;
&lt;br /&gt;
=== CHEMAGIC360 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! TYPE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| DNA || 96 || $700 || $770 &lt;br /&gt;
|-&lt;br /&gt;
| RNA || 96 || $800 || $880 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 12 samples || $300 || $330 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 96 samples || $1,000 || $1,100 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SINGLE CELL &amp;amp; SPATIAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== 10X CHROMIUM ===&lt;br /&gt;
&lt;br /&gt;
Please email biomicro@mit.edu two weeks prior to desired submission date so we will have reagents ready for you.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! 10X USAGE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Assisted Service&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;DIGITAL GENE EXPRESSION&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 5&#039; RNA &amp;amp;nbsp;&amp;amp;nbsp;3&#039; RNA || setup || $1,015 || $1,116.50 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $1,750 || $1,925 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 5&#039; RNA &amp;amp;nbsp;&amp;amp;nbsp;3&#039; RNA - on chip multiplexing || setup || $1,150 || $1,265 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per 4 samples || $2,305 || $2,535 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Fixed RNA (Flex v2) &amp;amp;nbsp;&amp;amp;nbsp;probe based. human/mouse only || setup || $2,700 || $2,970 || charge per submission - up to 48 samples&lt;br /&gt;
|-&lt;br /&gt;
| per sample (1-plex) || $270 || $297 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Amplicon (CITE-SEQ, TCR, BCR, antibody barcode, etc // per amplicon) || setup || $470 || $517 || additional prep beyond DGE&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $45 || $50 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;scATACseq&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | ATACseq || setup || $880 || $968 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $1,675 || $1,843 || Includes QC and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;Multiome (ATAC+3&#039;RNA)&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | MULTI || setup || $1,800 || $1,980 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $3,100 || $3,410 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;CANCELLATION&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| per session ||  || $200 || $220 || &amp;lt;24h notice&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=== VISIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SLIDES !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| HD: polyA or FFPE (hs/mm only) || 1 slide / 2 tiles || $7,850 || $8,596 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| QC - FFPE Scroll || per scroll || $60 || $66 || RNA isolation from FFPE scroll&lt;br /&gt;
|-&lt;br /&gt;
| QC - Fresh Frozen Scroll || per scroll || $40 || $44 || RNA isolation from FF scroll&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== AVITI24 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! AVITI24 SPATIAL !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Slide Only || rowspan=&amp;quot;5&amp;quot; | per slide || $150 || $165 || slide: 1, 12, or 48 well&lt;br /&gt;
|-&lt;br /&gt;
| Optimization Only || $800 || $880 || used when the run fails&lt;br /&gt;
|-&lt;br /&gt;
| [https://www.elementbiosciences.com/products/aviti24/cytoprofiling Teton Defined Panel] || $7,200 || $7,920 || scroll to predefined panels&lt;br /&gt;
|-&lt;br /&gt;
| Atlas Short || $5,500 || $6,050 || for CRISPR screens / short sequencing&lt;br /&gt;
|-&lt;br /&gt;
| [https://www.elementbiosciences.com/products/aviti24/cytoprofiling Antibody Add-on] || $360 || $396 || scroll to flexible protein customization&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== OTHER GENOMICS SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== [[BioMicroCenter:QC|QUALITY CONTROL]] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! QUALITY CONTROL !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: RNA or DNA || per sample || $15 || $16.50 ||&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: Preloaded row || per row (12) || $80 || $88 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: RNA or DNA || per sample || $30 || $33 ||&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: Preloaded Row || per row (12) || $160 || $176 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| BioAnalyzer: Walkup Service || per chip || $50 || $55 ||&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (Short read quantification test) || per sample || $25 || $27.50 || 4 point serial dilution&lt;br /&gt;
|-&lt;br /&gt;
| Full plate qPCR (short read quantification test) || per plate || $400 || $440 || full plate only (exclude column 1 for standards) - must be to BMC specifications.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Sample QC services:&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Fresh Frozen Curl || per curl || $40 || $44 ||&lt;br /&gt;
|-&lt;br /&gt;
| FFPE Curl || per curl || $60 || $66 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OLIGO SYNTHESIS ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Platform !! Service !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;6&amp;quot; | DNAscript Syntax || Setup (per run) || $1,000 || $1,100 || Per run cost&lt;br /&gt;
|-&lt;br /&gt;
| 2000 nucleotide synthesis || $500 || $550 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
| 8000 nucleotide synthesis || $1,500 || $1,650 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
| add Biotin (max48) || $115 || $126 || max 48 per run and 2 per oligo. Couple to T only.&lt;br /&gt;
|-&lt;br /&gt;
| add Fluor || $300 || $330 ||&lt;br /&gt;
|-&lt;br /&gt;
| add quench || $100 || $110 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== [[BioMicroCenter:RTPCR|REAL TIME PCR]] ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Roche LightCycler 480 || $15 || per plate || [https://mit.ilabsolutions.com/schedules/261680#/schedule/ CALENDAR] *available for CORE only || Contact [[BioMicroCenter:People|Christopher Hallee]] for training&lt;br /&gt;
|-&lt;br /&gt;
| SYBR Green (KAPA/Roche) || $45 || per ml ||  || Available for MIT only&lt;br /&gt;
|-&lt;br /&gt;
| 96-well PLATES || $10 || per plate ||  || Available for MIT only&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
== OTHER LAB SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;COVARIS SONICATOR&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| COVARIS E220 || $20 || per hour || [https://mit.ilabsolutions.com/equipment/261752/?tab=schedule ilab calendar] || tubes available for purchase.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PIPPIN PREP&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Gel Isolation || $75 || per gel (5 lanes) || TBA ||&lt;br /&gt;
|-&lt;br /&gt;
| Training || $25 || per session || TBA || Contact [[BioMicroCenter:People|Noelani Kamelamela]] for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PLATE READER&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Varioskan || $18 || per hour || [https://mit.ilabsolutions.com/schedules/262715#/schedule/ CALENDAR] || Contact [[BioMicroCenter:People|Noelani Kamelamela]] for training&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;ROBOTICS&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Tecan EVO 150 || $75 || per 1h block - based on scheduled time. || [https://mit.ilabsolutions.com/schedules/262347#/schedule/ CALENDAR] ||&lt;br /&gt;
|-&lt;br /&gt;
| non-filter tips || $8 || per box ||  || ** Please let us know if there is additional plasticware you would like us to stock.&lt;br /&gt;
|-&lt;br /&gt;
| Filter tips || $12.00 || per box ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| Training || $65 || per hour || Contact [[BioMicroCenter:People|Tatum Murdock]] ||&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;NANODROP&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Nanodrop || -- ||  || Walk up service || * no charge&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== COMPUTATIONAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! COMPUTATIONAL SERVICES !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! Other MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Support || per hour || $90 || $125 || Very limited support for non-MIT users&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Share || per 0.1FTE || $1,250 || N/A || MIT only. Priority access to informatics.&lt;br /&gt;
|-&lt;br /&gt;
| Ingenuity Pathway Analysis || per dataset || $100 || $110 || Recovery of licence cost.&lt;br /&gt;
|-&lt;br /&gt;
| Active Data storage || per TB per year || $100 || $300 ||&lt;br /&gt;
|-&lt;br /&gt;
| Tape Archive / Recovery || per tape || $60 || $70 ||&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Training Classes || per session || $50 || $100 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
OLD&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2025 | FY2025 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023b | FY2023-Feb Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023 | FY2023 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2022 | FY2022 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2021 | FY2021 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2019 | FY2019 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2017 | FY2017 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2016 | FY2016 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2015 | FY2015 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2014 | FY2014 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2013 | FY2013 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2012 | FY2012 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2011 | FY2011 Pricing]]&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131407</id>
		<title>MIT:Pricing</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131407"/>
		<updated>2026-04-27T17:10:56Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* MiSeq classic */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&#039;&#039;&#039;PRICING UPDATE 7/1/2025&#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - HIGH OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== NOVASEQX / NOVASEQ6000 SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! NOVASEQ SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 150PE Lane^^ || $1,850 || $2,000 || rowspan=&amp;quot;2&amp;quot; | Per Lane || rowspan=&amp;quot;5&amp;quot; | Through collaboration with nearby academic shared resources&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 150PE Lane^^ || $2,600 || $2,860&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 300nt^^ || $12,160 || $13,376 || rowspan=&amp;quot;3&amp;quot; | Per Flowcell&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 300nt^^ || $16,200 || $17,820&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 100nt^^ || $5,750 || $6,325&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - MID OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Element_Sequencing ELEMENT AVITI24] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ELEMENT AVITI SEQUENCING !! Lane/Flowcell !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 75 PE || Full flowcell (2 lane, 800m read) || $1,900 || $2,090 || per flowcell || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| One lane (~400m read) || $1,000 || $1,100 || per lane&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 150 PE || Full flowcell (2 lane, ~800m read) || $2,650 || $2,915 || per flowcell&lt;br /&gt;
|-&lt;br /&gt;
| One lane (~400m read) || $1,375 || $1,513 || per lane&lt;br /&gt;
|-&lt;br /&gt;
| 300 PE || Full flowcell (~200m reads) || $3,500 || $3,850 || per lane&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - LOW OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Singular_Sequencing#Requirements%2FThings_to_Consider SINGULAR G4] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SINGULAR G4 SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 50 PE: F3 Lane (~100m reads) || $300 || $330 || per lane || rowspan=&amp;quot;3&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| Rapid 300nt: F3 flowcell (~400m reads)* || $1,800 || $1,980 || per flowcell&lt;br /&gt;
|-&lt;br /&gt;
| 150 PE: F3 Lane (~100m reads) || $450 || $495 || per lane&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
* Rapid flowcells are required for adapted Illumina libraries.&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== MISEQ SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Assisted ====&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Length !! Reads !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || rowspan=&amp;quot;2&amp;quot; | 5M || $715 || $786.50 || rowspan=&amp;quot;9&amp;quot; | per kit || rowspan=&amp;quot;9&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $1,040 || $1,144&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;4&amp;quot; | 25M || $925 || $1,017.50&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $1,334 || $1,467.40&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $1,570 || $1,727&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;1000nt&#039;&#039;&#039; || $2,590 || $2,849&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;2&amp;quot; | 100M || $1,540 || $1,694&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $2,125 || $2,337.50&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || 50M || $2,125 || $2,337.50&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Walkup ====&lt;br /&gt;
Training and lab storage on BMC servers required. Run must be scheduled in the [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar.]&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Length !! Reads !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! RunTime !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Machine usage || — || $120 || $132 || per run || — || training and lab storage on BMC servers required.&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || rowspan=&amp;quot;2&amp;quot; | 5M || $381 || $419.10 || rowspan=&amp;quot;9&amp;quot; | per kit || 8h || rowspan=&amp;quot;9&amp;quot; |&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $665 || $731.50 || 16h&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;4&amp;quot; | 25M || $565 || $621.50 || 5h&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $920 || $1,012 || 8h&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $1,125 || $1,238 || 16h&lt;br /&gt;
|-&lt;br /&gt;
| 1000nt || $1,921 || $2,113.10 || 24h&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;2&amp;quot; | 100M || $1,130 || $1,243 || 5h&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $1,638.50 || $1,802.35 || 8h&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || 50M || $1,638.50 || $1,802.35 || 16h&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq classic ====&lt;br /&gt;
&lt;br /&gt;
* MiSeq is off contract and will be retired upon instrument failure&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Length !! Reads !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 70nt || 15M || $1,320 || $1,452 || rowspan=&amp;quot;6&amp;quot; | per kit || rowspan=&amp;quot;6&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| 150nt || 25M || $1,430 || $1,573&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || 15M || $1,595 || $1,754.50&lt;br /&gt;
|-&lt;br /&gt;
| 500nt || 15M || $1,760 || $1,936&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || 25M || $2,200 || $2,420&lt;br /&gt;
|-&lt;br /&gt;
| 500nt || 1M &amp;amp;nbsp;&#039;&#039;&#039;NANO&#039;&#039;&#039; || $770 || $847&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OTHER SHORT READ SERVICES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SHORT READ SUPPORTING SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Quality Control Only -only one QC is included per sequencing lane. || $35 || $38.50 || per sample || Includes RT-PCR and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Quality Control - Use SYBR for sample quantification for pooling instead of qPCR. Only available for pooling. || $15 || $16.50 || per sample || Includes Fluorometric quantification and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (short read) || $25 || $27.50 || per sample || Includes qPCR values from standard QC only&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only - full plate(short read) || $400 || $440 || per plate || excludes column 1 (used for controls)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LONG READ SEQUENCING ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PROMETHION SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $1,200 || $1,320 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PACBIO REVIO SEQUENCING^^ !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| SMRT Cell || $2,900 || $3,190 || per SMRT Cell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== LIBRARY GENERATION ==&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - DNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! colspan=&amp;quot;3&amp;quot; | ILLUMINA Sample Preparation !! colspan=&amp;quot;3&amp;quot; style=&amp;quot;color:blue;&amp;quot; | &amp;amp;nbsp;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;STANDARD THROUGHPUT DNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for individual samples. Repreps will typically be attempted on failed samples without charge. || colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center; color:blue;&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT DNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for sample batches. Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included.&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | LIGATION BASED NEB UltraII || STD || per sample || $105 || $115 || Includes QC, adapter ligation, size selection, barcoding, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 24 || style=&amp;quot;color:blue;&amp;quot; | $900 || style=&amp;quot;color:blue;&amp;quot; | $990 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes adapter ligation, size selection, barcoding, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 96 || style=&amp;quot;color:blue;&amp;quot; | $1,800 || style=&amp;quot;color:blue;&amp;quot; | $1,980&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation &amp;amp;nbsp;&amp;amp;nbsp;NEXTERA-XT || rowspan=&amp;quot;2&amp;quot; | STD || rowspan=&amp;quot;2&amp;quot; | per Sample || $105 || $115 || rowspan=&amp;quot;2&amp;quot; | Includes set-up, tagmentation, indexing, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation &amp;amp;nbsp;&amp;amp;nbsp;NEXTERA-FLEX || $157 || $173&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | NEXTERA-XT OR FLEX || style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $900 || style=&amp;quot;color:blue;&amp;quot; | $990 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes tagmentation, indexing, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,800 || style=&amp;quot;color:blue;&amp;quot; | $1,980&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 16S Amplicon || style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 48 || style=&amp;quot;color:blue;&amp;quot; | $1,900 || style=&amp;quot;color:blue;&amp;quot; | $2,090 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes normalization, enrichment, pooling and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | add&#039;l 48 || style=&amp;quot;color:blue;&amp;quot; | $650 || style=&amp;quot;color:blue;&amp;quot; | $715&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Other Amplicon || style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 48 || style=&amp;quot;color:blue;&amp;quot; | $1,600 || style=&amp;quot;color:blue;&amp;quot; | $1,760 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes normalization, enrichment, pooling and quality control (SYBR and FA). &amp;amp;nbsp;&amp;amp;nbsp;Samples *must* be submitted amplified with appropriate linkers.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | add&#039;l 48 || style=&amp;quot;color:blue;&amp;quot; | $630 || style=&amp;quot;color:blue;&amp;quot; | $693&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Samples not in proper input format will be subject to these additional charges.&lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || || 48 samples || $60 || $66 ||&lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || || per sample || $5 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || || per sample || $10 || $11 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - RNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! colspan=&amp;quot;3&amp;quot; | ILLUMINA Sample Preparation !! colspan=&amp;quot;3&amp;quot; style=&amp;quot;color:blue;&amp;quot; | &amp;amp;nbsp;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;STANDARD RNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for individual samples. Repreps will typically be attempted on failed samples without charge. || colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center; color:blue;&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT RNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. Mixing of multiple projects not recommended.&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | polyA based isolation &amp;amp;nbsp;&amp;amp;nbsp;NEB UltraII RNAseq || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $157 || $173 || Includes QC, polyA isolation, generation of cDNA, library construction, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,500 || style=&amp;quot;color:blue;&amp;quot; | $1,650 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,000 || style=&amp;quot;color:blue;&amp;quot; | $3,300&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | High Throughput 3&#039; Digital Gene Expression (HT3DGE) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,050 || style=&amp;quot;color:blue;&amp;quot; | $1,155 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes generation of cDNA, library construction, indexing and library quality control. Does not include sample QC.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,100 || style=&amp;quot;color:blue;&amp;quot; | $2,310&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Total RNA sequencing &amp;amp;nbsp;&amp;amp;nbsp;NEB RNAseq +Ribodepletion || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $235 || $258.50 || Includes sample QC, ribosomal depletion, generation of cDNA, library construction, indexing and library quality control.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,500 || style=&amp;quot;color:blue;&amp;quot; | $2,750 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $5,000 || style=&amp;quot;color:blue;&amp;quot; | $5,500&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Low Input polyA+ &amp;amp;nbsp;&amp;amp;nbsp;Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;STD&#039;&#039;&#039; v4 || per sample || $262 || $289 || rowspan=&amp;quot;3&amp;quot; | Includes generation of cDNA, amplification, library construction, indexing and quality control (SYBR + FA). Single sample includes initial QC.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,000 || style=&amp;quot;color:blue;&amp;quot; | $2,200&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,200 || style=&amp;quot;color:blue;&amp;quot; | $3,520&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Low Input Mammalian Total &amp;amp;nbsp;&amp;amp;nbsp;Clontech ZapR Kit || STD || per sample || $210 || $231 || Includes generation of cDNA, amplification, library construction, rRNA degradation, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,000 || style=&amp;quot;color:blue;&amp;quot; | $3,300 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $5,000 || style=&amp;quot;color:blue;&amp;quot; | $5,500&lt;br /&gt;
|-&lt;br /&gt;
| Small RNA || STD || per sample || $289 || $318 || Uses NEB, BIOO or QIAGEN small RNA kit&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Samples not in proper input format will be subject to these additional charges.&lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || || 48 samples || $60 || $66 ||&lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || || per sample || $5 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || || per sample || $10 || $11 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
=== LONG READ LIBRARIES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Oxford Nanopore Sample Preparation !! Nanopore Kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit&lt;br /&gt;
|-&lt;br /&gt;
| Standard Ligation || LSK || $160 || $176 || per sample/pool&lt;br /&gt;
|-&lt;br /&gt;
| Native Barcoding &amp;amp;nbsp;&amp;amp;nbsp;(ligation indexing) || - || $50 || $55 || rowspan=&amp;quot;5&amp;quot; | per sample&lt;br /&gt;
|-&lt;br /&gt;
| SMARTseq -&amp;gt; Ligation || Cv4+LSK || $300 || $330&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Prep (tagment - ~10-20kb) || RAD || $150 || $165&lt;br /&gt;
|-&lt;br /&gt;
| Long Insert Prep || RAD (modified, target &amp;gt;100kb) || $262 || $289&lt;br /&gt;
|-&lt;br /&gt;
| Direct RNA || RNA004 || $160 || $176&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PacBio Sample Preparation !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Basic Library || $315 || $346 || Per Library&lt;br /&gt;
|-&lt;br /&gt;
| $157 || $173 || Per add&#039;l Sample&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Genomic Library || $472 || $520 || Per Library&lt;br /&gt;
|-&lt;br /&gt;
| $235 || $258 || Per add&#039;l Sample&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SAMPLE EXTRACTION ==&lt;br /&gt;
&lt;br /&gt;
=== CHEMAGIC360 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! TYPE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| DNA || 96 || $700 || $770 ||&lt;br /&gt;
|-&lt;br /&gt;
| RNA || 96 || $800 || $880 ||&lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 12 samples || $300 || $330 ||&lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 96 samples || $1,000 || $1,100 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SINGLE CELL &amp;amp; SPATIAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== 10X CHROMIUM ===&lt;br /&gt;
&lt;br /&gt;
Please email biomicro@mit.edu two weeks prior to desired submission date so we will have reagents ready for you.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! 10X USAGE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Assisted Service&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;DIGITAL GENE EXPRESSION&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 5&#039; RNA &amp;amp;nbsp;&amp;amp;nbsp;3&#039; RNA || setup || $1,015 || $1,116.50 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $1,750 || $1,925 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 5&#039; RNA &amp;amp;nbsp;&amp;amp;nbsp;3&#039; RNA - on chip multiplexing || setup || $1,150 || $1,265 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per 4 samples || $2,305 || $2,535 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Fixed RNA (Flex v2) &amp;amp;nbsp;&amp;amp;nbsp;probe based. human/mouse only || setup || $2,700 || $2,970 || charge per submission - up to 48 samples&lt;br /&gt;
|-&lt;br /&gt;
| per sample (1-plex) || $270 || $297 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Amplicon (CITE-SEQ, TCR, BCR, antibody barcode, etc // per amplicon) || setup || $470 || $517 || additional prep beyond DGE&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $45 || $50 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;scATACseq&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | ATACseq || setup || $880 || $968 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $1,675 || $1,843 || Includes QC and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;Multiome (ATAC+3&#039;RNA)&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | MULTI || setup || $1,800 || $1,980 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $3,100 || $3,410 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;CANCELLATION&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| per session ||  || $200 || $220 || &amp;lt;24h notice&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=== VISIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SLIDES !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| HD: polyA or FFPE (hs/mm only) || 1 slide / 2 tiles || $7,850 || $8,596 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| QC - FFPE Scroll || per scroll || $60 || $66 || RNA isolation from FFPE scroll&lt;br /&gt;
|-&lt;br /&gt;
| QC - Fresh Frozen Scroll || per scroll || $40 || $44 || RNA isolation from FF scroll&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== AVITI24 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! AVITI24 SPATIAL !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Slide Only || rowspan=&amp;quot;5&amp;quot; | per slide || $150 || $165 || slide: 1, 12, or 48 well&lt;br /&gt;
|-&lt;br /&gt;
| Optimization Only || $800 || $880 || used when the run fails&lt;br /&gt;
|-&lt;br /&gt;
| [https://www.elementbiosciences.com/products/aviti24/cytoprofiling Teton Defined Panel] || $7,200 || $7,920 || scroll to predefined panels&lt;br /&gt;
|-&lt;br /&gt;
| Atlas Short || $5,500 || $6,050 || for CRISPR screens / short sequencing&lt;br /&gt;
|-&lt;br /&gt;
| [https://www.elementbiosciences.com/products/aviti24/cytoprofiling Antibody Add-on] || $360 || $396 || scroll to flexible protein customization&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== OTHER GENOMICS SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== [[BioMicroCenter:QC|QUALITY CONTROL]] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! QUALITY CONTROL !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: RNA or DNA || per sample || $15 || $16.50 ||&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: Preloaded row || per row (12) || $80 || $88 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: RNA or DNA || per sample || $30 || $33 ||&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: Preloaded Row || per row (12) || $160 || $176 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| BioAnalyzer: Walkup Service || per chip || $50 || $55 ||&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (Short read quantification test) || per sample || $25 || $27.50 || 4 point serial dilution&lt;br /&gt;
|-&lt;br /&gt;
| Full plate qPCR (short read quantification test) || per plate || $400 || $440 || full plate only (exclude column 1 for standards) - must be to BMC specifications.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Sample QC services:&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Fresh Frozen Curl || per curl || $40 || $44 ||&lt;br /&gt;
|-&lt;br /&gt;
| FFPE Curl || per curl || $60 || $66 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OLIGO SYNTHESIS ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Platform !! Service !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;6&amp;quot; | DNAscript Syntax || Setup (per run) || $1,000 || $1,100 || Per run cost&lt;br /&gt;
|-&lt;br /&gt;
| 2000 nucleotide synthesis || $500 || $550 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
| 8000 nucleotide synthesis || $1,500 || $1,650 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
| add Biotin (max48) || $115 || $126 || max 48 per run and 2 per oligo. Couple to T only.&lt;br /&gt;
|-&lt;br /&gt;
| add Fluor || $300 || $330 ||&lt;br /&gt;
|-&lt;br /&gt;
| add quench || $100 || $110 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== [[BioMicroCenter:RTPCR|REAL TIME PCR]] ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Roche LightCycler 480 || $15 || per plate || [https://mit.ilabsolutions.com/schedules/261680#/schedule/ CALENDAR] *available for CORE only || Contact [[BioMicroCenter:People|Christopher Hallee]] for training&lt;br /&gt;
|-&lt;br /&gt;
| SYBR Green (KAPA/Roche) || $45 || per ml ||  || Available for MIT only&lt;br /&gt;
|-&lt;br /&gt;
| 96-well PLATES || $10 || per plate ||  || Available for MIT only&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
== OTHER LAB SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;COVARIS SONICATOR&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| COVARIS E220 || $20 || per hour || [https://mit.ilabsolutions.com/equipment/261752/?tab=schedule ilab calendar] || tubes available for purchase.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PIPPIN PREP&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Gel Isolation || $75 || per gel (5 lanes) || TBA ||&lt;br /&gt;
|-&lt;br /&gt;
| Training || $25 || per session || TBA || Contact [[BioMicroCenter:People|Noelani Kamelamela]] for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PLATE READER&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Varioskan || $18 || per hour || [https://mit.ilabsolutions.com/schedules/262715#/schedule/ CALENDAR] || Contact [[BioMicroCenter:People|Noelani Kamelamela]] for training&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;ROBOTICS&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Tecan EVO 150 || $75 || per 1h block - based on scheduled time. || [https://mit.ilabsolutions.com/schedules/262347#/schedule/ CALENDAR] ||&lt;br /&gt;
|-&lt;br /&gt;
| non-filter tips || $8 || per box ||  || ** Please let us know if there is additional plasticware you would like us to stock.&lt;br /&gt;
|-&lt;br /&gt;
| Filter tips || $12.00 || per box ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| Training || $65 || per hour || Contact [[BioMicroCenter:People|Tatum Murdock]] ||&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;NANODROP&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Nanodrop || -- ||  || Walk up service || * no charge&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== COMPUTATIONAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! COMPUTATIONAL SERVICES !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! Other MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Support || per hour || $90 || $125 || Very limited support for non-MIT users&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Share || per 0.1FTE || $1,250 || N/A || MIT only. Priority access to informatics.&lt;br /&gt;
|-&lt;br /&gt;
| Ingenuity Pathway Analysis || per dataset || $100 || $110 || Recovery of licence cost.&lt;br /&gt;
|-&lt;br /&gt;
| Active Data storage || per TB per year || $100 || $300 ||&lt;br /&gt;
|-&lt;br /&gt;
| Tape Archive / Recovery || per tape || $60 || $70 ||&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Training Classes || per session || $50 || $100 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
OLD&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2025 | FY2025 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023b | FY2023-Feb Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023 | FY2023 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2022 | FY2022 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2021 | FY2021 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2019 | FY2019 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2017 | FY2017 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2016 | FY2016 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2015 | FY2015 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2014 | FY2014 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2013 | FY2013 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2012 | FY2012 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2011 | FY2011 Pricing]]&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131406</id>
		<title>MIT:Pricing</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131406"/>
		<updated>2026-04-27T17:10:38Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* MiSeq i100 Assisted */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&#039;&#039;&#039;PRICING UPDATE 7/1/2025&#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - HIGH OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== NOVASEQX / NOVASEQ6000 SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! NOVASEQ SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 150PE Lane^^ || $1,850 || $2,000 || rowspan=&amp;quot;2&amp;quot; | Per Lane || rowspan=&amp;quot;5&amp;quot; | Through collaboration with nearby academic shared resources&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 150PE Lane^^ || $2,600 || $2,860&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 300nt^^ || $12,160 || $13,376 || rowspan=&amp;quot;3&amp;quot; | Per Flowcell&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 300nt^^ || $16,200 || $17,820&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 100nt^^ || $5,750 || $6,325&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - MID OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Element_Sequencing ELEMENT AVITI24] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ELEMENT AVITI SEQUENCING !! Lane/Flowcell !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 75 PE || Full flowcell (2 lane, 800m read) || $1,900 || $2,090 || per flowcell || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| One lane (~400m read) || $1,000 || $1,100 || per lane&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 150 PE || Full flowcell (2 lane, ~800m read) || $2,650 || $2,915 || per flowcell&lt;br /&gt;
|-&lt;br /&gt;
| One lane (~400m read) || $1,375 || $1,513 || per lane&lt;br /&gt;
|-&lt;br /&gt;
| 300 PE || Full flowcell (~200m reads) || $3,500 || $3,850 || per lane&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - LOW OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Singular_Sequencing#Requirements%2FThings_to_Consider SINGULAR G4] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SINGULAR G4 SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 50 PE: F3 Lane (~100m reads) || $300 || $330 || per lane || rowspan=&amp;quot;3&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| Rapid 300nt: F3 flowcell (~400m reads)* || $1,800 || $1,980 || per flowcell&lt;br /&gt;
|-&lt;br /&gt;
| 150 PE: F3 Lane (~100m reads) || $450 || $495 || per lane&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
* Rapid flowcells are required for adapted Illumina libraries.&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== MISEQ SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Assisted ====&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Length !! Reads !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || rowspan=&amp;quot;2&amp;quot; | 5M || $715 || $786.50 || rowspan=&amp;quot;9&amp;quot; | per kit || rowspan=&amp;quot;9&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $1,040 || $1,144&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;4&amp;quot; | 25M || $925 || $1,017.50&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $1,334 || $1,467.40&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $1,570 || $1,727&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;1000nt&#039;&#039;&#039; || $2,590 || $2,849&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;2&amp;quot; | 100M || $1,540 || $1,694&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $2,125 || $2,337.50&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || 50M || $2,125 || $2,337.50&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Walkup ====&lt;br /&gt;
Training and lab storage on BMC servers required. Run must be scheduled in the [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar.]&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Length !! Reads !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! RunTime !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Machine usage || — || $120 || $132 || per run || — || training and lab storage on BMC servers required.&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || rowspan=&amp;quot;2&amp;quot; | 5M || $381 || $419.10 || rowspan=&amp;quot;9&amp;quot; | per kit || 8h || rowspan=&amp;quot;9&amp;quot; |&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $665 || $731.50 || 16h&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;4&amp;quot; | 25M || $565 || $621.50 || 5h&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $920 || $1,012 || 8h&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $1,125 || $1,238 || 16h&lt;br /&gt;
|-&lt;br /&gt;
| 1000nt || $1,921 || $2,113.10 || 24h&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;2&amp;quot; | 100M || $1,130 || $1,243 || 5h&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $1,638.50 || $1,802.35 || 8h&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || 50M || $1,638.50 || $1,802.35 || 16h&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq classic ====&lt;br /&gt;
&lt;br /&gt;
* MiSeq is off contract and will be retired upon instrument failure&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Length !! Reads !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 70nt || 15M || $1,320 || $1,452 || rowspan=&amp;quot;6&amp;quot; | per lane || rowspan=&amp;quot;6&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| 150nt || 25M || $1,430 || $1,573&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || 15M || $1,595 || $1,754.50&lt;br /&gt;
|-&lt;br /&gt;
| 500nt || 15M || $1,760 || $1,936&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || 25M || $2,200 || $2,420&lt;br /&gt;
|-&lt;br /&gt;
| 500nt || 1M &amp;amp;nbsp;&#039;&#039;&#039;NANO&#039;&#039;&#039; || $770 || $847&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OTHER SHORT READ SERVICES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SHORT READ SUPPORTING SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Quality Control Only -only one QC is included per sequencing lane. || $35 || $38.50 || per sample || Includes RT-PCR and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Quality Control - Use SYBR for sample quantification for pooling instead of qPCR. Only available for pooling. || $15 || $16.50 || per sample || Includes Fluorometric quantification and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (short read) || $25 || $27.50 || per sample || Includes qPCR values from standard QC only&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only - full plate(short read) || $400 || $440 || per plate || excludes column 1 (used for controls)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LONG READ SEQUENCING ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PROMETHION SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $1,200 || $1,320 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PACBIO REVIO SEQUENCING^^ !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| SMRT Cell || $2,900 || $3,190 || per SMRT Cell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== LIBRARY GENERATION ==&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - DNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! colspan=&amp;quot;3&amp;quot; | ILLUMINA Sample Preparation !! colspan=&amp;quot;3&amp;quot; style=&amp;quot;color:blue;&amp;quot; | &amp;amp;nbsp;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;STANDARD THROUGHPUT DNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for individual samples. Repreps will typically be attempted on failed samples without charge. || colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center; color:blue;&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT DNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for sample batches. Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included.&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | LIGATION BASED NEB UltraII || STD || per sample || $105 || $115 || Includes QC, adapter ligation, size selection, barcoding, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 24 || style=&amp;quot;color:blue;&amp;quot; | $900 || style=&amp;quot;color:blue;&amp;quot; | $990 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes adapter ligation, size selection, barcoding, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 96 || style=&amp;quot;color:blue;&amp;quot; | $1,800 || style=&amp;quot;color:blue;&amp;quot; | $1,980&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation &amp;amp;nbsp;&amp;amp;nbsp;NEXTERA-XT || rowspan=&amp;quot;2&amp;quot; | STD || rowspan=&amp;quot;2&amp;quot; | per Sample || $105 || $115 || rowspan=&amp;quot;2&amp;quot; | Includes set-up, tagmentation, indexing, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation &amp;amp;nbsp;&amp;amp;nbsp;NEXTERA-FLEX || $157 || $173&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | NEXTERA-XT OR FLEX || style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $900 || style=&amp;quot;color:blue;&amp;quot; | $990 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes tagmentation, indexing, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,800 || style=&amp;quot;color:blue;&amp;quot; | $1,980&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 16S Amplicon || style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 48 || style=&amp;quot;color:blue;&amp;quot; | $1,900 || style=&amp;quot;color:blue;&amp;quot; | $2,090 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes normalization, enrichment, pooling and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | add&#039;l 48 || style=&amp;quot;color:blue;&amp;quot; | $650 || style=&amp;quot;color:blue;&amp;quot; | $715&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Other Amplicon || style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 48 || style=&amp;quot;color:blue;&amp;quot; | $1,600 || style=&amp;quot;color:blue;&amp;quot; | $1,760 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes normalization, enrichment, pooling and quality control (SYBR and FA). &amp;amp;nbsp;&amp;amp;nbsp;Samples *must* be submitted amplified with appropriate linkers.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | add&#039;l 48 || style=&amp;quot;color:blue;&amp;quot; | $630 || style=&amp;quot;color:blue;&amp;quot; | $693&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Samples not in proper input format will be subject to these additional charges.&lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || || 48 samples || $60 || $66 ||&lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || || per sample || $5 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || || per sample || $10 || $11 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - RNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! colspan=&amp;quot;3&amp;quot; | ILLUMINA Sample Preparation !! colspan=&amp;quot;3&amp;quot; style=&amp;quot;color:blue;&amp;quot; | &amp;amp;nbsp;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;STANDARD RNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for individual samples. Repreps will typically be attempted on failed samples without charge. || colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center; color:blue;&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT RNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. Mixing of multiple projects not recommended.&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | polyA based isolation &amp;amp;nbsp;&amp;amp;nbsp;NEB UltraII RNAseq || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $157 || $173 || Includes QC, polyA isolation, generation of cDNA, library construction, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,500 || style=&amp;quot;color:blue;&amp;quot; | $1,650 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,000 || style=&amp;quot;color:blue;&amp;quot; | $3,300&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | High Throughput 3&#039; Digital Gene Expression (HT3DGE) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,050 || style=&amp;quot;color:blue;&amp;quot; | $1,155 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes generation of cDNA, library construction, indexing and library quality control. Does not include sample QC.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,100 || style=&amp;quot;color:blue;&amp;quot; | $2,310&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Total RNA sequencing &amp;amp;nbsp;&amp;amp;nbsp;NEB RNAseq +Ribodepletion || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $235 || $258.50 || Includes sample QC, ribosomal depletion, generation of cDNA, library construction, indexing and library quality control.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,500 || style=&amp;quot;color:blue;&amp;quot; | $2,750 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $5,000 || style=&amp;quot;color:blue;&amp;quot; | $5,500&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Low Input polyA+ &amp;amp;nbsp;&amp;amp;nbsp;Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;STD&#039;&#039;&#039; v4 || per sample || $262 || $289 || rowspan=&amp;quot;3&amp;quot; | Includes generation of cDNA, amplification, library construction, indexing and quality control (SYBR + FA). Single sample includes initial QC.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,000 || style=&amp;quot;color:blue;&amp;quot; | $2,200&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,200 || style=&amp;quot;color:blue;&amp;quot; | $3,520&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Low Input Mammalian Total &amp;amp;nbsp;&amp;amp;nbsp;Clontech ZapR Kit || STD || per sample || $210 || $231 || Includes generation of cDNA, amplification, library construction, rRNA degradation, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,000 || style=&amp;quot;color:blue;&amp;quot; | $3,300 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $5,000 || style=&amp;quot;color:blue;&amp;quot; | $5,500&lt;br /&gt;
|-&lt;br /&gt;
| Small RNA || STD || per sample || $289 || $318 || Uses NEB, BIOO or QIAGEN small RNA kit&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Samples not in proper input format will be subject to these additional charges.&lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || || 48 samples || $60 || $66 ||&lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || || per sample || $5 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || || per sample || $10 || $11 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
=== LONG READ LIBRARIES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Oxford Nanopore Sample Preparation !! Nanopore Kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit&lt;br /&gt;
|-&lt;br /&gt;
| Standard Ligation || LSK || $160 || $176 || per sample/pool&lt;br /&gt;
|-&lt;br /&gt;
| Native Barcoding &amp;amp;nbsp;&amp;amp;nbsp;(ligation indexing) || - || $50 || $55 || rowspan=&amp;quot;5&amp;quot; | per sample&lt;br /&gt;
|-&lt;br /&gt;
| SMARTseq -&amp;gt; Ligation || Cv4+LSK || $300 || $330&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Prep (tagment - ~10-20kb) || RAD || $150 || $165&lt;br /&gt;
|-&lt;br /&gt;
| Long Insert Prep || RAD (modified, target &amp;gt;100kb) || $262 || $289&lt;br /&gt;
|-&lt;br /&gt;
| Direct RNA || RNA004 || $160 || $176&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PacBio Sample Preparation !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Basic Library || $315 || $346 || Per Library&lt;br /&gt;
|-&lt;br /&gt;
| $157 || $173 || Per add&#039;l Sample&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Genomic Library || $472 || $520 || Per Library&lt;br /&gt;
|-&lt;br /&gt;
| $235 || $258 || Per add&#039;l Sample&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SAMPLE EXTRACTION ==&lt;br /&gt;
&lt;br /&gt;
=== CHEMAGIC360 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! TYPE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| DNA || 96 || $700 || $770 ||&lt;br /&gt;
|-&lt;br /&gt;
| RNA || 96 || $800 || $880 ||&lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 12 samples || $300 || $330 ||&lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 96 samples || $1,000 || $1,100 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SINGLE CELL &amp;amp; SPATIAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== 10X CHROMIUM ===&lt;br /&gt;
&lt;br /&gt;
Please email biomicro@mit.edu two weeks prior to desired submission date so we will have reagents ready for you.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! 10X USAGE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Assisted Service&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;DIGITAL GENE EXPRESSION&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 5&#039; RNA &amp;amp;nbsp;&amp;amp;nbsp;3&#039; RNA || setup || $1,015 || $1,116.50 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $1,750 || $1,925 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 5&#039; RNA &amp;amp;nbsp;&amp;amp;nbsp;3&#039; RNA - on chip multiplexing || setup || $1,150 || $1,265 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per 4 samples || $2,305 || $2,535 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Fixed RNA (Flex v2) &amp;amp;nbsp;&amp;amp;nbsp;probe based. human/mouse only || setup || $2,700 || $2,970 || charge per submission - up to 48 samples&lt;br /&gt;
|-&lt;br /&gt;
| per sample (1-plex) || $270 || $297 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Amplicon (CITE-SEQ, TCR, BCR, antibody barcode, etc // per amplicon) || setup || $470 || $517 || additional prep beyond DGE&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $45 || $50 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;scATACseq&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | ATACseq || setup || $880 || $968 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $1,675 || $1,843 || Includes QC and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;Multiome (ATAC+3&#039;RNA)&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | MULTI || setup || $1,800 || $1,980 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $3,100 || $3,410 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;CANCELLATION&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| per session ||  || $200 || $220 || &amp;lt;24h notice&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=== VISIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SLIDES !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| HD: polyA or FFPE (hs/mm only) || 1 slide / 2 tiles || $7,850 || $8,596 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| QC - FFPE Scroll || per scroll || $60 || $66 || RNA isolation from FFPE scroll&lt;br /&gt;
|-&lt;br /&gt;
| QC - Fresh Frozen Scroll || per scroll || $40 || $44 || RNA isolation from FF scroll&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== AVITI24 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! AVITI24 SPATIAL !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Slide Only || rowspan=&amp;quot;5&amp;quot; | per slide || $150 || $165 || slide: 1, 12, or 48 well&lt;br /&gt;
|-&lt;br /&gt;
| Optimization Only || $800 || $880 || used when the run fails&lt;br /&gt;
|-&lt;br /&gt;
| [https://www.elementbiosciences.com/products/aviti24/cytoprofiling Teton Defined Panel] || $7,200 || $7,920 || scroll to predefined panels&lt;br /&gt;
|-&lt;br /&gt;
| Atlas Short || $5,500 || $6,050 || for CRISPR screens / short sequencing&lt;br /&gt;
|-&lt;br /&gt;
| [https://www.elementbiosciences.com/products/aviti24/cytoprofiling Antibody Add-on] || $360 || $396 || scroll to flexible protein customization&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== OTHER GENOMICS SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== [[BioMicroCenter:QC|QUALITY CONTROL]] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! QUALITY CONTROL !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: RNA or DNA || per sample || $15 || $16.50 ||&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: Preloaded row || per row (12) || $80 || $88 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: RNA or DNA || per sample || $30 || $33 ||&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: Preloaded Row || per row (12) || $160 || $176 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| BioAnalyzer: Walkup Service || per chip || $50 || $55 ||&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (Short read quantification test) || per sample || $25 || $27.50 || 4 point serial dilution&lt;br /&gt;
|-&lt;br /&gt;
| Full plate qPCR (short read quantification test) || per plate || $400 || $440 || full plate only (exclude column 1 for standards) - must be to BMC specifications.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Sample QC services:&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Fresh Frozen Curl || per curl || $40 || $44 ||&lt;br /&gt;
|-&lt;br /&gt;
| FFPE Curl || per curl || $60 || $66 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OLIGO SYNTHESIS ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Platform !! Service !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;6&amp;quot; | DNAscript Syntax || Setup (per run) || $1,000 || $1,100 || Per run cost&lt;br /&gt;
|-&lt;br /&gt;
| 2000 nucleotide synthesis || $500 || $550 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
| 8000 nucleotide synthesis || $1,500 || $1,650 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
| add Biotin (max48) || $115 || $126 || max 48 per run and 2 per oligo. Couple to T only.&lt;br /&gt;
|-&lt;br /&gt;
| add Fluor || $300 || $330 ||&lt;br /&gt;
|-&lt;br /&gt;
| add quench || $100 || $110 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== [[BioMicroCenter:RTPCR|REAL TIME PCR]] ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Roche LightCycler 480 || $15 || per plate || [https://mit.ilabsolutions.com/schedules/261680#/schedule/ CALENDAR] *available for CORE only || Contact [[BioMicroCenter:People|Christopher Hallee]] for training&lt;br /&gt;
|-&lt;br /&gt;
| SYBR Green (KAPA/Roche) || $45 || per ml ||  || Available for MIT only&lt;br /&gt;
|-&lt;br /&gt;
| 96-well PLATES || $10 || per plate ||  || Available for MIT only&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
== OTHER LAB SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;COVARIS SONICATOR&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| COVARIS E220 || $20 || per hour || [https://mit.ilabsolutions.com/equipment/261752/?tab=schedule ilab calendar] || tubes available for purchase.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PIPPIN PREP&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Gel Isolation || $75 || per gel (5 lanes) || TBA ||&lt;br /&gt;
|-&lt;br /&gt;
| Training || $25 || per session || TBA || Contact [[BioMicroCenter:People|Noelani Kamelamela]] for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PLATE READER&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Varioskan || $18 || per hour || [https://mit.ilabsolutions.com/schedules/262715#/schedule/ CALENDAR] || Contact [[BioMicroCenter:People|Noelani Kamelamela]] for training&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;ROBOTICS&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Tecan EVO 150 || $75 || per 1h block - based on scheduled time. || [https://mit.ilabsolutions.com/schedules/262347#/schedule/ CALENDAR] ||&lt;br /&gt;
|-&lt;br /&gt;
| non-filter tips || $8 || per box ||  || ** Please let us know if there is additional plasticware you would like us to stock.&lt;br /&gt;
|-&lt;br /&gt;
| Filter tips || $12.00 || per box ||  ||&lt;br /&gt;
|-&lt;br /&gt;
| Training || $65 || per hour || Contact [[BioMicroCenter:People|Tatum Murdock]] ||&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;NANODROP&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Nanodrop || -- ||  || Walk up service || * no charge&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== COMPUTATIONAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! COMPUTATIONAL SERVICES !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! Other MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Support || per hour || $90 || $125 || Very limited support for non-MIT users&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Share || per 0.1FTE || $1,250 || N/A || MIT only. Priority access to informatics.&lt;br /&gt;
|-&lt;br /&gt;
| Ingenuity Pathway Analysis || per dataset || $100 || $110 || Recovery of licence cost.&lt;br /&gt;
|-&lt;br /&gt;
| Active Data storage || per TB per year || $100 || $300 ||&lt;br /&gt;
|-&lt;br /&gt;
| Tape Archive / Recovery || per tape || $60 || $70 ||&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Training Classes || per session || $50 || $100 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
OLD&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2025 | FY2025 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023b | FY2023-Feb Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023 | FY2023 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2022 | FY2022 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2021 | FY2021 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2019 | FY2019 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2017 | FY2017 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2016 | FY2016 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2015 | FY2015 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2014 | FY2014 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2013 | FY2013 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2012 | FY2012 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2011 | FY2011 Pricing]]&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Pricing&amp;diff=131405</id>
		<title>BioMicroCenter:Pricing</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=BioMicroCenter:Pricing&amp;diff=131405"/>
		<updated>2026-04-27T17:08:31Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* CHEMAGIC360 */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;{{BioMicroCenter}}&lt;br /&gt;
&#039;&#039;&#039;PRICING UPDATE 7/1/2025&#039;&#039;&#039;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - MID OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Element_Sequencing ELEMENT AVITI24] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ELEMENT AVITI SEQUENCING !! Lane/Flowcell !! [[BioMicroCenter:FAQ#NON_MIT_USERS|External Academic]] !! External For-Profit !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 75 PE || Full flowcell (2 lane, 800m read) || $2,375 || $2,660 || per flowcell || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| One lane (~400m read) || $1,250 || $1,400 || per lane&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 150 PE || Full flowcell (2 lane, ~800m read) || $3,312.50 || $3,710 || per flowcell&lt;br /&gt;
|-&lt;br /&gt;
| One lane (~400m read) || $1,719 || $1,925 || per lane&lt;br /&gt;
|-&lt;br /&gt;
| 300 PE || Full flowcell (~200m reads) || $4,375 || $4,900 || per lane&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - LOW OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Singular_Sequencing#Requirements%2FThings_to_Consider SINGULAR G4] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SINGULAR G4 SEQUENCING !! [[BioMicroCenter:FAQ#NON_MIT_USERS|External Academic]] !! External For-Profit !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 50 PE: F3 Lane (~100m reads) || $375 || $420 || per lane || rowspan=&amp;quot;3&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| Rapid 300nt: F3 flowcell (~400m reads)* || $2,250 || $2,520 || per flowcell&lt;br /&gt;
|-&lt;br /&gt;
| 150 PE: F3 Lane (~100m reads) || $562.50 || $630 || per lane&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
* Rapid flowcells are required for adapted Illumina libraries.&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== MISEQ SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Assisted ====&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Length !! Reads !! [[BioMicroCenter:FAQ#NON_MIT_USERS|External Academic]] !! External For-Profit !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || rowspan=&amp;quot;2&amp;quot; | 5M || $893.75 || $1,001 || rowspan=&amp;quot;9&amp;quot; | per flowcell || rowspan=&amp;quot;9&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $1,300 || $1,456&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;4&amp;quot; | 25M || $1,156.25 || $1,295&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $1,667.50 || $1,867.60&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || $1,962.50 || $2,198&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;1000nt&#039;&#039;&#039; || $3,237.50 || $3,626&lt;br /&gt;
|-&lt;br /&gt;
| 100nt || rowspan=&amp;quot;2&amp;quot; | 100M || $1,925 || $2,156&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || $2,656 || $2,975&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || 50M || $2,656 || $2,975&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq classic ====&lt;br /&gt;
&lt;br /&gt;
* MiSeq is off contract and will be retired upon instrument failure&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Length !! Reads !! [[BioMicroCenter:FAQ#NON_MIT_USERS|External Academic]] !! External For-Profit !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 70nt || 15M || $1,650 || $1,848 || rowspan=&amp;quot;6&amp;quot; | per lane || rowspan=&amp;quot;6&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| 150nt || 25M || $1,787.50 || $2,002&lt;br /&gt;
|-&lt;br /&gt;
| 300nt || 15M || $1,993.75 || $2,233&lt;br /&gt;
|-&lt;br /&gt;
| 500nt || 15M || $2,200 || $2,464&lt;br /&gt;
|-&lt;br /&gt;
| 600nt || 25M || $2,750 || $3,080&lt;br /&gt;
|-&lt;br /&gt;
| 500nt || 1M &amp;amp;nbsp;&#039;&#039;&#039;NANO&#039;&#039;&#039; || $962.50 || $1,078&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OTHER SHORT READ SERVICES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SHORT READ SUPPORTING SERVICES !! [[BioMicroCenter:FAQ#NON_MIT_USERS|External Academic]] !! External For-Profit !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Quality Control Only -only one QC is included per sequencing lane. || $43.75 || $49 || per sample || Includes RT-PCR and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Quality Control - Use SYBR for sample quantification for pooling instead of qPCR. Only available for pooling. || $18.75 || $21 || per sample || Includes Fluorometric quantification and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (short read) || $31.25 || $35 || per sample || Includes qPCR values from standard QC only&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only - full plate(short read) || $500 || $560 || per plate || excludes column 1 (used for controls)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LONG READ SEQUENCING ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PROMETHION SEQUENCING !! [[BioMicroCenter:FAQ#NON_MIT_USERS|External Academic]] !! External For-Profit !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $1,500 || $1,680 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== LIBRARY GENERATION ==&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - DNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! colspan=&amp;quot;3&amp;quot; | ILLUMINA Sample Preparation !! colspan=&amp;quot;3&amp;quot; style=&amp;quot;color:blue;&amp;quot; | &amp;amp;nbsp;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;STANDARD THROUGHPUT DNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for individual samples. Repreps will typically be attempted on failed samples without charge. || colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center; color:blue;&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT DNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for sample batches. Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included.&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:FAQ#NON_MIT_USERS|External Academic]] !! External For-Profit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | LIGATION BASED NEB UltraII || STD || per sample || $136.50 || $157 || Includes QC, adapter ligation, size selection, barcoding, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; rowspan=&amp;quot;2&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 24 || style=&amp;quot;color:blue;&amp;quot; | $1,125 || style=&amp;quot;color:blue;&amp;quot; | $1,260 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes adapter ligation, size selection, barcoding, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | 96 || style=&amp;quot;color:blue;&amp;quot; | $2,250 || style=&amp;quot;color:blue;&amp;quot; | $2,520&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation &amp;amp;nbsp;&amp;amp;nbsp;NEXTERA-XT || rowspan=&amp;quot;2&amp;quot; | STD || rowspan=&amp;quot;2&amp;quot; | per Sample || $136.50 || $157 || rowspan=&amp;quot;2&amp;quot; | Includes set-up, tagmentation, indexing, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation &amp;amp;nbsp;&amp;amp;nbsp;NEXTERA-FLEX || $204 || $235&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | NEXTERA-XT OR FLEX || style=&amp;quot;color:blue;&amp;quot; rowspan=&amp;quot;2&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,125 || style=&amp;quot;color:blue;&amp;quot; | $1,260 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes tagmentation, indexing, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,250 || style=&amp;quot;color:blue;&amp;quot; | $2,520&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 16S Amplicon || style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 48 || style=&amp;quot;color:blue;&amp;quot; | $2,375 || style=&amp;quot;color:blue;&amp;quot; | $2,660 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes normalization, enrichment, pooling and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | add&#039;l 48 || style=&amp;quot;color:blue;&amp;quot; | $812.50 || style=&amp;quot;color:blue;&amp;quot; | $910&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Other Amplicon || style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | 48 || style=&amp;quot;color:blue;&amp;quot; | $2,000 || style=&amp;quot;color:blue;&amp;quot; | $2,240 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes normalization, enrichment, pooling and quality control (SYBR and FA). &amp;amp;nbsp;&amp;amp;nbsp;Samples *must* be submitted amplified with appropriate linkers.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | HTL || style=&amp;quot;color:blue;&amp;quot; | add&#039;l 48 || style=&amp;quot;color:blue;&amp;quot; | $787.50 || style=&amp;quot;color:blue;&amp;quot; | $945&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Samples not in proper input format will be subject to these additional charges.&lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || || 48 samples || $75 || $84&lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || || per sample || $6.25 || $7 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || || per sample || $12.50 || $14 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - RNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! colspan=&amp;quot;3&amp;quot; | ILLUMINA Sample Preparation !! colspan=&amp;quot;3&amp;quot; style=&amp;quot;color:blue;&amp;quot; | &amp;amp;nbsp;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;STANDARD RNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Prices for individual samples. Repreps will typically be attempted on failed samples without charge. || colspan=&amp;quot;3&amp;quot; style=&amp;quot;font-weight:bold; text-align:center; color:blue;&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT RNA&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. Mixing of multiple projects not recommended.&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:FAQ#NON_MIT_USERS|External Academic]] !! External For-Profit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | polyA based isolation &amp;amp;nbsp;&amp;amp;nbsp;NEB UltraII RNAseq || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $196.25 || $219.80 || Includes QC, polyA isolation, generation of cDNA, library construction, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | rowspan=&amp;quot;2&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,875 || style=&amp;quot;color:blue;&amp;quot; | $2,100 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,750 || style=&amp;quot;color:blue;&amp;quot; | $4,200&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | High Throughput 3&#039; Digital Gene Expression (HT3DGE) || style=&amp;quot;color:blue;&amp;quot; | rowspan=&amp;quot;2&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $1,312.50 || style=&amp;quot;color:blue;&amp;quot; | $1,470 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes generation of cDNA, library construction, indexing and library quality control. Does not include sample QC.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,625 || style=&amp;quot;color:blue;&amp;quot; | $2,940&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Total RNA sequencing &amp;amp;nbsp;&amp;amp;nbsp;NEB RNAseq +Ribodepletion || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $293.75 || $329 || Includes sample QC, ribosomal depletion, generation of cDNA, library construction, indexing and library quality control.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | rowspan=&amp;quot;2&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,125 || style=&amp;quot;color:blue;&amp;quot; | $3,500 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $6,250 || style=&amp;quot;color:blue;&amp;quot; | $7,000&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Low Input polyA+ &amp;amp;nbsp;&amp;amp;nbsp;Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;STD&#039;&#039;&#039; v4 || per sample || $340.60 || $394 || rowspan=&amp;quot;3&amp;quot; | Includes generation of cDNA, amplification, library construction, indexing and quality control (SYBR + FA). Single sample includes initial QC.&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | rowspan=&amp;quot;2&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $2,500 || style=&amp;quot;color:blue;&amp;quot; | $2,800&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $4,000 || style=&amp;quot;color:blue;&amp;quot; | $4,480&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot; | Low Input Mammalian Total &amp;amp;nbsp;&amp;amp;nbsp;Clontech ZapR Kit || STD || per sample || $273 || $315 || Includes generation of cDNA, amplification, library construction, rRNA degradation, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | rowspan=&amp;quot;2&amp;quot; | &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;24&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $3,750 || style=&amp;quot;color:blue;&amp;quot; | $4,200 || rowspan=&amp;quot;2&amp;quot; style=&amp;quot;color:blue;&amp;quot; | Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| style=&amp;quot;color:blue;&amp;quot; | &#039;&#039;96&#039;&#039; || style=&amp;quot;color:blue;&amp;quot; | $6,250 || style=&amp;quot;color:blue;&amp;quot; | $7,000&lt;br /&gt;
|-&lt;br /&gt;
| Small RNA || STD || per sample || $375.70 || $433 || Uses NEB, BIOO or QIAGEN small RNA kit&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; style=&amp;quot;font-weight:bold; text-align:center;&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039; &amp;amp;nbsp;&amp;amp;nbsp;Samples not in proper input format will be subject to these additional charges.&lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || || 48 samples || $75 || $84&lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || || per sample || $6.25 || $7 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || || per sample || $12.50 || $14 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
=== LONG READ LIBRARIES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Oxford Nanopore Sample Preparation !! Nanopore Kit !! [[BioMicroCenter:FAQ#NON_MIT_USERS|External Academic]] !! External For-Profit !! unit&lt;br /&gt;
|-&lt;br /&gt;
| Standard Ligation || LSK || $200 || $224 || per sample/pool&lt;br /&gt;
|-&lt;br /&gt;
| Native Barcoding &amp;amp;nbsp;&amp;amp;nbsp;(ligation indexing) || - || $65 || $70 || rowspan=&amp;quot;5&amp;quot; | per sample&lt;br /&gt;
|-&lt;br /&gt;
| SMARTseq -&amp;gt; Ligation || Cv4+LSK || $375 || $420&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Prep (tagment - ~10-20kb) || RAD || $188 || $225&lt;br /&gt;
|-&lt;br /&gt;
| Long Insert Prep || RAD (modified, target &amp;gt;100kb) || $340.60 || $393&lt;br /&gt;
|-&lt;br /&gt;
| Direct RNA || RNA004 || $200 || $240&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
== SAMPLE EXTRACTION ==&lt;br /&gt;
&lt;br /&gt;
=== CHEMAGIC360 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! TYPE !! Batch Size !! [[BioMicroCenter:FAQ#NON_MIT_USERS|External Academic]] !! External For-Profit &lt;br /&gt;
|-&lt;br /&gt;
| DNA || 96 || $875 || $980&lt;br /&gt;
|-&lt;br /&gt;
| RNA || 96 || $1,000 || $1,120&lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 12 samples || $375 || $420&lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 96 samples || $1,250 || $1,400&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SINGLE CELL &amp;amp; SPATIAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== 10X CHROMIUM ===&lt;br /&gt;
&lt;br /&gt;
Please email biomicro@mit.edu two weeks prior to desired submission date so we will have reagents ready for you.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! 10X USAGE !! Batch Size !! [[BioMicroCenter:FAQ#NON_MIT_USERS|External Academic]] !! External For-Profit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Assisted Service&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;DIGITAL GENE EXPRESSION&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 5&#039; RNA &amp;amp;nbsp;&amp;amp;nbsp;3&#039; RNA || setup || $1,268.75 || $1,421 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $2,188 || $2,450 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | 5&#039; RNA &amp;amp;nbsp;&amp;amp;nbsp;3&#039; RNA - on chip multiplexing || setup || $1,437.50 || $1,610 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per 4 samples || $2,881 || $3,227 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Fixed RNA (Flex v2) &amp;amp;nbsp;&amp;amp;nbsp;probe based. human/mouse only || setup || $3,375 || $3,780 || charge per submission - up to 48 samples&lt;br /&gt;
|-&lt;br /&gt;
| per sample (1-plex) || $337.50 || $378 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | Amplicon (CITE-SEQ, TCR, BCR, antibody barcode, etc // per amplicon) || setup || $587.50 || $658 || additional prep beyond DGE&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $56 || $63 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;scATACseq&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | ATACseq || setup || $1,100 || $1,232 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $2,094 || $2,345 || Includes QC and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;Multiome (ATAC+3&#039;RNA)&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot; | MULTI || setup || $2,250 || $2,520 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| per sample || $3,875 || $4,340 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;CANCELLATION&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| per session ||  || $250 || $280 || &amp;lt;24h notice&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
=== VISIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SLIDES !! Batch Size !! [[BioMicroCenter:FAQ#NON_MIT_USERS|External Academic]] !! External For-Profit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| HD: polyA or FFPE (hs/mm only) || 1 slide / 2 tiles || $9,813 || $10,940 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| QC - FFPE Scroll || per scroll || $75 || $84 || RNA isolation from FFPE scroll&lt;br /&gt;
|-&lt;br /&gt;
| QC - Fresh Frozen Scroll || per scroll || $56 || $66 || RNA isolation from FF scroll&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== AVITI24 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! AVITI24 SPATIAL !! Batch Size !! [[BioMicroCenter:FAQ#NON_MIT_USERS|External Academic]] !! External For-Profit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Slide Only || rowspan=&amp;quot;5&amp;quot; | per slide || $188 || $210 || slide: 1, 12, or 48 well&lt;br /&gt;
|-&lt;br /&gt;
| Optimization Only || $1,000 || $1,120 || used when the run fails&lt;br /&gt;
|-&lt;br /&gt;
| [https://www.elementbiosciences.com/products/aviti24/cytoprofiling Teton Defined Panel] || $9,000 || $10,080 || scroll to predefined panels&lt;br /&gt;
|-&lt;br /&gt;
| Atlas Short || $6,875 || $7,700 || for CRISPR screens / short sequencing&lt;br /&gt;
|-&lt;br /&gt;
| [https://www.elementbiosciences.com/products/aviti24/cytoprofiling Antibody Add-on] || $450 || $504 || scroll to flexible protein customization&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== OTHER GENOMICS SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== [[BioMicroCenter:QC|QUALITY CONTROL]] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! QUALITY CONTROL !! unit !! [[BioMicroCenter:FAQ#NON_MIT_USERS|External Academic]] !! External For-Profit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: RNA or DNA || per sample || $18.75 || $21&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: Preloaded row || per row (12) || $100 || $112 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: RNA or DNA || per sample || $37.50 || $42&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: Preloaded Row || per row (12) || $200 || $224 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| BioAnalyzer: Walkup Service || per chip || $62.50 || $70&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (Short read quantification test) || per sample || $31.25 || $35 || 4 point serial dilution&lt;br /&gt;
|-&lt;br /&gt;
| Full plate qPCR (short read quantification test) || per plate || $500 || $560 || full plate only (exclude column 1 for standards) - must be to BMC specifications.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Sample QC services:&#039;&#039;&#039;&lt;br /&gt;
|-&lt;br /&gt;
| Fresh Frozen Curl || per curl || $56 || $66 ||&lt;br /&gt;
|-&lt;br /&gt;
| FFPE Curl || per curl || $75 || $84 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OLIGO SYNTHESIS ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Platform !! Service !! [[BioMicroCenter:FAQ#NON_MIT_USERS|External Academic]] !! External For-Profit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;6&amp;quot; | DNAscript Syntax || Setup (per run) || $1,250 || $1,400 || Per run cost&lt;br /&gt;
|-&lt;br /&gt;
| 2000 nucleotide synthesis || $625 || $700 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
| 8000 nucleotide synthesis || $1,875 || $2,100 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
| add Biotin (max48) || $144 || $161 || max 48 per run and 2 per oligo. Couple to T only.&lt;br /&gt;
|-&lt;br /&gt;
| add Fluor || $375 || $420 ||&lt;br /&gt;
|-&lt;br /&gt;
| add quench || $125 || $140 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== COMPUTATIONAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! COMPUTATIONAL SERVICES !! unit !! [[BioMicroCenter:FAQ#NON_MIT_USERS|External Academic]] !! [[BioMicroCenter:FAQ#NON_MIT_USERS|External For-Profit]] !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Support || per hour || $180 || $205 || Very limited support for non-MIT users.&lt;br /&gt;
|}&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131334</id>
		<title>MIT:Pricing</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131334"/>
		<updated>2026-04-15T19:28:00Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* OLIGO SYNTHESIS */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== SEQUENCING - HIGH OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== NOVASEQX / NOVASEQ6000 SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! NOVASEQ SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 100nt || $3,699.00 || $4,068.90 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 300nt** || $5,238.00 || $5,761.80 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 500nt || $7,020.00 || $7,722.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 100nt** || $5,832.00 || $6,415.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 200nt** || $7,452.00 || $8,197.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 300nt** || $8,127.00 || $8,939.70 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 100nt** || $10,395.00 || $11,434.50 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 200nt** || $12,960.00 || $14,256.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 300nt** || $13,500.00 || $14,850.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 50nt &amp;lt;br&amp;gt; Lane**|| $3,780.00 || $4,158.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 300nt &amp;lt;br&amp;gt; Lane**|| $5,400.00 || $5,940.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 150PE &amp;lt;br&amp;gt; Lane^^ || $1,850.00 || $2,000.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 150PE &amp;lt;br&amp;gt; Lane^^ || $2,600.00 || $2,860.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 300nt^^ || $12,160.00 || $13,376.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 300nt^^ || $16,200.00 || $17,820.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 100nt^^ || $5,750.00 || $6,325.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
** - minimal inventory maintained&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - MID OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Element_Sequencing ELEMENT AVITI24] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ELEMENT AVITI SEQUENCING !! Lane/Flowcell !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 75PE / 150nt || Full flowcell (2 lane, ~800M reads) || $1,900.00 || $2,090.00 || per flowcell || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,000.00 || $1,100.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 150PE / 300nt || Full flowcell (2 lane, ~800M reads) || $2,650.00 || $2,915.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,375.00 || $1,513.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 300PE / 600nt || Full flowcell (~200M reads) || $3,500.00 || $3,850.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - LOW OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Singular_Sequencing#Requirements%2FThings_to_Consider SINGULAR G4] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SINGULAR G4 SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 50 PE: F3 Lane (~100M reads) || $300.00 || $330.00 || per lane || rowspan=&amp;quot;3&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| Rapid 300nt: F3 flowcell* || $1,800.00 || $1,980.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
| 150 PE: F3 Lane (~100M reads) || $450.00 || $495.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
* Rapid flowcells are required for adapted Illumina libraries.&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== MISEQ SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Assisted ====&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt || $715.00 || $786.50 &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $1,040.00 || $1,144.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $925.00 || $1,017.50 &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt|| $1,334.00 || $1,467.40 &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,570.00 || $1,727.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt|| $2,590.00 || $2,849.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,540.00 || $1,694.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Walkup ====&lt;br /&gt;
Training and lab storage on BMC servers required. Run must be scheduled in the [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar.]&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 Kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! RunTime &lt;br /&gt;
|-&lt;br /&gt;
| Machine usage || $120.00 || $132.00 || Xh  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt|| $381.00 || $419.10 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $665.00 || $731.50 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $565.00 || $621.50 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt || $920.00 || $1,012.00 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,125.00 || $1,238.00 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt || $1,921.00 || $2,113.10 || 24h &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,130.00 || $1,243.00 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $1,638.50 || $1,802.35 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $1,638.50 || $1,802.35 || 16h &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq classic ====&lt;br /&gt;
&lt;br /&gt;
* MiSeq is off contract and will be retired upon instrument failure&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! MISEQ kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT&lt;br /&gt;
|-&lt;br /&gt;
| 70nt V2 || $1,320.00 || $1,452.00 &lt;br /&gt;
|-&lt;br /&gt;
| 150nt V3 || $1,430.00 || $1,573.00 &lt;br /&gt;
|-&lt;br /&gt;
| 300nt V2 || $1,595.00 || $1,754.50 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt V2 || $1,760.00 || $1,936.00 &lt;br /&gt;
|-&lt;br /&gt;
| 600nt V3  || $2,200.00 || $2,420.00 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt &#039;&#039;&#039;NANO&#039;&#039;&#039; Run  || $770.00 || $847.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OTHER SHORT READ SERVICES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SHORT READ SUPPORTING SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Quality Control Only - only one QC is included per sequencing lane. || $35.00 || $38.50 || per sample || Includes RT-PCR and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Quality Control - Use SYBR for sample quantification for pooling instead of qPCR. Only available for pooling. || $15.00 || $16.50 || per sample || Includes Fluorometric quantification and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (short read) || $25.00 || $27.50 || per sample || Includes qPCR values from standard QC only&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only - full plate (short read) || $400.00 || $440.00 || per plate || excludes column 1 (used for controls)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LONG READ SEQUENCING ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PROMETHION SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $1,200.00 || $1,320.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PACBIO REVIO SEQUENCING^^ !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $2,900.00 || $3,190.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== LIBRARY GENERATION ==&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - CONVERSION ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Input library !! Convert To !! Method !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || Index Overwrite (per sample) || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || P5/P7 conversion (per pool) || $100.00 || $110.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - DNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;STANDARD THROUGHPUT DNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| LIGATION BASED NEB UltraII || STD || per sample || $105.00 || $115.00 || Includes QC, adapter ligation, size selection, barcoding, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT DNA&#039;&#039;&#039;  Prices for sample batches. Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. &lt;br /&gt;
|-&lt;br /&gt;
| HTL NEB UltraII || HTL || 24 || $900.00 || $990.00 || Includes adapter ligation, size selection, barcoding, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-XT || STD || per Sample || $105.00 || $115.00 || Includes set-up, tagmentation, indexing, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-Flex || STD || per Sample || $157.00 || $173.00 &lt;br /&gt;
|-&lt;br /&gt;
| NEXTERA-XT OR FLEX || HTL || 24 || $900.00 || $990.00 || Includes tagmentation, indexing, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| 16S Amplicon || HTL || 48 || $1,900.00 || $2,090.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $650.00 || $715.00 &lt;br /&gt;
|-&lt;br /&gt;
| Other Amplicon || HTL || 48 || $1,600.00 || $1,760.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA). Samples *must* be submitted amplified with appropriate linkers.&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $630.00 || $693.00 &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples submitted not in a plated format will be subject to these additional charges. &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || STD || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || STD || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || STD || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - RNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; |&#039;&#039;&#039;STANDARD RNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| polyA based isolation NEB UltraII RNAseq || STD || per sample || $157.00 || $173.00 || Includes QC, polyA isolation, generation of cDNA, library construction, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || STD || per sample || $235.00 || $258.50 || Includes sample QC, ribosomal depletion, generation of cDNA, library construction, indexing and library quality control.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || STD v4 || per sample || $262.00 || $289.00 || Includes generation of cDNA, amplification, library construction, indexing and quality control (SYBR + FA). Single sample includes initial QC.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || STD || per sample || $210.00 || $231.00 || Includes generation of cDNA, amplification, library construction, rRNA degradation, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Small RNA || STD || per sample || $289.00 || $318.00 || Uses NEB, BIOO or QIAGEN small RNA kit&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT RNA&#039;&#039;&#039;  Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. Mixing of multiple projects not recommended. &lt;br /&gt;
|-&lt;br /&gt;
| polyA NEB UltraII RNAseq || HTL (NEB only) || 24 || $1,500.00 || $1,650.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL (NEB only) || 96 || $3,000.00 || $3,300.00 &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput 3&#039; Digital Gene Expression (HT3DGE) || &#039;&#039;&#039;HTL&#039;&#039;&#039; || 24 || $1,050.00 || $1,155.00 || Includes generation of cDNA, library construction, indexing and library quality control. Does not include sample QC.&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $2,100.00 || $2,310.00 &lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || 24 || $2,500.00 || $2,750.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || 24 || $2,000.00 || $2,200.00 &lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $3,200.00 || $3,520.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || 24 || $3,000.00 || $3,300.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples not in proper input format will be subject to these additional charges. &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || STD || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || STD || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || STD || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
=== LONG READ LIBRARIES ===&lt;br /&gt;
Oxford Nanopore prep methods remain highly experimental and are continually in flux. As such, we can only estimate cost based on reagents/effort and cannot guarantee results. Please consult the core prior to sample submission for the latest information.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Oxford Nanopore Sample Preparation !! Nanopore Kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Standard Ligation || LSK || $160.00 || $176.00 &lt;br /&gt;
|-&lt;br /&gt;
| Native Barcoding (ligation indexing) || - || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| SMARTseq -&amp;gt; Ligation || Cv4+LSK || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| Rapid Prep (tagment - ~10-20kb) || RAD || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Long Insert Prep || RAD (modified, target &amp;gt;100kb) || $262.00 || $289.00 &lt;br /&gt;
|-&lt;br /&gt;
| Direct RNA || RNA004 || $160.00 || $176.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SAMPLE EXTRACTION ==&lt;br /&gt;
&lt;br /&gt;
=== CHEMAGIC360 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! TYPE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| DNA || 96 || $700.00 || $770.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA || 96 || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 12 samples || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 96 samples || $1,000.00 || $1,100.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SINGLE CELL &amp;amp; SPATIAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== 10X CHROMIUM ===&lt;br /&gt;
Please email biomicro@mit.edu two weeks prior to desired submission date so we will have reagents ready for you.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! 10X USAGE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Assisted Service&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;DIGITAL GENE EXPRESSION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - setup || setup || $1,015.00 || $1,116.50 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - per sample || per sample || $1,750.00 || $1,925.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - setup || setup || $1,150.00 || $1,265.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - per 4 samples || per 4 samples || $2,305.00 || $2,535.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) probe based. human/mouse only - setup || setup (up to 48 samples) || $2,700.00 || $2,970.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per sample (1-plex) || per sample || $270.00 || $297.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per 4-plex || per 4 samples || $3,900.00 || $4,290.00 &lt;br /&gt;
|-&lt;br /&gt;
| Amplicon (CITE-SEQ, TCR, BCR, antibody barcode, etc. // per amplicon) - setup || setup || $470.00 || $517.00 || additional prep beyond DGE&lt;br /&gt;
|-&lt;br /&gt;
| Amplicon - per sample || per sample || $45.00 || $50.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;scATACseq&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - setup || setup || $880.00 || $968.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - per sample || per sample || $1,675.00 || $1,843.00 || Includes QC and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;Multiome (ATAC+3&#039;RNA)&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| MULTI - setup || setup || $1,800.00 || $1,980.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| MULTI - per sample || per sample || $3,100.00 || $3,410.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;CANCELLATION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| per session || &amp;lt;24h notice || $200.00 || $220.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== VISIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SLIDES !! Batch Size !! KI Only !! [[BioMicroCenter:CoreDeps|Other CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Test Array || slide || colspan=&amp;quot;2&amp;quot; | $975.00 || $1,071.00 || recommended 1x per tissue type for fresh frozen&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - Fresh Frozen || 1 slide / 4 tiles || colspan=&amp;quot;2&amp;quot; | $6,010.00 || $6,609.00 || Includes H&amp;amp;E stain images + Library Generation&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - FFPE (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $4,550.00 || $4,996.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - HD (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $7,850.00 || $8,596.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| QC - FFPE Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $60.00 || $66.00 || RNA isolation from FFPE scroll&lt;br /&gt;
|-&lt;br /&gt;
| QC - Fresh Frozen Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $40.00 || $44.00 || RNA isolation from FF scroll&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== AVITI24 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! AVITI24 SPATIAL !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Slide Only || per slide || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Optimization Only || per slide || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| Teton Panel || per slide || $7,200.00 || $7,920.00 &lt;br /&gt;
|-&lt;br /&gt;
| Atlas Short || per slide || $5,500.00 || $6,050.00 &lt;br /&gt;
|-&lt;br /&gt;
| Antibody Add-on || per slide || $360.00 || $396.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== OTHER GENOMICS SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== [[BioMicroCenter:QC|QUALITY CONTROL]] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! QUALITY CONTROL !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: RNA or DNA || per sample || $15.00 || $16.50 &lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: Preloaded row || per row (12) || $80.00 || $88.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: RNA or DNA || per sample || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: Preloaded Row || per row (12) || $160.00 || $176.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| BioAnalyzer: Walkup Service || per chip || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (Short read quantification test) || per sample || $25.00 || $27.50 || 4 point serial dilution&lt;br /&gt;
|-&lt;br /&gt;
| Full plate qPCR (short read quantification test) || per plate || $400.00 || $440.00 || full plate only (exclude column 1 for standards) - must be to BMC specifications.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Sample QC services:&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Fresh Frozen Curl || per curl || $40.00 || $44.00 &lt;br /&gt;
|-&lt;br /&gt;
| FFPE Curl || per curl || $60.00 || $66.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OLIGO SYNTHESIS ===&lt;br /&gt;
The Syntax 600 from DNAScript is an oligo synthesizer for oligos at biologically relevant concentrations. &lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Service !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Setup (per run) || $1,000.00 || $1,100.00 || Per run cost&lt;br /&gt;
|-&lt;br /&gt;
| 2000 nucleotide synthesis || $500.00 || $550.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
| 8000 nucleotide synthesis || $1,500.00 || $1,650.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
| add Biotin (max 48) || $115.00 || $126.00 || max 48 per run and 2 per oligo. Couple to T only.&lt;br /&gt;
|-&lt;br /&gt;
| add Fluor || $300.00 || $330.00 ||&lt;br /&gt;
|-&lt;br /&gt;
|  add Quench || $100.00 || $110.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== REAL TIME PCR ==&lt;br /&gt;
&lt;br /&gt;
Email biomicro@mit.edu for training&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! iLabs&lt;br /&gt;
|-&lt;br /&gt;
| Roche LightCycler 480 || $15.00 || per plate ||[https://mit.ilabsolutions.com/schedules/261680#/schedule/ ilab  qPCR calendar]&lt;br /&gt;
|-&lt;br /&gt;
| SYBR Green (KAPA/Roche) || $45.00 || per ml || [https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]&lt;br /&gt;
|-&lt;br /&gt;
| 96-well PLATES || $10.00 || per plate ||[https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]  &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
== OTHER LAB SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;COVARIS SONICATOR&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| COVARIS E220 || $20.00 / $22.00 || per hour || [https://mit.ilabsolutions.com/equipment/261752/?tab=schedule ilab calendar] || tubes available for purchase.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PIPPIN PREP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Gel Isolation || $75.00 / $82.50 || per gel (5 lanes) || TBA &lt;br /&gt;
|-&lt;br /&gt;
| Training || $25.00 / $27.50 || per session || TBA || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PLATE READER&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Varioskan || $18.00 / $20.00 || per hour || [https://mit.ilabsolutions.com/schedules/262715#/schedule/ ilabs plate reader calendar] || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;ROBOTICS&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Tecan EVO 150 || $75.00 / $82.50 || per 1h block - based on scheduled time. || [ &lt;br /&gt;
|-&lt;br /&gt;
| non-filter tips || $8.00 / $8.80 || per box ||  || ** Please let us know if there is additional plasticware you would like us to stock.&lt;br /&gt;
|-&lt;br /&gt;
| Filter tips || $12.00 / $13.20 || per box ||  [https://mit.ilabsolutions.com/service_center/3381/?tab=services services request]&lt;br /&gt;
|-&lt;br /&gt;
| Training || $65.00 / $71.50 || per hour || Email biomicro@mit.edu for training &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;NANODROP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Nanodrop || -- ||  || Walk up service || * no charge&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== COMPUTATIONAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! COMPUTATIONAL SERVICES !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! Other MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Support || per hour || $90.00 || $125.00 || Very limited support for non-MIT users&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Share || per 0.1FTE || $1,250.00 || N/A || MIT only. Priority access to informatics.&lt;br /&gt;
|-&lt;br /&gt;
| Ingenuity Pathway Analysis || per dataset || $100.00 || $110.00 || Recovery of licence cost.&lt;br /&gt;
|-&lt;br /&gt;
| Active Data storage || per TB per year || $100.00 || $300.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Tape Archive / Recovery || per tape || $60.00 || $70.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Training Classes || per session || $50.00 || $100.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
OLD&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2025 | FY2025 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023b | FY2023-Feb Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023 | FY2023 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2022 | FY2022 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2021 | FY2021 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2019 | FY2019 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2017 | FY2017 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2016 | FY2016 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2015 | FY2015 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2014 | FY2014 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2013 | FY2013 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2012 | FY2012 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2011 | FY2011 Pricing]]&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131333</id>
		<title>MIT:Pricing</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131333"/>
		<updated>2026-04-15T18:55:37Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* OLIGO SYNTHESIS */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== SEQUENCING - HIGH OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== NOVASEQX / NOVASEQ6000 SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! NOVASEQ SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 100nt || $3,699.00 || $4,068.90 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 300nt** || $5,238.00 || $5,761.80 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 500nt || $7,020.00 || $7,722.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 100nt** || $5,832.00 || $6,415.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 200nt** || $7,452.00 || $8,197.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 300nt** || $8,127.00 || $8,939.70 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 100nt** || $10,395.00 || $11,434.50 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 200nt** || $12,960.00 || $14,256.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 300nt** || $13,500.00 || $14,850.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 50nt &amp;lt;br&amp;gt; Lane**|| $3,780.00 || $4,158.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 300nt &amp;lt;br&amp;gt; Lane**|| $5,400.00 || $5,940.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 150PE &amp;lt;br&amp;gt; Lane^^ || $1,850.00 || $2,000.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 150PE &amp;lt;br&amp;gt; Lane^^ || $2,600.00 || $2,860.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 300nt^^ || $12,160.00 || $13,376.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 300nt^^ || $16,200.00 || $17,820.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 100nt^^ || $5,750.00 || $6,325.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
** - minimal inventory maintained&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - MID OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Element_Sequencing ELEMENT AVITI24] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ELEMENT AVITI SEQUENCING !! Lane/Flowcell !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 75PE / 150nt || Full flowcell (2 lane, ~800M reads) || $1,900.00 || $2,090.00 || per flowcell || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,000.00 || $1,100.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 150PE / 300nt || Full flowcell (2 lane, ~800M reads) || $2,650.00 || $2,915.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,375.00 || $1,513.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 300PE / 600nt || Full flowcell (~200M reads) || $3,500.00 || $3,850.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - LOW OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Singular_Sequencing#Requirements%2FThings_to_Consider SINGULAR G4] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SINGULAR G4 SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 50 PE: F3 Lane (~100M reads) || $300.00 || $330.00 || per lane || rowspan=&amp;quot;3&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| Rapid 300nt: F3 flowcell* || $1,800.00 || $1,980.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
| 150 PE: F3 Lane (~100M reads) || $450.00 || $495.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
* Rapid flowcells are required for adapted Illumina libraries.&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== MISEQ SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Assisted ====&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt || $715.00 || $786.50 &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $1,040.00 || $1,144.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $925.00 || $1,017.50 &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt|| $1,334.00 || $1,467.40 &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,570.00 || $1,727.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt|| $2,590.00 || $2,849.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,540.00 || $1,694.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Walkup ====&lt;br /&gt;
Training and lab storage on BMC servers required. Run must be scheduled in the [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar.]&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 Kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! RunTime &lt;br /&gt;
|-&lt;br /&gt;
| Machine usage || $120.00 || $132.00 || Xh  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt|| $381.00 || $419.10 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $665.00 || $731.50 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $565.00 || $621.50 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt || $920.00 || $1,012.00 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,125.00 || $1,238.00 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt || $1,921.00 || $2,113.10 || 24h &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,130.00 || $1,243.00 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $1,638.50 || $1,802.35 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $1,638.50 || $1,802.35 || 16h &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq classic ====&lt;br /&gt;
&lt;br /&gt;
* MiSeq is off contract and will be retired upon instrument failure&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! MISEQ kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT&lt;br /&gt;
|-&lt;br /&gt;
| 70nt V2 || $1,320.00 || $1,452.00 &lt;br /&gt;
|-&lt;br /&gt;
| 150nt V3 || $1,430.00 || $1,573.00 &lt;br /&gt;
|-&lt;br /&gt;
| 300nt V2 || $1,595.00 || $1,754.50 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt V2 || $1,760.00 || $1,936.00 &lt;br /&gt;
|-&lt;br /&gt;
| 600nt V3  || $2,200.00 || $2,420.00 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt &#039;&#039;&#039;NANO&#039;&#039;&#039; Run  || $770.00 || $847.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OTHER SHORT READ SERVICES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SHORT READ SUPPORTING SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Quality Control Only - only one QC is included per sequencing lane. || $35.00 || $38.50 || per sample || Includes RT-PCR and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Quality Control - Use SYBR for sample quantification for pooling instead of qPCR. Only available for pooling. || $15.00 || $16.50 || per sample || Includes Fluorometric quantification and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (short read) || $25.00 || $27.50 || per sample || Includes qPCR values from standard QC only&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only - full plate (short read) || $400.00 || $440.00 || per plate || excludes column 1 (used for controls)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LONG READ SEQUENCING ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PROMETHION SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $1,200.00 || $1,320.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PACBIO REVIO SEQUENCING^^ !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $2,900.00 || $3,190.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== LIBRARY GENERATION ==&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - CONVERSION ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Input library !! Convert To !! Method !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || Index Overwrite (per sample) || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || P5/P7 conversion (per pool) || $100.00 || $110.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - DNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;STANDARD THROUGHPUT DNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| LIGATION BASED NEB UltraII || STD || per sample || $105.00 || $115.00 || Includes QC, adapter ligation, size selection, barcoding, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT DNA&#039;&#039;&#039;  Prices for sample batches. Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. &lt;br /&gt;
|-&lt;br /&gt;
| HTL NEB UltraII || HTL || 24 || $900.00 || $990.00 || Includes adapter ligation, size selection, barcoding, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-XT || STD || per Sample || $105.00 || $115.00 || Includes set-up, tagmentation, indexing, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-Flex || STD || per Sample || $157.00 || $173.00 &lt;br /&gt;
|-&lt;br /&gt;
| NEXTERA-XT OR FLEX || HTL || 24 || $900.00 || $990.00 || Includes tagmentation, indexing, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| 16S Amplicon || HTL || 48 || $1,900.00 || $2,090.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $650.00 || $715.00 &lt;br /&gt;
|-&lt;br /&gt;
| Other Amplicon || HTL || 48 || $1,600.00 || $1,760.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA). Samples *must* be submitted amplified with appropriate linkers.&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $630.00 || $693.00 &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples submitted not in a plated format will be subject to these additional charges. &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || STD || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || STD || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || STD || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - RNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; |&#039;&#039;&#039;STANDARD RNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| polyA based isolation NEB UltraII RNAseq || STD || per sample || $157.00 || $173.00 || Includes QC, polyA isolation, generation of cDNA, library construction, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || STD || per sample || $235.00 || $258.50 || Includes sample QC, ribosomal depletion, generation of cDNA, library construction, indexing and library quality control.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || STD v4 || per sample || $262.00 || $289.00 || Includes generation of cDNA, amplification, library construction, indexing and quality control (SYBR + FA). Single sample includes initial QC.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || STD || per sample || $210.00 || $231.00 || Includes generation of cDNA, amplification, library construction, rRNA degradation, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Small RNA || STD || per sample || $289.00 || $318.00 || Uses NEB, BIOO or QIAGEN small RNA kit&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT RNA&#039;&#039;&#039;  Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. Mixing of multiple projects not recommended. &lt;br /&gt;
|-&lt;br /&gt;
| polyA NEB UltraII RNAseq || HTL (NEB only) || 24 || $1,500.00 || $1,650.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL (NEB only) || 96 || $3,000.00 || $3,300.00 &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput 3&#039; Digital Gene Expression (HT3DGE) || &#039;&#039;&#039;HTL&#039;&#039;&#039; || 24 || $1,050.00 || $1,155.00 || Includes generation of cDNA, library construction, indexing and library quality control. Does not include sample QC.&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $2,100.00 || $2,310.00 &lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || 24 || $2,500.00 || $2,750.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || 24 || $2,000.00 || $2,200.00 &lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $3,200.00 || $3,520.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || 24 || $3,000.00 || $3,300.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples not in proper input format will be subject to these additional charges. &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || STD || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || STD || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || STD || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
=== LONG READ LIBRARIES ===&lt;br /&gt;
Oxford Nanopore prep methods remain highly experimental and are continually in flux. As such, we can only estimate cost based on reagents/effort and cannot guarantee results. Please consult the core prior to sample submission for the latest information.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Oxford Nanopore Sample Preparation !! Nanopore Kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Standard Ligation || LSK || $160.00 || $176.00 &lt;br /&gt;
|-&lt;br /&gt;
| Native Barcoding (ligation indexing) || - || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| SMARTseq -&amp;gt; Ligation || Cv4+LSK || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| Rapid Prep (tagment - ~10-20kb) || RAD || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Long Insert Prep || RAD (modified, target &amp;gt;100kb) || $262.00 || $289.00 &lt;br /&gt;
|-&lt;br /&gt;
| Direct RNA || RNA004 || $160.00 || $176.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SAMPLE EXTRACTION ==&lt;br /&gt;
&lt;br /&gt;
=== CHEMAGIC360 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! TYPE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| DNA || 96 || $700.00 || $770.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA || 96 || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 12 samples || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 96 samples || $1,000.00 || $1,100.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SINGLE CELL &amp;amp; SPATIAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== 10X CHROMIUM ===&lt;br /&gt;
Please email biomicro@mit.edu two weeks prior to desired submission date so we will have reagents ready for you.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! 10X USAGE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Assisted Service&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;DIGITAL GENE EXPRESSION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - setup || setup || $1,015.00 || $1,116.50 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - per sample || per sample || $1,750.00 || $1,925.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - setup || setup || $1,150.00 || $1,265.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - per 4 samples || per 4 samples || $2,305.00 || $2,535.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) probe based. human/mouse only - setup || setup (up to 48 samples) || $2,700.00 || $2,970.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per sample (1-plex) || per sample || $270.00 || $297.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per 4-plex || per 4 samples || $3,900.00 || $4,290.00 &lt;br /&gt;
|-&lt;br /&gt;
| Amplicon (CITE-SEQ, TCR, BCR, antibody barcode, etc. // per amplicon) - setup || setup || $470.00 || $517.00 || additional prep beyond DGE&lt;br /&gt;
|-&lt;br /&gt;
| Amplicon - per sample || per sample || $45.00 || $50.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;scATACseq&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - setup || setup || $880.00 || $968.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - per sample || per sample || $1,675.00 || $1,843.00 || Includes QC and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;Multiome (ATAC+3&#039;RNA)&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| MULTI - setup || setup || $1,800.00 || $1,980.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| MULTI - per sample || per sample || $3,100.00 || $3,410.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;CANCELLATION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| per session || &amp;lt;24h notice || $200.00 || $220.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== VISIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SLIDES !! Batch Size !! KI Only !! [[BioMicroCenter:CoreDeps|Other CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Test Array || slide || colspan=&amp;quot;2&amp;quot; | $975.00 || $1,071.00 || recommended 1x per tissue type for fresh frozen&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - Fresh Frozen || 1 slide / 4 tiles || colspan=&amp;quot;2&amp;quot; | $6,010.00 || $6,609.00 || Includes H&amp;amp;E stain images + Library Generation&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - FFPE (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $4,550.00 || $4,996.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - HD (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $7,850.00 || $8,596.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| QC - FFPE Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $60.00 || $66.00 || RNA isolation from FFPE scroll&lt;br /&gt;
|-&lt;br /&gt;
| QC - Fresh Frozen Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $40.00 || $44.00 || RNA isolation from FF scroll&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== AVITI24 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! AVITI24 SPATIAL !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Slide Only || per slide || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Optimization Only || per slide || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| Teton Panel || per slide || $7,200.00 || $7,920.00 &lt;br /&gt;
|-&lt;br /&gt;
| Atlas Short || per slide || $5,500.00 || $6,050.00 &lt;br /&gt;
|-&lt;br /&gt;
| Antibody Add-on || per slide || $360.00 || $396.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== OTHER GENOMICS SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== [[BioMicroCenter:QC|QUALITY CONTROL]] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! QUALITY CONTROL !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: RNA or DNA || per sample || $15.00 || $16.50 &lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: Preloaded row || per row (12) || $80.00 || $88.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: RNA or DNA || per sample || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: Preloaded Row || per row (12) || $160.00 || $176.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| BioAnalyzer: Walkup Service || per chip || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (Short read quantification test) || per sample || $25.00 || $27.50 || 4 point serial dilution&lt;br /&gt;
|-&lt;br /&gt;
| Full plate qPCR (short read quantification test) || per plate || $400.00 || $440.00 || full plate only (exclude column 1 for standards) - must be to BMC specifications.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Sample QC services:&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Fresh Frozen Curl || per curl || $40.00 || $44.00 &lt;br /&gt;
|-&lt;br /&gt;
| FFPE Curl || per curl || $60.00 || $66.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OLIGO SYNTHESIS ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Platform !! Service !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | Dr.Oligo &lt;br /&gt;
|-&lt;br /&gt;
| Assisted || $2,000.00 +consumables || $2,200.00 +consumables || includes setup and run of the instrument only. Large reagents / N2 included.&lt;br /&gt;
|-&lt;br /&gt;
|  || Walkup || $1,000.00 +consumables || $1,100.00 +consumables || includes run of the instrument only. Large reagents / N2 included.&lt;br /&gt;
|-&lt;br /&gt;
|  || Training || $4,000.00 || $4,400.00 || includes two instrument runs.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | DNAscript Syntax&lt;br /&gt;
|-&lt;br /&gt;
| Setup (per run) || $1,000.00 || $1,100.00 || Per run cost&lt;br /&gt;
|-&lt;br /&gt;
|  || 2000 nucleotide synthesis || $500.00 || $550.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
|  || 8000 nucleotide synthesis || $1,500.00 || $1,650.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
|  || add Biotin (max 48) || $115.00 || $126.00 || max 48 per run and 2 per oligo. Couple to T only.&lt;br /&gt;
|-&lt;br /&gt;
|  || add Fluor || $300.00 || $330.00 ||&lt;br /&gt;
|-&lt;br /&gt;
|  || add Quench || $100.00 || $110.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== REAL TIME PCR ==&lt;br /&gt;
&lt;br /&gt;
Email biomicro@mit.edu for training&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! iLabs&lt;br /&gt;
|-&lt;br /&gt;
| Roche LightCycler 480 || $15.00 || per plate ||[https://mit.ilabsolutions.com/schedules/261680#/schedule/ ilab  qPCR calendar]&lt;br /&gt;
|-&lt;br /&gt;
| SYBR Green (KAPA/Roche) || $45.00 || per ml || [https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]&lt;br /&gt;
|-&lt;br /&gt;
| 96-well PLATES || $10.00 || per plate ||[https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]  &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
== OTHER LAB SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;COVARIS SONICATOR&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| COVARIS E220 || $20.00 / $22.00 || per hour || [https://mit.ilabsolutions.com/equipment/261752/?tab=schedule ilab calendar] || tubes available for purchase.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PIPPIN PREP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Gel Isolation || $75.00 / $82.50 || per gel (5 lanes) || TBA &lt;br /&gt;
|-&lt;br /&gt;
| Training || $25.00 / $27.50 || per session || TBA || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PLATE READER&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Varioskan || $18.00 / $20.00 || per hour || [https://mit.ilabsolutions.com/schedules/262715#/schedule/ ilabs plate reader calendar] || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;ROBOTICS&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Tecan EVO 150 || $75.00 / $82.50 || per 1h block - based on scheduled time. || [ &lt;br /&gt;
|-&lt;br /&gt;
| non-filter tips || $8.00 / $8.80 || per box ||  || ** Please let us know if there is additional plasticware you would like us to stock.&lt;br /&gt;
|-&lt;br /&gt;
| Filter tips || $12.00 / $13.20 || per box ||  [https://mit.ilabsolutions.com/service_center/3381/?tab=services services request]&lt;br /&gt;
|-&lt;br /&gt;
| Training || $65.00 / $71.50 || per hour || Email biomicro@mit.edu for training &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;NANODROP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Nanodrop || -- ||  || Walk up service || * no charge&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== COMPUTATIONAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! COMPUTATIONAL SERVICES !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! Other MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Support || per hour || $90.00 || $125.00 || Very limited support for non-MIT users&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Share || per 0.1FTE || $1,250.00 || N/A || MIT only. Priority access to informatics.&lt;br /&gt;
|-&lt;br /&gt;
| Ingenuity Pathway Analysis || per dataset || $100.00 || $110.00 || Recovery of licence cost.&lt;br /&gt;
|-&lt;br /&gt;
| Active Data storage || per TB per year || $100.00 || $300.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Tape Archive / Recovery || per tape || $60.00 || $70.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Training Classes || per session || $50.00 || $100.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
OLD&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2025 | FY2025 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023b | FY2023-Feb Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023 | FY2023 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2022 | FY2022 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2021 | FY2021 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2019 | FY2019 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2017 | FY2017 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2016 | FY2016 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2015 | FY2015 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2014 | FY2014 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2013 | FY2013 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2012 | FY2012 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2011 | FY2011 Pricing]]&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131332</id>
		<title>MIT:Pricing</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131332"/>
		<updated>2026-04-15T18:52:51Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* 10X CHROMIUM */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== SEQUENCING - HIGH OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== NOVASEQX / NOVASEQ6000 SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! NOVASEQ SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 100nt || $3,699.00 || $4,068.90 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 300nt** || $5,238.00 || $5,761.80 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 500nt || $7,020.00 || $7,722.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 100nt** || $5,832.00 || $6,415.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 200nt** || $7,452.00 || $8,197.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 300nt** || $8,127.00 || $8,939.70 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 100nt** || $10,395.00 || $11,434.50 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 200nt** || $12,960.00 || $14,256.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 300nt** || $13,500.00 || $14,850.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 50nt &amp;lt;br&amp;gt; Lane**|| $3,780.00 || $4,158.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 300nt &amp;lt;br&amp;gt; Lane**|| $5,400.00 || $5,940.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 150PE &amp;lt;br&amp;gt; Lane^^ || $1,850.00 || $2,000.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 150PE &amp;lt;br&amp;gt; Lane^^ || $2,600.00 || $2,860.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 300nt^^ || $12,160.00 || $13,376.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 300nt^^ || $16,200.00 || $17,820.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 100nt^^ || $5,750.00 || $6,325.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
** - minimal inventory maintained&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - MID OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Element_Sequencing ELEMENT AVITI24] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ELEMENT AVITI SEQUENCING !! Lane/Flowcell !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 75PE / 150nt || Full flowcell (2 lane, ~800M reads) || $1,900.00 || $2,090.00 || per flowcell || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,000.00 || $1,100.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 150PE / 300nt || Full flowcell (2 lane, ~800M reads) || $2,650.00 || $2,915.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,375.00 || $1,513.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 300PE / 600nt || Full flowcell (~200M reads) || $3,500.00 || $3,850.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - LOW OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Singular_Sequencing#Requirements%2FThings_to_Consider SINGULAR G4] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SINGULAR G4 SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 50 PE: F3 Lane (~100M reads) || $300.00 || $330.00 || per lane || rowspan=&amp;quot;3&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| Rapid 300nt: F3 flowcell* || $1,800.00 || $1,980.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
| 150 PE: F3 Lane (~100M reads) || $450.00 || $495.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
* Rapid flowcells are required for adapted Illumina libraries.&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== MISEQ SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Assisted ====&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt || $715.00 || $786.50 &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $1,040.00 || $1,144.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $925.00 || $1,017.50 &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt|| $1,334.00 || $1,467.40 &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,570.00 || $1,727.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt|| $2,590.00 || $2,849.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,540.00 || $1,694.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Walkup ====&lt;br /&gt;
Training and lab storage on BMC servers required. Run must be scheduled in the [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar.]&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 Kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! RunTime &lt;br /&gt;
|-&lt;br /&gt;
| Machine usage || $120.00 || $132.00 || Xh  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt|| $381.00 || $419.10 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $665.00 || $731.50 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $565.00 || $621.50 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt || $920.00 || $1,012.00 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,125.00 || $1,238.00 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt || $1,921.00 || $2,113.10 || 24h &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,130.00 || $1,243.00 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $1,638.50 || $1,802.35 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $1,638.50 || $1,802.35 || 16h &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq classic ====&lt;br /&gt;
&lt;br /&gt;
* MiSeq is off contract and will be retired upon instrument failure&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! MISEQ kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT&lt;br /&gt;
|-&lt;br /&gt;
| 70nt V2 || $1,320.00 || $1,452.00 &lt;br /&gt;
|-&lt;br /&gt;
| 150nt V3 || $1,430.00 || $1,573.00 &lt;br /&gt;
|-&lt;br /&gt;
| 300nt V2 || $1,595.00 || $1,754.50 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt V2 || $1,760.00 || $1,936.00 &lt;br /&gt;
|-&lt;br /&gt;
| 600nt V3  || $2,200.00 || $2,420.00 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt &#039;&#039;&#039;NANO&#039;&#039;&#039; Run  || $770.00 || $847.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OTHER SHORT READ SERVICES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SHORT READ SUPPORTING SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Quality Control Only - only one QC is included per sequencing lane. || $35.00 || $38.50 || per sample || Includes RT-PCR and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Quality Control - Use SYBR for sample quantification for pooling instead of qPCR. Only available for pooling. || $15.00 || $16.50 || per sample || Includes Fluorometric quantification and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (short read) || $25.00 || $27.50 || per sample || Includes qPCR values from standard QC only&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only - full plate (short read) || $400.00 || $440.00 || per plate || excludes column 1 (used for controls)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LONG READ SEQUENCING ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PROMETHION SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $1,200.00 || $1,320.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PACBIO REVIO SEQUENCING^^ !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $2,900.00 || $3,190.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== LIBRARY GENERATION ==&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - CONVERSION ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Input library !! Convert To !! Method !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || Index Overwrite (per sample) || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || P5/P7 conversion (per pool) || $100.00 || $110.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - DNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;STANDARD THROUGHPUT DNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| LIGATION BASED NEB UltraII || STD || per sample || $105.00 || $115.00 || Includes QC, adapter ligation, size selection, barcoding, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT DNA&#039;&#039;&#039;  Prices for sample batches. Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. &lt;br /&gt;
|-&lt;br /&gt;
| HTL NEB UltraII || HTL || 24 || $900.00 || $990.00 || Includes adapter ligation, size selection, barcoding, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-XT || STD || per Sample || $105.00 || $115.00 || Includes set-up, tagmentation, indexing, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-Flex || STD || per Sample || $157.00 || $173.00 &lt;br /&gt;
|-&lt;br /&gt;
| NEXTERA-XT OR FLEX || HTL || 24 || $900.00 || $990.00 || Includes tagmentation, indexing, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| 16S Amplicon || HTL || 48 || $1,900.00 || $2,090.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $650.00 || $715.00 &lt;br /&gt;
|-&lt;br /&gt;
| Other Amplicon || HTL || 48 || $1,600.00 || $1,760.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA). Samples *must* be submitted amplified with appropriate linkers.&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $630.00 || $693.00 &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples submitted not in a plated format will be subject to these additional charges. &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || STD || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || STD || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || STD || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - RNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; |&#039;&#039;&#039;STANDARD RNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| polyA based isolation NEB UltraII RNAseq || STD || per sample || $157.00 || $173.00 || Includes QC, polyA isolation, generation of cDNA, library construction, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || STD || per sample || $235.00 || $258.50 || Includes sample QC, ribosomal depletion, generation of cDNA, library construction, indexing and library quality control.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || STD v4 || per sample || $262.00 || $289.00 || Includes generation of cDNA, amplification, library construction, indexing and quality control (SYBR + FA). Single sample includes initial QC.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || STD || per sample || $210.00 || $231.00 || Includes generation of cDNA, amplification, library construction, rRNA degradation, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Small RNA || STD || per sample || $289.00 || $318.00 || Uses NEB, BIOO or QIAGEN small RNA kit&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT RNA&#039;&#039;&#039;  Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. Mixing of multiple projects not recommended. &lt;br /&gt;
|-&lt;br /&gt;
| polyA NEB UltraII RNAseq || HTL (NEB only) || 24 || $1,500.00 || $1,650.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL (NEB only) || 96 || $3,000.00 || $3,300.00 &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput 3&#039; Digital Gene Expression (HT3DGE) || &#039;&#039;&#039;HTL&#039;&#039;&#039; || 24 || $1,050.00 || $1,155.00 || Includes generation of cDNA, library construction, indexing and library quality control. Does not include sample QC.&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $2,100.00 || $2,310.00 &lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || 24 || $2,500.00 || $2,750.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || 24 || $2,000.00 || $2,200.00 &lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $3,200.00 || $3,520.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || 24 || $3,000.00 || $3,300.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples not in proper input format will be subject to these additional charges. &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || STD || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || STD || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || STD || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
=== LONG READ LIBRARIES ===&lt;br /&gt;
Oxford Nanopore prep methods remain highly experimental and are continually in flux. As such, we can only estimate cost based on reagents/effort and cannot guarantee results. Please consult the core prior to sample submission for the latest information.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Oxford Nanopore Sample Preparation !! Nanopore Kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Standard Ligation || LSK || $160.00 || $176.00 &lt;br /&gt;
|-&lt;br /&gt;
| Native Barcoding (ligation indexing) || - || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| SMARTseq -&amp;gt; Ligation || Cv4+LSK || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| Rapid Prep (tagment - ~10-20kb) || RAD || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Long Insert Prep || RAD (modified, target &amp;gt;100kb) || $262.00 || $289.00 &lt;br /&gt;
|-&lt;br /&gt;
| Direct RNA || RNA004 || $160.00 || $176.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SAMPLE EXTRACTION ==&lt;br /&gt;
&lt;br /&gt;
=== CHEMAGIC360 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! TYPE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| DNA || 96 || $700.00 || $770.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA || 96 || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 12 samples || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 96 samples || $1,000.00 || $1,100.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SINGLE CELL &amp;amp; SPATIAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== 10X CHROMIUM ===&lt;br /&gt;
Please email biomicro@mit.edu two weeks prior to desired submission date so we will have reagents ready for you.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! 10X USAGE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Assisted Service&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;DIGITAL GENE EXPRESSION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - setup || setup || $1,015.00 || $1,116.50 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - per sample || per sample || $1,750.00 || $1,925.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - setup || setup || $1,150.00 || $1,265.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - per 4 samples || per 4 samples || $2,305.00 || $2,535.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) probe based. human/mouse only - setup || setup (up to 48 samples) || $2,700.00 || $2,970.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per sample (1-plex) || per sample || $270.00 || $297.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per 4-plex || per 4 samples || $3,900.00 || $4,290.00 &lt;br /&gt;
|-&lt;br /&gt;
| Amplicon (CITE-SEQ, TCR, BCR, antibody barcode, etc. // per amplicon) - setup || setup || $470.00 || $517.00 || additional prep beyond DGE&lt;br /&gt;
|-&lt;br /&gt;
| Amplicon - per sample || per sample || $45.00 || $50.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;scATACseq&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - setup || setup || $880.00 || $968.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - per sample || per sample || $1,675.00 || $1,843.00 || Includes QC and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;Multiome (ATAC+3&#039;RNA)&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| MULTI - setup || setup || $1,800.00 || $1,980.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| MULTI - per sample || per sample || $3,100.00 || $3,410.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;CANCELLATION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| per session || &amp;lt;24h notice || $200.00 || $220.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== VISIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SLIDES !! Batch Size !! KI Only !! [[BioMicroCenter:CoreDeps|Other CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Test Array || slide || colspan=&amp;quot;2&amp;quot; | $975.00 || $1,071.00 || recommended 1x per tissue type for fresh frozen&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - Fresh Frozen || 1 slide / 4 tiles || colspan=&amp;quot;2&amp;quot; | $6,010.00 || $6,609.00 || Includes H&amp;amp;E stain images + Library Generation&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - FFPE (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $4,550.00 || $4,996.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - HD (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $7,850.00 || $8,596.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| QC - FFPE Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $60.00 || $66.00 || RNA isolation from FFPE scroll&lt;br /&gt;
|-&lt;br /&gt;
| QC - Fresh Frozen Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $40.00 || $44.00 || RNA isolation from FF scroll&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== AVITI24 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! AVITI24 SPATIAL !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Slide Only || per slide || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Optimization Only || per slide || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| Teton Panel || per slide || $7,200.00 || $7,920.00 &lt;br /&gt;
|-&lt;br /&gt;
| Atlas Short || per slide || $5,500.00 || $6,050.00 &lt;br /&gt;
|-&lt;br /&gt;
| Antibody Add-on || per slide || $360.00 || $396.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== OTHER GENOMICS SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== [[BioMicroCenter:QC|QUALITY CONTROL]] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! QUALITY CONTROL !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: RNA or DNA || per sample || $15.00 || $16.50 &lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: Preloaded row || per row (12) || $80.00 || $88.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: RNA or DNA || per sample || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: Preloaded Row || per row (12) || $160.00 || $176.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| BioAnalyzer: Walkup Service || per chip || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (Short read quantification test) || per sample || $25.00 || $27.50 || 4 point serial dilution&lt;br /&gt;
|-&lt;br /&gt;
| Full plate qPCR (short read quantification test) || per plate || $400.00 || $440.00 || full plate only (exclude column 1 for standards) - must be to BMC specifications.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Sample QC services:&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Fresh Frozen Curl || per curl || $40.00 || $44.00 &lt;br /&gt;
|-&lt;br /&gt;
| FFPE Curl || per curl || $60.00 || $66.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OLIGO SYNTHESIS ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Platform !! Service !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Dr.Oligo || Assisted || $2,000.00 +consumables || $2,200.00 +consumables || includes setup and run of the instrument only. Large reagents / N2 included.&lt;br /&gt;
|-&lt;br /&gt;
|  || Walkup || $1,000.00 +consumables || $1,100.00 +consumables || includes run of the instrument only. Large reagents / N2 included.&lt;br /&gt;
|-&lt;br /&gt;
|  || Training || $4,000.00 || $4,400.00 || includes two instrument runs.&lt;br /&gt;
|-&lt;br /&gt;
| DNAscript Syntax || Setup (per run) || $1,000.00 || $1,100.00 || Per run cost&lt;br /&gt;
|-&lt;br /&gt;
|  || 2000 nucleotide synthesis || $500.00 || $550.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
|  || 8000 nucleotide synthesis || $1,500.00 || $1,650.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
|  || add Biotin (max 48) || $115.00 || $126.00 || max 48 per run and 2 per oligo. Couple to T only.&lt;br /&gt;
|-&lt;br /&gt;
|  || add Fluor || $300.00 || $330.00 ||&lt;br /&gt;
|-&lt;br /&gt;
|  || add Quench || $100.00 || $110.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== REAL TIME PCR ==&lt;br /&gt;
&lt;br /&gt;
Email biomicro@mit.edu for training&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! iLabs&lt;br /&gt;
|-&lt;br /&gt;
| Roche LightCycler 480 || $15.00 || per plate ||[https://mit.ilabsolutions.com/schedules/261680#/schedule/ ilab  qPCR calendar]&lt;br /&gt;
|-&lt;br /&gt;
| SYBR Green (KAPA/Roche) || $45.00 || per ml || [https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]&lt;br /&gt;
|-&lt;br /&gt;
| 96-well PLATES || $10.00 || per plate ||[https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]  &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
== OTHER LAB SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;COVARIS SONICATOR&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| COVARIS E220 || $20.00 / $22.00 || per hour || [https://mit.ilabsolutions.com/equipment/261752/?tab=schedule ilab calendar] || tubes available for purchase.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PIPPIN PREP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Gel Isolation || $75.00 / $82.50 || per gel (5 lanes) || TBA &lt;br /&gt;
|-&lt;br /&gt;
| Training || $25.00 / $27.50 || per session || TBA || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PLATE READER&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Varioskan || $18.00 / $20.00 || per hour || [https://mit.ilabsolutions.com/schedules/262715#/schedule/ ilabs plate reader calendar] || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;ROBOTICS&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Tecan EVO 150 || $75.00 / $82.50 || per 1h block - based on scheduled time. || [ &lt;br /&gt;
|-&lt;br /&gt;
| non-filter tips || $8.00 / $8.80 || per box ||  || ** Please let us know if there is additional plasticware you would like us to stock.&lt;br /&gt;
|-&lt;br /&gt;
| Filter tips || $12.00 / $13.20 || per box ||  [https://mit.ilabsolutions.com/service_center/3381/?tab=services services request]&lt;br /&gt;
|-&lt;br /&gt;
| Training || $65.00 / $71.50 || per hour || Email biomicro@mit.edu for training &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;NANODROP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Nanodrop || -- ||  || Walk up service || * no charge&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== COMPUTATIONAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! COMPUTATIONAL SERVICES !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! Other MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Support || per hour || $90.00 || $125.00 || Very limited support for non-MIT users&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Share || per 0.1FTE || $1,250.00 || N/A || MIT only. Priority access to informatics.&lt;br /&gt;
|-&lt;br /&gt;
| Ingenuity Pathway Analysis || per dataset || $100.00 || $110.00 || Recovery of licence cost.&lt;br /&gt;
|-&lt;br /&gt;
| Active Data storage || per TB per year || $100.00 || $300.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Tape Archive / Recovery || per tape || $60.00 || $70.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Training Classes || per session || $50.00 || $100.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
OLD&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2025 | FY2025 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023b | FY2023-Feb Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023 | FY2023 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2022 | FY2022 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2021 | FY2021 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2019 | FY2019 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2017 | FY2017 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2016 | FY2016 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2015 | FY2015 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2014 | FY2014 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2013 | FY2013 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2012 | FY2012 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2011 | FY2011 Pricing]]&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131331</id>
		<title>MIT:Pricing</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131331"/>
		<updated>2026-04-15T18:51:21Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* LONG READ LIBRARIES */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== SEQUENCING - HIGH OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== NOVASEQX / NOVASEQ6000 SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! NOVASEQ SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 100nt || $3,699.00 || $4,068.90 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 300nt** || $5,238.00 || $5,761.80 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 500nt || $7,020.00 || $7,722.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 100nt** || $5,832.00 || $6,415.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 200nt** || $7,452.00 || $8,197.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 300nt** || $8,127.00 || $8,939.70 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 100nt** || $10,395.00 || $11,434.50 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 200nt** || $12,960.00 || $14,256.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 300nt** || $13,500.00 || $14,850.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 50nt &amp;lt;br&amp;gt; Lane**|| $3,780.00 || $4,158.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 300nt &amp;lt;br&amp;gt; Lane**|| $5,400.00 || $5,940.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 150PE &amp;lt;br&amp;gt; Lane^^ || $1,850.00 || $2,000.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 150PE &amp;lt;br&amp;gt; Lane^^ || $2,600.00 || $2,860.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 300nt^^ || $12,160.00 || $13,376.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 300nt^^ || $16,200.00 || $17,820.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 100nt^^ || $5,750.00 || $6,325.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
** - minimal inventory maintained&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - MID OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Element_Sequencing ELEMENT AVITI24] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ELEMENT AVITI SEQUENCING !! Lane/Flowcell !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 75PE / 150nt || Full flowcell (2 lane, ~800M reads) || $1,900.00 || $2,090.00 || per flowcell || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,000.00 || $1,100.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 150PE / 300nt || Full flowcell (2 lane, ~800M reads) || $2,650.00 || $2,915.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,375.00 || $1,513.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 300PE / 600nt || Full flowcell (~200M reads) || $3,500.00 || $3,850.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - LOW OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Singular_Sequencing#Requirements%2FThings_to_Consider SINGULAR G4] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SINGULAR G4 SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 50 PE: F3 Lane (~100M reads) || $300.00 || $330.00 || per lane || rowspan=&amp;quot;3&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| Rapid 300nt: F3 flowcell* || $1,800.00 || $1,980.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
| 150 PE: F3 Lane (~100M reads) || $450.00 || $495.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
* Rapid flowcells are required for adapted Illumina libraries.&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== MISEQ SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Assisted ====&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt || $715.00 || $786.50 &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $1,040.00 || $1,144.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $925.00 || $1,017.50 &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt|| $1,334.00 || $1,467.40 &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,570.00 || $1,727.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt|| $2,590.00 || $2,849.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,540.00 || $1,694.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Walkup ====&lt;br /&gt;
Training and lab storage on BMC servers required. Run must be scheduled in the [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar.]&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 Kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! RunTime &lt;br /&gt;
|-&lt;br /&gt;
| Machine usage || $120.00 || $132.00 || Xh  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt|| $381.00 || $419.10 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $665.00 || $731.50 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $565.00 || $621.50 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt || $920.00 || $1,012.00 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,125.00 || $1,238.00 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt || $1,921.00 || $2,113.10 || 24h &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,130.00 || $1,243.00 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $1,638.50 || $1,802.35 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $1,638.50 || $1,802.35 || 16h &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq classic ====&lt;br /&gt;
&lt;br /&gt;
* MiSeq is off contract and will be retired upon instrument failure&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! MISEQ kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT&lt;br /&gt;
|-&lt;br /&gt;
| 70nt V2 || $1,320.00 || $1,452.00 &lt;br /&gt;
|-&lt;br /&gt;
| 150nt V3 || $1,430.00 || $1,573.00 &lt;br /&gt;
|-&lt;br /&gt;
| 300nt V2 || $1,595.00 || $1,754.50 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt V2 || $1,760.00 || $1,936.00 &lt;br /&gt;
|-&lt;br /&gt;
| 600nt V3  || $2,200.00 || $2,420.00 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt &#039;&#039;&#039;NANO&#039;&#039;&#039; Run  || $770.00 || $847.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OTHER SHORT READ SERVICES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SHORT READ SUPPORTING SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Quality Control Only - only one QC is included per sequencing lane. || $35.00 || $38.50 || per sample || Includes RT-PCR and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Quality Control - Use SYBR for sample quantification for pooling instead of qPCR. Only available for pooling. || $15.00 || $16.50 || per sample || Includes Fluorometric quantification and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (short read) || $25.00 || $27.50 || per sample || Includes qPCR values from standard QC only&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only - full plate (short read) || $400.00 || $440.00 || per plate || excludes column 1 (used for controls)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LONG READ SEQUENCING ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PROMETHION SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $1,200.00 || $1,320.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PACBIO REVIO SEQUENCING^^ !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $2,900.00 || $3,190.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== LIBRARY GENERATION ==&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - CONVERSION ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Input library !! Convert To !! Method !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || Index Overwrite (per sample) || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || P5/P7 conversion (per pool) || $100.00 || $110.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - DNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;STANDARD THROUGHPUT DNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| LIGATION BASED NEB UltraII || STD || per sample || $105.00 || $115.00 || Includes QC, adapter ligation, size selection, barcoding, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT DNA&#039;&#039;&#039;  Prices for sample batches. Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. &lt;br /&gt;
|-&lt;br /&gt;
| HTL NEB UltraII || HTL || 24 || $900.00 || $990.00 || Includes adapter ligation, size selection, barcoding, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-XT || STD || per Sample || $105.00 || $115.00 || Includes set-up, tagmentation, indexing, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-Flex || STD || per Sample || $157.00 || $173.00 &lt;br /&gt;
|-&lt;br /&gt;
| NEXTERA-XT OR FLEX || HTL || 24 || $900.00 || $990.00 || Includes tagmentation, indexing, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| 16S Amplicon || HTL || 48 || $1,900.00 || $2,090.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $650.00 || $715.00 &lt;br /&gt;
|-&lt;br /&gt;
| Other Amplicon || HTL || 48 || $1,600.00 || $1,760.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA). Samples *must* be submitted amplified with appropriate linkers.&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $630.00 || $693.00 &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples submitted not in a plated format will be subject to these additional charges. &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || STD || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || STD || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || STD || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - RNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; |&#039;&#039;&#039;STANDARD RNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| polyA based isolation NEB UltraII RNAseq || STD || per sample || $157.00 || $173.00 || Includes QC, polyA isolation, generation of cDNA, library construction, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || STD || per sample || $235.00 || $258.50 || Includes sample QC, ribosomal depletion, generation of cDNA, library construction, indexing and library quality control.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || STD v4 || per sample || $262.00 || $289.00 || Includes generation of cDNA, amplification, library construction, indexing and quality control (SYBR + FA). Single sample includes initial QC.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || STD || per sample || $210.00 || $231.00 || Includes generation of cDNA, amplification, library construction, rRNA degradation, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Small RNA || STD || per sample || $289.00 || $318.00 || Uses NEB, BIOO or QIAGEN small RNA kit&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT RNA&#039;&#039;&#039;  Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. Mixing of multiple projects not recommended. &lt;br /&gt;
|-&lt;br /&gt;
| polyA NEB UltraII RNAseq || HTL (NEB only) || 24 || $1,500.00 || $1,650.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL (NEB only) || 96 || $3,000.00 || $3,300.00 &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput 3&#039; Digital Gene Expression (HT3DGE) || &#039;&#039;&#039;HTL&#039;&#039;&#039; || 24 || $1,050.00 || $1,155.00 || Includes generation of cDNA, library construction, indexing and library quality control. Does not include sample QC.&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $2,100.00 || $2,310.00 &lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || 24 || $2,500.00 || $2,750.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || 24 || $2,000.00 || $2,200.00 &lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $3,200.00 || $3,520.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || 24 || $3,000.00 || $3,300.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples not in proper input format will be subject to these additional charges. &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || STD || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || STD || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || STD || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
=== LONG READ LIBRARIES ===&lt;br /&gt;
Oxford Nanopore prep methods remain highly experimental and are continually in flux. As such, we can only estimate cost based on reagents/effort and cannot guarantee results. Please consult the core prior to sample submission for the latest information.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Oxford Nanopore Sample Preparation !! Nanopore Kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Standard Ligation || LSK || $160.00 || $176.00 &lt;br /&gt;
|-&lt;br /&gt;
| Native Barcoding (ligation indexing) || - || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| SMARTseq -&amp;gt; Ligation || Cv4+LSK || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| Rapid Prep (tagment - ~10-20kb) || RAD || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Long Insert Prep || RAD (modified, target &amp;gt;100kb) || $262.00 || $289.00 &lt;br /&gt;
|-&lt;br /&gt;
| Direct RNA || RNA004 || $160.00 || $176.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SAMPLE EXTRACTION ==&lt;br /&gt;
&lt;br /&gt;
=== CHEMAGIC360 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! TYPE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| DNA || 96 || $700.00 || $770.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA || 96 || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 12 samples || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 96 samples || $1,000.00 || $1,100.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SINGLE CELL &amp;amp; SPATIAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== 10X CHROMIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! 10X USAGE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Assisted Service&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;DIGITAL GENE EXPRESSION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - setup || setup || $1,015.00 || $1,116.50 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - per sample || per sample || $1,750.00 || $1,925.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - setup || setup || $1,150.00 || $1,265.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - per 4 samples || per 4 samples || $2,305.00 || $2,535.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) probe based. human/mouse only - setup || setup (up to 48 samples) || $2,700.00 || $2,970.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per sample (1-plex) || per sample || $270.00 || $297.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per 4-plex || per 4 samples || $3,900.00 || $4,290.00 &lt;br /&gt;
|-&lt;br /&gt;
| Amplicon (CITE-SEQ, TCR, BCR, antibody barcode, etc. // per amplicon) - setup || setup || $470.00 || $517.00 || additional prep beyond DGE&lt;br /&gt;
|-&lt;br /&gt;
| Amplicon - per sample || per sample || $45.00 || $50.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;scATACseq&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - setup || setup || $880.00 || $968.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - per sample || per sample || $1,675.00 || $1,843.00 || Includes QC and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;Multiome (ATAC+3&#039;RNA)&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| MULTI - setup || setup || $1,800.00 || $1,980.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| MULTI - per sample || per sample || $3,100.00 || $3,410.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;CANCELLATION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| per session || &amp;lt;24h notice || $200.00 || $220.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
* please let BMC know if you plan to run this method early so we will have reagents ready for you.&lt;br /&gt;
&lt;br /&gt;
=== VISIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SLIDES !! Batch Size !! KI Only !! [[BioMicroCenter:CoreDeps|Other CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Test Array || slide || colspan=&amp;quot;2&amp;quot; | $975.00 || $1,071.00 || recommended 1x per tissue type for fresh frozen&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - Fresh Frozen || 1 slide / 4 tiles || colspan=&amp;quot;2&amp;quot; | $6,010.00 || $6,609.00 || Includes H&amp;amp;E stain images + Library Generation&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - FFPE (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $4,550.00 || $4,996.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - HD (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $7,850.00 || $8,596.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| QC - FFPE Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $60.00 || $66.00 || RNA isolation from FFPE scroll&lt;br /&gt;
|-&lt;br /&gt;
| QC - Fresh Frozen Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $40.00 || $44.00 || RNA isolation from FF scroll&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== AVITI24 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! AVITI24 SPATIAL !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Slide Only || per slide || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Optimization Only || per slide || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| Teton Panel || per slide || $7,200.00 || $7,920.00 &lt;br /&gt;
|-&lt;br /&gt;
| Atlas Short || per slide || $5,500.00 || $6,050.00 &lt;br /&gt;
|-&lt;br /&gt;
| Antibody Add-on || per slide || $360.00 || $396.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== OTHER GENOMICS SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== [[BioMicroCenter:QC|QUALITY CONTROL]] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! QUALITY CONTROL !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: RNA or DNA || per sample || $15.00 || $16.50 &lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: Preloaded row || per row (12) || $80.00 || $88.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: RNA or DNA || per sample || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: Preloaded Row || per row (12) || $160.00 || $176.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| BioAnalyzer: Walkup Service || per chip || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (Short read quantification test) || per sample || $25.00 || $27.50 || 4 point serial dilution&lt;br /&gt;
|-&lt;br /&gt;
| Full plate qPCR (short read quantification test) || per plate || $400.00 || $440.00 || full plate only (exclude column 1 for standards) - must be to BMC specifications.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Sample QC services:&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Fresh Frozen Curl || per curl || $40.00 || $44.00 &lt;br /&gt;
|-&lt;br /&gt;
| FFPE Curl || per curl || $60.00 || $66.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OLIGO SYNTHESIS ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Platform !! Service !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Dr.Oligo || Assisted || $2,000.00 +consumables || $2,200.00 +consumables || includes setup and run of the instrument only. Large reagents / N2 included.&lt;br /&gt;
|-&lt;br /&gt;
|  || Walkup || $1,000.00 +consumables || $1,100.00 +consumables || includes run of the instrument only. Large reagents / N2 included.&lt;br /&gt;
|-&lt;br /&gt;
|  || Training || $4,000.00 || $4,400.00 || includes two instrument runs.&lt;br /&gt;
|-&lt;br /&gt;
| DNAscript Syntax || Setup (per run) || $1,000.00 || $1,100.00 || Per run cost&lt;br /&gt;
|-&lt;br /&gt;
|  || 2000 nucleotide synthesis || $500.00 || $550.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
|  || 8000 nucleotide synthesis || $1,500.00 || $1,650.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
|  || add Biotin (max 48) || $115.00 || $126.00 || max 48 per run and 2 per oligo. Couple to T only.&lt;br /&gt;
|-&lt;br /&gt;
|  || add Fluor || $300.00 || $330.00 ||&lt;br /&gt;
|-&lt;br /&gt;
|  || add Quench || $100.00 || $110.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== REAL TIME PCR ==&lt;br /&gt;
&lt;br /&gt;
Email biomicro@mit.edu for training&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! iLabs&lt;br /&gt;
|-&lt;br /&gt;
| Roche LightCycler 480 || $15.00 || per plate ||[https://mit.ilabsolutions.com/schedules/261680#/schedule/ ilab  qPCR calendar]&lt;br /&gt;
|-&lt;br /&gt;
| SYBR Green (KAPA/Roche) || $45.00 || per ml || [https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]&lt;br /&gt;
|-&lt;br /&gt;
| 96-well PLATES || $10.00 || per plate ||[https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]  &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
== OTHER LAB SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;COVARIS SONICATOR&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| COVARIS E220 || $20.00 / $22.00 || per hour || [https://mit.ilabsolutions.com/equipment/261752/?tab=schedule ilab calendar] || tubes available for purchase.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PIPPIN PREP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Gel Isolation || $75.00 / $82.50 || per gel (5 lanes) || TBA &lt;br /&gt;
|-&lt;br /&gt;
| Training || $25.00 / $27.50 || per session || TBA || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PLATE READER&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Varioskan || $18.00 / $20.00 || per hour || [https://mit.ilabsolutions.com/schedules/262715#/schedule/ ilabs plate reader calendar] || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;ROBOTICS&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Tecan EVO 150 || $75.00 / $82.50 || per 1h block - based on scheduled time. || [ &lt;br /&gt;
|-&lt;br /&gt;
| non-filter tips || $8.00 / $8.80 || per box ||  || ** Please let us know if there is additional plasticware you would like us to stock.&lt;br /&gt;
|-&lt;br /&gt;
| Filter tips || $12.00 / $13.20 || per box ||  [https://mit.ilabsolutions.com/service_center/3381/?tab=services services request]&lt;br /&gt;
|-&lt;br /&gt;
| Training || $65.00 / $71.50 || per hour || Email biomicro@mit.edu for training &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;NANODROP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Nanodrop || -- ||  || Walk up service || * no charge&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== COMPUTATIONAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! COMPUTATIONAL SERVICES !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! Other MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Support || per hour || $90.00 || $125.00 || Very limited support for non-MIT users&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Share || per 0.1FTE || $1,250.00 || N/A || MIT only. Priority access to informatics.&lt;br /&gt;
|-&lt;br /&gt;
| Ingenuity Pathway Analysis || per dataset || $100.00 || $110.00 || Recovery of licence cost.&lt;br /&gt;
|-&lt;br /&gt;
| Active Data storage || per TB per year || $100.00 || $300.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Tape Archive / Recovery || per tape || $60.00 || $70.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Training Classes || per session || $50.00 || $100.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
OLD&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2025 | FY2025 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023b | FY2023-Feb Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023 | FY2023 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2022 | FY2022 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2021 | FY2021 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2019 | FY2019 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2017 | FY2017 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2016 | FY2016 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2015 | FY2015 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2014 | FY2014 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2013 | FY2013 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2012 | FY2012 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2011 | FY2011 Pricing]]&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131330</id>
		<title>MIT:Pricing</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131330"/>
		<updated>2026-04-15T18:50:20Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* NOVASEQX / NOVASEQ6000 SEQUENCING */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== SEQUENCING - HIGH OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== NOVASEQX / NOVASEQ6000 SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! NOVASEQ SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 100nt || $3,699.00 || $4,068.90 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 300nt** || $5,238.00 || $5,761.80 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 500nt || $7,020.00 || $7,722.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 100nt** || $5,832.00 || $6,415.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 200nt** || $7,452.00 || $8,197.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 300nt** || $8,127.00 || $8,939.70 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 100nt** || $10,395.00 || $11,434.50 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 200nt** || $12,960.00 || $14,256.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 300nt** || $13,500.00 || $14,850.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 50nt &amp;lt;br&amp;gt; Lane**|| $3,780.00 || $4,158.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 300nt &amp;lt;br&amp;gt; Lane**|| $5,400.00 || $5,940.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 150PE &amp;lt;br&amp;gt; Lane^^ || $1,850.00 || $2,000.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 150PE &amp;lt;br&amp;gt; Lane^^ || $2,600.00 || $2,860.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 300nt^^ || $12,160.00 || $13,376.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 300nt^^ || $16,200.00 || $17,820.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 100nt^^ || $5,750.00 || $6,325.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
** - minimal inventory maintained&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - MID OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Element_Sequencing ELEMENT AVITI24] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ELEMENT AVITI SEQUENCING !! Lane/Flowcell !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 75PE / 150nt || Full flowcell (2 lane, ~800M reads) || $1,900.00 || $2,090.00 || per flowcell || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,000.00 || $1,100.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 150PE / 300nt || Full flowcell (2 lane, ~800M reads) || $2,650.00 || $2,915.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,375.00 || $1,513.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 300PE / 600nt || Full flowcell (~200M reads) || $3,500.00 || $3,850.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - LOW OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Singular_Sequencing#Requirements%2FThings_to_Consider SINGULAR G4] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SINGULAR G4 SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 50 PE: F3 Lane (~100M reads) || $300.00 || $330.00 || per lane || rowspan=&amp;quot;3&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| Rapid 300nt: F3 flowcell* || $1,800.00 || $1,980.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
| 150 PE: F3 Lane (~100M reads) || $450.00 || $495.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
* Rapid flowcells are required for adapted Illumina libraries.&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== MISEQ SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Assisted ====&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt || $715.00 || $786.50 &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $1,040.00 || $1,144.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $925.00 || $1,017.50 &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt|| $1,334.00 || $1,467.40 &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,570.00 || $1,727.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt|| $2,590.00 || $2,849.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,540.00 || $1,694.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Walkup ====&lt;br /&gt;
Training and lab storage on BMC servers required. Run must be scheduled in the [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar.]&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 Kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! RunTime &lt;br /&gt;
|-&lt;br /&gt;
| Machine usage || $120.00 || $132.00 || Xh  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt|| $381.00 || $419.10 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $665.00 || $731.50 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $565.00 || $621.50 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt || $920.00 || $1,012.00 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,125.00 || $1,238.00 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt || $1,921.00 || $2,113.10 || 24h &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,130.00 || $1,243.00 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $1,638.50 || $1,802.35 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $1,638.50 || $1,802.35 || 16h &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq classic ====&lt;br /&gt;
&lt;br /&gt;
* MiSeq is off contract and will be retired upon instrument failure&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! MISEQ kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT&lt;br /&gt;
|-&lt;br /&gt;
| 70nt V2 || $1,320.00 || $1,452.00 &lt;br /&gt;
|-&lt;br /&gt;
| 150nt V3 || $1,430.00 || $1,573.00 &lt;br /&gt;
|-&lt;br /&gt;
| 300nt V2 || $1,595.00 || $1,754.50 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt V2 || $1,760.00 || $1,936.00 &lt;br /&gt;
|-&lt;br /&gt;
| 600nt V3  || $2,200.00 || $2,420.00 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt &#039;&#039;&#039;NANO&#039;&#039;&#039; Run  || $770.00 || $847.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OTHER SHORT READ SERVICES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SHORT READ SUPPORTING SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Quality Control Only - only one QC is included per sequencing lane. || $35.00 || $38.50 || per sample || Includes RT-PCR and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Quality Control - Use SYBR for sample quantification for pooling instead of qPCR. Only available for pooling. || $15.00 || $16.50 || per sample || Includes Fluorometric quantification and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (short read) || $25.00 || $27.50 || per sample || Includes qPCR values from standard QC only&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only - full plate (short read) || $400.00 || $440.00 || per plate || excludes column 1 (used for controls)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LONG READ SEQUENCING ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PROMETHION SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $1,200.00 || $1,320.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PACBIO REVIO SEQUENCING^^ !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $2,900.00 || $3,190.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== LIBRARY GENERATION ==&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - CONVERSION ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Input library !! Convert To !! Method !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || Index Overwrite (per sample) || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || P5/P7 conversion (per pool) || $100.00 || $110.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - DNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;STANDARD THROUGHPUT DNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| LIGATION BASED NEB UltraII || STD || per sample || $105.00 || $115.00 || Includes QC, adapter ligation, size selection, barcoding, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT DNA&#039;&#039;&#039;  Prices for sample batches. Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. &lt;br /&gt;
|-&lt;br /&gt;
| HTL NEB UltraII || HTL || 24 || $900.00 || $990.00 || Includes adapter ligation, size selection, barcoding, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-XT || STD || per Sample || $105.00 || $115.00 || Includes set-up, tagmentation, indexing, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-Flex || STD || per Sample || $157.00 || $173.00 &lt;br /&gt;
|-&lt;br /&gt;
| NEXTERA-XT OR FLEX || HTL || 24 || $900.00 || $990.00 || Includes tagmentation, indexing, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| 16S Amplicon || HTL || 48 || $1,900.00 || $2,090.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $650.00 || $715.00 &lt;br /&gt;
|-&lt;br /&gt;
| Other Amplicon || HTL || 48 || $1,600.00 || $1,760.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA). Samples *must* be submitted amplified with appropriate linkers.&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $630.00 || $693.00 &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples submitted not in a plated format will be subject to these additional charges. &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || STD || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || STD || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || STD || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - RNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; |&#039;&#039;&#039;STANDARD RNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| polyA based isolation NEB UltraII RNAseq || STD || per sample || $157.00 || $173.00 || Includes QC, polyA isolation, generation of cDNA, library construction, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || STD || per sample || $235.00 || $258.50 || Includes sample QC, ribosomal depletion, generation of cDNA, library construction, indexing and library quality control.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || STD v4 || per sample || $262.00 || $289.00 || Includes generation of cDNA, amplification, library construction, indexing and quality control (SYBR + FA). Single sample includes initial QC.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || STD || per sample || $210.00 || $231.00 || Includes generation of cDNA, amplification, library construction, rRNA degradation, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Small RNA || STD || per sample || $289.00 || $318.00 || Uses NEB, BIOO or QIAGEN small RNA kit&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT RNA&#039;&#039;&#039;  Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. Mixing of multiple projects not recommended. &lt;br /&gt;
|-&lt;br /&gt;
| polyA NEB UltraII RNAseq || HTL (NEB only) || 24 || $1,500.00 || $1,650.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL (NEB only) || 96 || $3,000.00 || $3,300.00 &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput 3&#039; Digital Gene Expression (HT3DGE) || &#039;&#039;&#039;HTL&#039;&#039;&#039; || 24 || $1,050.00 || $1,155.00 || Includes generation of cDNA, library construction, indexing and library quality control. Does not include sample QC.&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $2,100.00 || $2,310.00 &lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || 24 || $2,500.00 || $2,750.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || 24 || $2,000.00 || $2,200.00 &lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $3,200.00 || $3,520.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || 24 || $3,000.00 || $3,300.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples not in proper input format will be subject to these additional charges. &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || STD || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || STD || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || STD || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
=== LONG READ LIBRARIES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Oxford Nanopore Sample Preparation !! Nanopore Kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Standard Ligation || LSK || $160.00 || $176.00 || rowspan=&amp;quot;6&amp;quot; | Oxford Nanopore prep methods remain highly experimental and are continually in flux. As such, we can only estimate cost based on reagents/effort and cannot guarantee results. Please consult the core prior to sample submission for the latest information.&lt;br /&gt;
|-&lt;br /&gt;
| Native Barcoding (ligation indexing) || - || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| SMARTseq -&amp;gt; Ligation || Cv4+LSK || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| Rapid Prep (tagment - ~10-20kb) || RAD || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Long Insert Prep || RAD (modified, target &amp;gt;100kb) || $262.00 || $289.00 &lt;br /&gt;
|-&lt;br /&gt;
| Direct RNA || RNA004 || $160.00 || $176.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SAMPLE EXTRACTION ==&lt;br /&gt;
&lt;br /&gt;
=== CHEMAGIC360 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! TYPE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| DNA || 96 || $700.00 || $770.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA || 96 || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 12 samples || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 96 samples || $1,000.00 || $1,100.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SINGLE CELL &amp;amp; SPATIAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== 10X CHROMIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! 10X USAGE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Assisted Service&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;DIGITAL GENE EXPRESSION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - setup || setup || $1,015.00 || $1,116.50 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - per sample || per sample || $1,750.00 || $1,925.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - setup || setup || $1,150.00 || $1,265.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - per 4 samples || per 4 samples || $2,305.00 || $2,535.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) probe based. human/mouse only - setup || setup (up to 48 samples) || $2,700.00 || $2,970.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per sample (1-plex) || per sample || $270.00 || $297.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per 4-plex || per 4 samples || $3,900.00 || $4,290.00 &lt;br /&gt;
|-&lt;br /&gt;
| Amplicon (CITE-SEQ, TCR, BCR, antibody barcode, etc. // per amplicon) - setup || setup || $470.00 || $517.00 || additional prep beyond DGE&lt;br /&gt;
|-&lt;br /&gt;
| Amplicon - per sample || per sample || $45.00 || $50.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;scATACseq&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - setup || setup || $880.00 || $968.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - per sample || per sample || $1,675.00 || $1,843.00 || Includes QC and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;Multiome (ATAC+3&#039;RNA)&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| MULTI - setup || setup || $1,800.00 || $1,980.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| MULTI - per sample || per sample || $3,100.00 || $3,410.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;CANCELLATION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| per session || &amp;lt;24h notice || $200.00 || $220.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
* please let BMC know if you plan to run this method early so we will have reagents ready for you.&lt;br /&gt;
&lt;br /&gt;
=== VISIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SLIDES !! Batch Size !! KI Only !! [[BioMicroCenter:CoreDeps|Other CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Test Array || slide || colspan=&amp;quot;2&amp;quot; | $975.00 || $1,071.00 || recommended 1x per tissue type for fresh frozen&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - Fresh Frozen || 1 slide / 4 tiles || colspan=&amp;quot;2&amp;quot; | $6,010.00 || $6,609.00 || Includes H&amp;amp;E stain images + Library Generation&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - FFPE (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $4,550.00 || $4,996.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - HD (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $7,850.00 || $8,596.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| QC - FFPE Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $60.00 || $66.00 || RNA isolation from FFPE scroll&lt;br /&gt;
|-&lt;br /&gt;
| QC - Fresh Frozen Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $40.00 || $44.00 || RNA isolation from FF scroll&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== AVITI24 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! AVITI24 SPATIAL !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Slide Only || per slide || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Optimization Only || per slide || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| Teton Panel || per slide || $7,200.00 || $7,920.00 &lt;br /&gt;
|-&lt;br /&gt;
| Atlas Short || per slide || $5,500.00 || $6,050.00 &lt;br /&gt;
|-&lt;br /&gt;
| Antibody Add-on || per slide || $360.00 || $396.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== OTHER GENOMICS SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== [[BioMicroCenter:QC|QUALITY CONTROL]] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! QUALITY CONTROL !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: RNA or DNA || per sample || $15.00 || $16.50 &lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: Preloaded row || per row (12) || $80.00 || $88.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: RNA or DNA || per sample || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: Preloaded Row || per row (12) || $160.00 || $176.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| BioAnalyzer: Walkup Service || per chip || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (Short read quantification test) || per sample || $25.00 || $27.50 || 4 point serial dilution&lt;br /&gt;
|-&lt;br /&gt;
| Full plate qPCR (short read quantification test) || per plate || $400.00 || $440.00 || full plate only (exclude column 1 for standards) - must be to BMC specifications.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Sample QC services:&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Fresh Frozen Curl || per curl || $40.00 || $44.00 &lt;br /&gt;
|-&lt;br /&gt;
| FFPE Curl || per curl || $60.00 || $66.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OLIGO SYNTHESIS ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Platform !! Service !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Dr.Oligo || Assisted || $2,000.00 +consumables || $2,200.00 +consumables || includes setup and run of the instrument only. Large reagents / N2 included.&lt;br /&gt;
|-&lt;br /&gt;
|  || Walkup || $1,000.00 +consumables || $1,100.00 +consumables || includes run of the instrument only. Large reagents / N2 included.&lt;br /&gt;
|-&lt;br /&gt;
|  || Training || $4,000.00 || $4,400.00 || includes two instrument runs.&lt;br /&gt;
|-&lt;br /&gt;
| DNAscript Syntax || Setup (per run) || $1,000.00 || $1,100.00 || Per run cost&lt;br /&gt;
|-&lt;br /&gt;
|  || 2000 nucleotide synthesis || $500.00 || $550.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
|  || 8000 nucleotide synthesis || $1,500.00 || $1,650.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
|  || add Biotin (max 48) || $115.00 || $126.00 || max 48 per run and 2 per oligo. Couple to T only.&lt;br /&gt;
|-&lt;br /&gt;
|  || add Fluor || $300.00 || $330.00 ||&lt;br /&gt;
|-&lt;br /&gt;
|  || add Quench || $100.00 || $110.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== REAL TIME PCR ==&lt;br /&gt;
&lt;br /&gt;
Email biomicro@mit.edu for training&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! iLabs&lt;br /&gt;
|-&lt;br /&gt;
| Roche LightCycler 480 || $15.00 || per plate ||[https://mit.ilabsolutions.com/schedules/261680#/schedule/ ilab  qPCR calendar]&lt;br /&gt;
|-&lt;br /&gt;
| SYBR Green (KAPA/Roche) || $45.00 || per ml || [https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]&lt;br /&gt;
|-&lt;br /&gt;
| 96-well PLATES || $10.00 || per plate ||[https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]  &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
== OTHER LAB SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;COVARIS SONICATOR&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| COVARIS E220 || $20.00 / $22.00 || per hour || [https://mit.ilabsolutions.com/equipment/261752/?tab=schedule ilab calendar] || tubes available for purchase.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PIPPIN PREP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Gel Isolation || $75.00 / $82.50 || per gel (5 lanes) || TBA &lt;br /&gt;
|-&lt;br /&gt;
| Training || $25.00 / $27.50 || per session || TBA || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PLATE READER&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Varioskan || $18.00 / $20.00 || per hour || [https://mit.ilabsolutions.com/schedules/262715#/schedule/ ilabs plate reader calendar] || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;ROBOTICS&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Tecan EVO 150 || $75.00 / $82.50 || per 1h block - based on scheduled time. || [ &lt;br /&gt;
|-&lt;br /&gt;
| non-filter tips || $8.00 / $8.80 || per box ||  || ** Please let us know if there is additional plasticware you would like us to stock.&lt;br /&gt;
|-&lt;br /&gt;
| Filter tips || $12.00 / $13.20 || per box ||  [https://mit.ilabsolutions.com/service_center/3381/?tab=services services request]&lt;br /&gt;
|-&lt;br /&gt;
| Training || $65.00 / $71.50 || per hour || Email biomicro@mit.edu for training &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;NANODROP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Nanodrop || -- ||  || Walk up service || * no charge&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== COMPUTATIONAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! COMPUTATIONAL SERVICES !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! Other MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Support || per hour || $90.00 || $125.00 || Very limited support for non-MIT users&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Share || per 0.1FTE || $1,250.00 || N/A || MIT only. Priority access to informatics.&lt;br /&gt;
|-&lt;br /&gt;
| Ingenuity Pathway Analysis || per dataset || $100.00 || $110.00 || Recovery of licence cost.&lt;br /&gt;
|-&lt;br /&gt;
| Active Data storage || per TB per year || $100.00 || $300.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Tape Archive / Recovery || per tape || $60.00 || $70.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Training Classes || per session || $50.00 || $100.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
OLD&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2025 | FY2025 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023b | FY2023-Feb Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023 | FY2023 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2022 | FY2022 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2021 | FY2021 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2019 | FY2019 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2017 | FY2017 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2016 | FY2016 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2015 | FY2015 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2014 | FY2014 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2013 | FY2013 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2012 | FY2012 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2011 | FY2011 Pricing]]&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131329</id>
		<title>MIT:Pricing</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131329"/>
		<updated>2026-04-15T18:50:12Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* NOVASEQX / NOVASEQ6000 SEQUENCING */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== SEQUENCING - HIGH OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== NOVASEQX / NOVASEQ6000 SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! NOVASEQ SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 100nt || $3,699.00 || $4,068.90 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 300nt** || $5,238.00 || $5,761.80 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 500nt || $7,020.00 || $7,722.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 100nt** || $5,832.00 || $6,415.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 200nt** || $7,452.00 || $8,197.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 300nt** || $8,127.00 || $8,939.70 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 100nt** || $10,395.00 || $11,434.50 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 200nt** || $12,960.00 || $14,256.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 300nt** || $13,500.00 || $14,850.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 50nt &amp;lt;br&amp;gt; Lane**|| $3,780.00 || $4,158.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 300nt &amp;lt;br&amp;gt; Lane**|| $5,400.00 || $5,940.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 150PE &amp;lt;br&amp;gt; Lane^^ || $1,850.00 || $2,000.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 150PE &amp;lt;br&amp;gt; Lane^^ || $2,600.00 || $2,860.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 300nt^^ || $12,160.00 || $13,376.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 300nt^^ || $16,200.00 || $17,820.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 100nt^^ || $5,750.00 || $6,325.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
** - minimal inventory maintained&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - MID OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Element_Sequencing ELEMENT AVITI24] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ELEMENT AVITI SEQUENCING !! Lane/Flowcell !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 75PE / 150nt || Full flowcell (2 lane, ~800M reads) || $1,900.00 || $2,090.00 || per flowcell || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,000.00 || $1,100.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 150PE / 300nt || Full flowcell (2 lane, ~800M reads) || $2,650.00 || $2,915.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,375.00 || $1,513.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 300PE / 600nt || Full flowcell (~200M reads) || $3,500.00 || $3,850.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - LOW OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Singular_Sequencing#Requirements%2FThings_to_Consider SINGULAR G4] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SINGULAR G4 SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 50 PE: F3 Lane (~100M reads) || $300.00 || $330.00 || per lane || rowspan=&amp;quot;3&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| Rapid 300nt: F3 flowcell* || $1,800.00 || $1,980.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
| 150 PE: F3 Lane (~100M reads) || $450.00 || $495.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
* Rapid flowcells are required for adapted Illumina libraries.&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== MISEQ SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Assisted ====&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt || $715.00 || $786.50 &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $1,040.00 || $1,144.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $925.00 || $1,017.50 &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt|| $1,334.00 || $1,467.40 &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,570.00 || $1,727.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt|| $2,590.00 || $2,849.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,540.00 || $1,694.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Walkup ====&lt;br /&gt;
Training and lab storage on BMC servers required. Run must be scheduled in the [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar.]&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 Kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! RunTime &lt;br /&gt;
|-&lt;br /&gt;
| Machine usage || $120.00 || $132.00 || Xh  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt|| $381.00 || $419.10 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $665.00 || $731.50 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $565.00 || $621.50 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt || $920.00 || $1,012.00 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,125.00 || $1,238.00 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt || $1,921.00 || $2,113.10 || 24h &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,130.00 || $1,243.00 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $1,638.50 || $1,802.35 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $1,638.50 || $1,802.35 || 16h &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq classic ====&lt;br /&gt;
&lt;br /&gt;
* MiSeq is off contract and will be retired upon instrument failure&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! MISEQ kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT&lt;br /&gt;
|-&lt;br /&gt;
| 70nt V2 || $1,320.00 || $1,452.00 &lt;br /&gt;
|-&lt;br /&gt;
| 150nt V3 || $1,430.00 || $1,573.00 &lt;br /&gt;
|-&lt;br /&gt;
| 300nt V2 || $1,595.00 || $1,754.50 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt V2 || $1,760.00 || $1,936.00 &lt;br /&gt;
|-&lt;br /&gt;
| 600nt V3  || $2,200.00 || $2,420.00 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt &#039;&#039;&#039;NANO&#039;&#039;&#039; Run  || $770.00 || $847.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OTHER SHORT READ SERVICES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SHORT READ SUPPORTING SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Quality Control Only - only one QC is included per sequencing lane. || $35.00 || $38.50 || per sample || Includes RT-PCR and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Quality Control - Use SYBR for sample quantification for pooling instead of qPCR. Only available for pooling. || $15.00 || $16.50 || per sample || Includes Fluorometric quantification and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (short read) || $25.00 || $27.50 || per sample || Includes qPCR values from standard QC only&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only - full plate (short read) || $400.00 || $440.00 || per plate || excludes column 1 (used for controls)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LONG READ SEQUENCING ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PROMETHION SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $1,200.00 || $1,320.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PACBIO REVIO SEQUENCING^^ !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $2,900.00 || $3,190.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== LIBRARY GENERATION ==&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - CONVERSION ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Input library !! Convert To !! Method !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || Index Overwrite (per sample) || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || P5/P7 conversion (per pool) || $100.00 || $110.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - DNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;STANDARD THROUGHPUT DNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| LIGATION BASED NEB UltraII || STD || per sample || $105.00 || $115.00 || Includes QC, adapter ligation, size selection, barcoding, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT DNA&#039;&#039;&#039;  Prices for sample batches. Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. &lt;br /&gt;
|-&lt;br /&gt;
| HTL NEB UltraII || HTL || 24 || $900.00 || $990.00 || Includes adapter ligation, size selection, barcoding, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-XT || STD || per Sample || $105.00 || $115.00 || Includes set-up, tagmentation, indexing, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-Flex || STD || per Sample || $157.00 || $173.00 &lt;br /&gt;
|-&lt;br /&gt;
| NEXTERA-XT OR FLEX || HTL || 24 || $900.00 || $990.00 || Includes tagmentation, indexing, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| 16S Amplicon || HTL || 48 || $1,900.00 || $2,090.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $650.00 || $715.00 &lt;br /&gt;
|-&lt;br /&gt;
| Other Amplicon || HTL || 48 || $1,600.00 || $1,760.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA). Samples *must* be submitted amplified with appropriate linkers.&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $630.00 || $693.00 &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples submitted not in a plated format will be subject to these additional charges. &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || STD || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || STD || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || STD || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - RNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; |&#039;&#039;&#039;STANDARD RNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| polyA based isolation NEB UltraII RNAseq || STD || per sample || $157.00 || $173.00 || Includes QC, polyA isolation, generation of cDNA, library construction, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || STD || per sample || $235.00 || $258.50 || Includes sample QC, ribosomal depletion, generation of cDNA, library construction, indexing and library quality control.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || STD v4 || per sample || $262.00 || $289.00 || Includes generation of cDNA, amplification, library construction, indexing and quality control (SYBR + FA). Single sample includes initial QC.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || STD || per sample || $210.00 || $231.00 || Includes generation of cDNA, amplification, library construction, rRNA degradation, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Small RNA || STD || per sample || $289.00 || $318.00 || Uses NEB, BIOO or QIAGEN small RNA kit&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT RNA&#039;&#039;&#039;  Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. Mixing of multiple projects not recommended. &lt;br /&gt;
|-&lt;br /&gt;
| polyA NEB UltraII RNAseq || HTL (NEB only) || 24 || $1,500.00 || $1,650.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL (NEB only) || 96 || $3,000.00 || $3,300.00 &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput 3&#039; Digital Gene Expression (HT3DGE) || &#039;&#039;&#039;HTL&#039;&#039;&#039; || 24 || $1,050.00 || $1,155.00 || Includes generation of cDNA, library construction, indexing and library quality control. Does not include sample QC.&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $2,100.00 || $2,310.00 &lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || 24 || $2,500.00 || $2,750.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || 24 || $2,000.00 || $2,200.00 &lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $3,200.00 || $3,520.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || 24 || $3,000.00 || $3,300.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples not in proper input format will be subject to these additional charges. &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || STD || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || STD || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || STD || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
=== LONG READ LIBRARIES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Oxford Nanopore Sample Preparation !! Nanopore Kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Standard Ligation || LSK || $160.00 || $176.00 || rowspan=&amp;quot;6&amp;quot; | Oxford Nanopore prep methods remain highly experimental and are continually in flux. As such, we can only estimate cost based on reagents/effort and cannot guarantee results. Please consult the core prior to sample submission for the latest information.&lt;br /&gt;
|-&lt;br /&gt;
| Native Barcoding (ligation indexing) || - || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| SMARTseq -&amp;gt; Ligation || Cv4+LSK || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| Rapid Prep (tagment - ~10-20kb) || RAD || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Long Insert Prep || RAD (modified, target &amp;gt;100kb) || $262.00 || $289.00 &lt;br /&gt;
|-&lt;br /&gt;
| Direct RNA || RNA004 || $160.00 || $176.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SAMPLE EXTRACTION ==&lt;br /&gt;
&lt;br /&gt;
=== CHEMAGIC360 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! TYPE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| DNA || 96 || $700.00 || $770.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA || 96 || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 12 samples || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 96 samples || $1,000.00 || $1,100.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SINGLE CELL &amp;amp; SPATIAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== 10X CHROMIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! 10X USAGE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Assisted Service&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;DIGITAL GENE EXPRESSION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - setup || setup || $1,015.00 || $1,116.50 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - per sample || per sample || $1,750.00 || $1,925.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - setup || setup || $1,150.00 || $1,265.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - per 4 samples || per 4 samples || $2,305.00 || $2,535.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) probe based. human/mouse only - setup || setup (up to 48 samples) || $2,700.00 || $2,970.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per sample (1-plex) || per sample || $270.00 || $297.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per 4-plex || per 4 samples || $3,900.00 || $4,290.00 &lt;br /&gt;
|-&lt;br /&gt;
| Amplicon (CITE-SEQ, TCR, BCR, antibody barcode, etc. // per amplicon) - setup || setup || $470.00 || $517.00 || additional prep beyond DGE&lt;br /&gt;
|-&lt;br /&gt;
| Amplicon - per sample || per sample || $45.00 || $50.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;scATACseq&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - setup || setup || $880.00 || $968.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - per sample || per sample || $1,675.00 || $1,843.00 || Includes QC and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;Multiome (ATAC+3&#039;RNA)&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| MULTI - setup || setup || $1,800.00 || $1,980.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| MULTI - per sample || per sample || $3,100.00 || $3,410.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;CANCELLATION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| per session || &amp;lt;24h notice || $200.00 || $220.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
* please let BMC know if you plan to run this method early so we will have reagents ready for you.&lt;br /&gt;
&lt;br /&gt;
=== VISIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SLIDES !! Batch Size !! KI Only !! [[BioMicroCenter:CoreDeps|Other CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Test Array || slide || colspan=&amp;quot;2&amp;quot; | $975.00 || $1,071.00 || recommended 1x per tissue type for fresh frozen&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - Fresh Frozen || 1 slide / 4 tiles || colspan=&amp;quot;2&amp;quot; | $6,010.00 || $6,609.00 || Includes H&amp;amp;E stain images + Library Generation&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - FFPE (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $4,550.00 || $4,996.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - HD (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $7,850.00 || $8,596.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| QC - FFPE Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $60.00 || $66.00 || RNA isolation from FFPE scroll&lt;br /&gt;
|-&lt;br /&gt;
| QC - Fresh Frozen Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $40.00 || $44.00 || RNA isolation from FF scroll&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== AVITI24 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! AVITI24 SPATIAL !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Slide Only || per slide || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Optimization Only || per slide || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| Teton Panel || per slide || $7,200.00 || $7,920.00 &lt;br /&gt;
|-&lt;br /&gt;
| Atlas Short || per slide || $5,500.00 || $6,050.00 &lt;br /&gt;
|-&lt;br /&gt;
| Antibody Add-on || per slide || $360.00 || $396.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== OTHER GENOMICS SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== [[BioMicroCenter:QC|QUALITY CONTROL]] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! QUALITY CONTROL !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: RNA or DNA || per sample || $15.00 || $16.50 &lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: Preloaded row || per row (12) || $80.00 || $88.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: RNA or DNA || per sample || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: Preloaded Row || per row (12) || $160.00 || $176.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| BioAnalyzer: Walkup Service || per chip || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (Short read quantification test) || per sample || $25.00 || $27.50 || 4 point serial dilution&lt;br /&gt;
|-&lt;br /&gt;
| Full plate qPCR (short read quantification test) || per plate || $400.00 || $440.00 || full plate only (exclude column 1 for standards) - must be to BMC specifications.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Sample QC services:&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Fresh Frozen Curl || per curl || $40.00 || $44.00 &lt;br /&gt;
|-&lt;br /&gt;
| FFPE Curl || per curl || $60.00 || $66.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OLIGO SYNTHESIS ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Platform !! Service !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Dr.Oligo || Assisted || $2,000.00 +consumables || $2,200.00 +consumables || includes setup and run of the instrument only. Large reagents / N2 included.&lt;br /&gt;
|-&lt;br /&gt;
|  || Walkup || $1,000.00 +consumables || $1,100.00 +consumables || includes run of the instrument only. Large reagents / N2 included.&lt;br /&gt;
|-&lt;br /&gt;
|  || Training || $4,000.00 || $4,400.00 || includes two instrument runs.&lt;br /&gt;
|-&lt;br /&gt;
| DNAscript Syntax || Setup (per run) || $1,000.00 || $1,100.00 || Per run cost&lt;br /&gt;
|-&lt;br /&gt;
|  || 2000 nucleotide synthesis || $500.00 || $550.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
|  || 8000 nucleotide synthesis || $1,500.00 || $1,650.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
|  || add Biotin (max 48) || $115.00 || $126.00 || max 48 per run and 2 per oligo. Couple to T only.&lt;br /&gt;
|-&lt;br /&gt;
|  || add Fluor || $300.00 || $330.00 ||&lt;br /&gt;
|-&lt;br /&gt;
|  || add Quench || $100.00 || $110.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== REAL TIME PCR ==&lt;br /&gt;
&lt;br /&gt;
Email biomicro@mit.edu for training&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! iLabs&lt;br /&gt;
|-&lt;br /&gt;
| Roche LightCycler 480 || $15.00 || per plate ||[https://mit.ilabsolutions.com/schedules/261680#/schedule/ ilab  qPCR calendar]&lt;br /&gt;
|-&lt;br /&gt;
| SYBR Green (KAPA/Roche) || $45.00 || per ml || [https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]&lt;br /&gt;
|-&lt;br /&gt;
| 96-well PLATES || $10.00 || per plate ||[https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]  &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
== OTHER LAB SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;COVARIS SONICATOR&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| COVARIS E220 || $20.00 / $22.00 || per hour || [https://mit.ilabsolutions.com/equipment/261752/?tab=schedule ilab calendar] || tubes available for purchase.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PIPPIN PREP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Gel Isolation || $75.00 / $82.50 || per gel (5 lanes) || TBA &lt;br /&gt;
|-&lt;br /&gt;
| Training || $25.00 / $27.50 || per session || TBA || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PLATE READER&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Varioskan || $18.00 / $20.00 || per hour || [https://mit.ilabsolutions.com/schedules/262715#/schedule/ ilabs plate reader calendar] || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;ROBOTICS&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Tecan EVO 150 || $75.00 / $82.50 || per 1h block - based on scheduled time. || [ &lt;br /&gt;
|-&lt;br /&gt;
| non-filter tips || $8.00 / $8.80 || per box ||  || ** Please let us know if there is additional plasticware you would like us to stock.&lt;br /&gt;
|-&lt;br /&gt;
| Filter tips || $12.00 / $13.20 || per box ||  [https://mit.ilabsolutions.com/service_center/3381/?tab=services services request]&lt;br /&gt;
|-&lt;br /&gt;
| Training || $65.00 / $71.50 || per hour || Email biomicro@mit.edu for training &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;NANODROP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Nanodrop || -- ||  || Walk up service || * no charge&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== COMPUTATIONAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! COMPUTATIONAL SERVICES !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! Other MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Support || per hour || $90.00 || $125.00 || Very limited support for non-MIT users&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Share || per 0.1FTE || $1,250.00 || N/A || MIT only. Priority access to informatics.&lt;br /&gt;
|-&lt;br /&gt;
| Ingenuity Pathway Analysis || per dataset || $100.00 || $110.00 || Recovery of licence cost.&lt;br /&gt;
|-&lt;br /&gt;
| Active Data storage || per TB per year || $100.00 || $300.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Tape Archive / Recovery || per tape || $60.00 || $70.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Training Classes || per session || $50.00 || $100.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
OLD&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2025 | FY2025 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023b | FY2023-Feb Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023 | FY2023 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2022 | FY2022 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2021 | FY2021 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2019 | FY2019 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2017 | FY2017 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2016 | FY2016 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2015 | FY2015 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2014 | FY2014 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2013 | FY2013 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2012 | FY2012 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2011 | FY2011 Pricing]]&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131328</id>
		<title>MIT:Pricing</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131328"/>
		<updated>2026-04-15T18:49:11Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* SHORT READ LIBRARY - RNA */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== SEQUENCING - HIGH OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== NOVASEQX / NOVASEQ6000 SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! NOVASEQ SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 100nt || $3,699.00 || $4,068.90 || rowspan=&amp;quot;9&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 300nt** || $5,238.00 || $5,761.80 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 500nt || $7,020.00 || $7,722.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 100nt** || $5,832.00 || $6,415.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 200nt** || $7,452.00 || $8,197.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 300nt** || $8,127.00 || $8,939.70 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 100nt** || $10,395.00 || $11,434.50 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 200nt** || $12,960.00 || $14,256.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 300nt** || $13,500.00 || $14,850.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 50nt &amp;lt;br&amp;gt; Lane**|| $3,780.00 || $4,158.00 || rowspan=&amp;quot;2&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 300nt &amp;lt;br&amp;gt; Lane**|| $5,400.00 || $5,940.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 150PE &amp;lt;br&amp;gt; Lane^^ || $1,850.00 || $2,000.00 || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 150PE &amp;lt;br&amp;gt; Lane^^ || $2,600.00 || $2,860.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 300nt^^ || $12,160.00 || $13,376.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 300nt^^ || $16,200.00 || $17,820.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 100nt^^ || $5,750.00 || $6,325.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
** - minimal inventory maintained&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - MID OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Element_Sequencing ELEMENT AVITI24] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ELEMENT AVITI SEQUENCING !! Lane/Flowcell !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 75PE / 150nt || Full flowcell (2 lane, ~800M reads) || $1,900.00 || $2,090.00 || per flowcell || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,000.00 || $1,100.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 150PE / 300nt || Full flowcell (2 lane, ~800M reads) || $2,650.00 || $2,915.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,375.00 || $1,513.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 300PE / 600nt || Full flowcell (~200M reads) || $3,500.00 || $3,850.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - LOW OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Singular_Sequencing#Requirements%2FThings_to_Consider SINGULAR G4] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SINGULAR G4 SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 50 PE: F3 Lane (~100M reads) || $300.00 || $330.00 || per lane || rowspan=&amp;quot;3&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| Rapid 300nt: F3 flowcell* || $1,800.00 || $1,980.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
| 150 PE: F3 Lane (~100M reads) || $450.00 || $495.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
* Rapid flowcells are required for adapted Illumina libraries.&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== MISEQ SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Assisted ====&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt || $715.00 || $786.50 &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $1,040.00 || $1,144.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $925.00 || $1,017.50 &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt|| $1,334.00 || $1,467.40 &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,570.00 || $1,727.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt|| $2,590.00 || $2,849.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,540.00 || $1,694.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Walkup ====&lt;br /&gt;
Training and lab storage on BMC servers required. Run must be scheduled in the [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar.]&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 Kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! RunTime &lt;br /&gt;
|-&lt;br /&gt;
| Machine usage || $120.00 || $132.00 || Xh  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt|| $381.00 || $419.10 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $665.00 || $731.50 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $565.00 || $621.50 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt || $920.00 || $1,012.00 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,125.00 || $1,238.00 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt || $1,921.00 || $2,113.10 || 24h &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,130.00 || $1,243.00 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $1,638.50 || $1,802.35 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $1,638.50 || $1,802.35 || 16h &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq classic ====&lt;br /&gt;
&lt;br /&gt;
* MiSeq is off contract and will be retired upon instrument failure&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! MISEQ kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT&lt;br /&gt;
|-&lt;br /&gt;
| 70nt V2 || $1,320.00 || $1,452.00 &lt;br /&gt;
|-&lt;br /&gt;
| 150nt V3 || $1,430.00 || $1,573.00 &lt;br /&gt;
|-&lt;br /&gt;
| 300nt V2 || $1,595.00 || $1,754.50 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt V2 || $1,760.00 || $1,936.00 &lt;br /&gt;
|-&lt;br /&gt;
| 600nt V3  || $2,200.00 || $2,420.00 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt &#039;&#039;&#039;NANO&#039;&#039;&#039; Run  || $770.00 || $847.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OTHER SHORT READ SERVICES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SHORT READ SUPPORTING SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Quality Control Only - only one QC is included per sequencing lane. || $35.00 || $38.50 || per sample || Includes RT-PCR and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Quality Control - Use SYBR for sample quantification for pooling instead of qPCR. Only available for pooling. || $15.00 || $16.50 || per sample || Includes Fluorometric quantification and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (short read) || $25.00 || $27.50 || per sample || Includes qPCR values from standard QC only&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only - full plate (short read) || $400.00 || $440.00 || per plate || excludes column 1 (used for controls)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LONG READ SEQUENCING ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PROMETHION SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $1,200.00 || $1,320.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PACBIO REVIO SEQUENCING^^ !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $2,900.00 || $3,190.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== LIBRARY GENERATION ==&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - CONVERSION ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Input library !! Convert To !! Method !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || Index Overwrite (per sample) || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || P5/P7 conversion (per pool) || $100.00 || $110.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - DNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;STANDARD THROUGHPUT DNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| LIGATION BASED NEB UltraII || STD || per sample || $105.00 || $115.00 || Includes QC, adapter ligation, size selection, barcoding, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT DNA&#039;&#039;&#039;  Prices for sample batches. Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. &lt;br /&gt;
|-&lt;br /&gt;
| HTL NEB UltraII || HTL || 24 || $900.00 || $990.00 || Includes adapter ligation, size selection, barcoding, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-XT || STD || per Sample || $105.00 || $115.00 || Includes set-up, tagmentation, indexing, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-Flex || STD || per Sample || $157.00 || $173.00 &lt;br /&gt;
|-&lt;br /&gt;
| NEXTERA-XT OR FLEX || HTL || 24 || $900.00 || $990.00 || Includes tagmentation, indexing, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| 16S Amplicon || HTL || 48 || $1,900.00 || $2,090.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $650.00 || $715.00 &lt;br /&gt;
|-&lt;br /&gt;
| Other Amplicon || HTL || 48 || $1,600.00 || $1,760.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA). Samples *must* be submitted amplified with appropriate linkers.&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $630.00 || $693.00 &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples submitted not in a plated format will be subject to these additional charges. &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || STD || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || STD || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || STD || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - RNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; |&#039;&#039;&#039;STANDARD RNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| polyA based isolation NEB UltraII RNAseq || STD || per sample || $157.00 || $173.00 || Includes QC, polyA isolation, generation of cDNA, library construction, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || STD || per sample || $235.00 || $258.50 || Includes sample QC, ribosomal depletion, generation of cDNA, library construction, indexing and library quality control.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || STD v4 || per sample || $262.00 || $289.00 || Includes generation of cDNA, amplification, library construction, indexing and quality control (SYBR + FA). Single sample includes initial QC.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || STD || per sample || $210.00 || $231.00 || Includes generation of cDNA, amplification, library construction, rRNA degradation, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Small RNA || STD || per sample || $289.00 || $318.00 || Uses NEB, BIOO or QIAGEN small RNA kit&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT RNA&#039;&#039;&#039;  Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. Mixing of multiple projects not recommended. &lt;br /&gt;
|-&lt;br /&gt;
| polyA NEB UltraII RNAseq || HTL (NEB only) || 24 || $1,500.00 || $1,650.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL (NEB only) || 96 || $3,000.00 || $3,300.00 &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput 3&#039; Digital Gene Expression (HT3DGE) || &#039;&#039;&#039;HTL&#039;&#039;&#039; || 24 || $1,050.00 || $1,155.00 || Includes generation of cDNA, library construction, indexing and library quality control. Does not include sample QC.&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $2,100.00 || $2,310.00 &lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || 24 || $2,500.00 || $2,750.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || 24 || $2,000.00 || $2,200.00 &lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $3,200.00 || $3,520.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || 24 || $3,000.00 || $3,300.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples not in proper input format will be subject to these additional charges. &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || STD || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || STD || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || STD || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
=== LONG READ LIBRARIES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Oxford Nanopore Sample Preparation !! Nanopore Kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Standard Ligation || LSK || $160.00 || $176.00 || rowspan=&amp;quot;6&amp;quot; | Oxford Nanopore prep methods remain highly experimental and are continually in flux. As such, we can only estimate cost based on reagents/effort and cannot guarantee results. Please consult the core prior to sample submission for the latest information.&lt;br /&gt;
|-&lt;br /&gt;
| Native Barcoding (ligation indexing) || - || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| SMARTseq -&amp;gt; Ligation || Cv4+LSK || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| Rapid Prep (tagment - ~10-20kb) || RAD || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Long Insert Prep || RAD (modified, target &amp;gt;100kb) || $262.00 || $289.00 &lt;br /&gt;
|-&lt;br /&gt;
| Direct RNA || RNA004 || $160.00 || $176.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SAMPLE EXTRACTION ==&lt;br /&gt;
&lt;br /&gt;
=== CHEMAGIC360 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! TYPE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| DNA || 96 || $700.00 || $770.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA || 96 || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 12 samples || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 96 samples || $1,000.00 || $1,100.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SINGLE CELL &amp;amp; SPATIAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== 10X CHROMIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! 10X USAGE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Assisted Service&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;DIGITAL GENE EXPRESSION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - setup || setup || $1,015.00 || $1,116.50 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - per sample || per sample || $1,750.00 || $1,925.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - setup || setup || $1,150.00 || $1,265.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - per 4 samples || per 4 samples || $2,305.00 || $2,535.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) probe based. human/mouse only - setup || setup (up to 48 samples) || $2,700.00 || $2,970.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per sample (1-plex) || per sample || $270.00 || $297.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per 4-plex || per 4 samples || $3,900.00 || $4,290.00 &lt;br /&gt;
|-&lt;br /&gt;
| Amplicon (CITE-SEQ, TCR, BCR, antibody barcode, etc. // per amplicon) - setup || setup || $470.00 || $517.00 || additional prep beyond DGE&lt;br /&gt;
|-&lt;br /&gt;
| Amplicon - per sample || per sample || $45.00 || $50.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;scATACseq&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - setup || setup || $880.00 || $968.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - per sample || per sample || $1,675.00 || $1,843.00 || Includes QC and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;Multiome (ATAC+3&#039;RNA)&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| MULTI - setup || setup || $1,800.00 || $1,980.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| MULTI - per sample || per sample || $3,100.00 || $3,410.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;CANCELLATION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| per session || &amp;lt;24h notice || $200.00 || $220.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
* please let BMC know if you plan to run this method early so we will have reagents ready for you.&lt;br /&gt;
&lt;br /&gt;
=== VISIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SLIDES !! Batch Size !! KI Only !! [[BioMicroCenter:CoreDeps|Other CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Test Array || slide || colspan=&amp;quot;2&amp;quot; | $975.00 || $1,071.00 || recommended 1x per tissue type for fresh frozen&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - Fresh Frozen || 1 slide / 4 tiles || colspan=&amp;quot;2&amp;quot; | $6,010.00 || $6,609.00 || Includes H&amp;amp;E stain images + Library Generation&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - FFPE (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $4,550.00 || $4,996.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - HD (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $7,850.00 || $8,596.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| QC - FFPE Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $60.00 || $66.00 || RNA isolation from FFPE scroll&lt;br /&gt;
|-&lt;br /&gt;
| QC - Fresh Frozen Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $40.00 || $44.00 || RNA isolation from FF scroll&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== AVITI24 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! AVITI24 SPATIAL !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Slide Only || per slide || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Optimization Only || per slide || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| Teton Panel || per slide || $7,200.00 || $7,920.00 &lt;br /&gt;
|-&lt;br /&gt;
| Atlas Short || per slide || $5,500.00 || $6,050.00 &lt;br /&gt;
|-&lt;br /&gt;
| Antibody Add-on || per slide || $360.00 || $396.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== OTHER GENOMICS SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== [[BioMicroCenter:QC|QUALITY CONTROL]] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! QUALITY CONTROL !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: RNA or DNA || per sample || $15.00 || $16.50 &lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: Preloaded row || per row (12) || $80.00 || $88.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: RNA or DNA || per sample || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: Preloaded Row || per row (12) || $160.00 || $176.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| BioAnalyzer: Walkup Service || per chip || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (Short read quantification test) || per sample || $25.00 || $27.50 || 4 point serial dilution&lt;br /&gt;
|-&lt;br /&gt;
| Full plate qPCR (short read quantification test) || per plate || $400.00 || $440.00 || full plate only (exclude column 1 for standards) - must be to BMC specifications.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Sample QC services:&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Fresh Frozen Curl || per curl || $40.00 || $44.00 &lt;br /&gt;
|-&lt;br /&gt;
| FFPE Curl || per curl || $60.00 || $66.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OLIGO SYNTHESIS ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Platform !! Service !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Dr.Oligo || Assisted || $2,000.00 +consumables || $2,200.00 +consumables || includes setup and run of the instrument only. Large reagents / N2 included.&lt;br /&gt;
|-&lt;br /&gt;
|  || Walkup || $1,000.00 +consumables || $1,100.00 +consumables || includes run of the instrument only. Large reagents / N2 included.&lt;br /&gt;
|-&lt;br /&gt;
|  || Training || $4,000.00 || $4,400.00 || includes two instrument runs.&lt;br /&gt;
|-&lt;br /&gt;
| DNAscript Syntax || Setup (per run) || $1,000.00 || $1,100.00 || Per run cost&lt;br /&gt;
|-&lt;br /&gt;
|  || 2000 nucleotide synthesis || $500.00 || $550.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
|  || 8000 nucleotide synthesis || $1,500.00 || $1,650.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
|  || add Biotin (max 48) || $115.00 || $126.00 || max 48 per run and 2 per oligo. Couple to T only.&lt;br /&gt;
|-&lt;br /&gt;
|  || add Fluor || $300.00 || $330.00 ||&lt;br /&gt;
|-&lt;br /&gt;
|  || add Quench || $100.00 || $110.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== REAL TIME PCR ==&lt;br /&gt;
&lt;br /&gt;
Email biomicro@mit.edu for training&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! iLabs&lt;br /&gt;
|-&lt;br /&gt;
| Roche LightCycler 480 || $15.00 || per plate ||[https://mit.ilabsolutions.com/schedules/261680#/schedule/ ilab  qPCR calendar]&lt;br /&gt;
|-&lt;br /&gt;
| SYBR Green (KAPA/Roche) || $45.00 || per ml || [https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]&lt;br /&gt;
|-&lt;br /&gt;
| 96-well PLATES || $10.00 || per plate ||[https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]  &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
== OTHER LAB SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;COVARIS SONICATOR&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| COVARIS E220 || $20.00 / $22.00 || per hour || [https://mit.ilabsolutions.com/equipment/261752/?tab=schedule ilab calendar] || tubes available for purchase.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PIPPIN PREP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Gel Isolation || $75.00 / $82.50 || per gel (5 lanes) || TBA &lt;br /&gt;
|-&lt;br /&gt;
| Training || $25.00 / $27.50 || per session || TBA || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PLATE READER&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Varioskan || $18.00 / $20.00 || per hour || [https://mit.ilabsolutions.com/schedules/262715#/schedule/ ilabs plate reader calendar] || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;ROBOTICS&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Tecan EVO 150 || $75.00 / $82.50 || per 1h block - based on scheduled time. || [ &lt;br /&gt;
|-&lt;br /&gt;
| non-filter tips || $8.00 / $8.80 || per box ||  || ** Please let us know if there is additional plasticware you would like us to stock.&lt;br /&gt;
|-&lt;br /&gt;
| Filter tips || $12.00 / $13.20 || per box ||  [https://mit.ilabsolutions.com/service_center/3381/?tab=services services request]&lt;br /&gt;
|-&lt;br /&gt;
| Training || $65.00 / $71.50 || per hour || Email biomicro@mit.edu for training &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;NANODROP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Nanodrop || -- ||  || Walk up service || * no charge&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== COMPUTATIONAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! COMPUTATIONAL SERVICES !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! Other MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Support || per hour || $90.00 || $125.00 || Very limited support for non-MIT users&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Share || per 0.1FTE || $1,250.00 || N/A || MIT only. Priority access to informatics.&lt;br /&gt;
|-&lt;br /&gt;
| Ingenuity Pathway Analysis || per dataset || $100.00 || $110.00 || Recovery of licence cost.&lt;br /&gt;
|-&lt;br /&gt;
| Active Data storage || per TB per year || $100.00 || $300.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Tape Archive / Recovery || per tape || $60.00 || $70.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Training Classes || per session || $50.00 || $100.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
OLD&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2025 | FY2025 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023b | FY2023-Feb Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023 | FY2023 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2022 | FY2022 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2021 | FY2021 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2019 | FY2019 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2017 | FY2017 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2016 | FY2016 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2015 | FY2015 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2014 | FY2014 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2013 | FY2013 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2012 | FY2012 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2011 | FY2011 Pricing]]&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131327</id>
		<title>MIT:Pricing</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131327"/>
		<updated>2026-04-15T18:47:47Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* SHORT READ LIBRARY - RNA */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== SEQUENCING - HIGH OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== NOVASEQX / NOVASEQ6000 SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! NOVASEQ SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 100nt || $3,699.00 || $4,068.90 || rowspan=&amp;quot;9&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 300nt** || $5,238.00 || $5,761.80 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 500nt || $7,020.00 || $7,722.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 100nt** || $5,832.00 || $6,415.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 200nt** || $7,452.00 || $8,197.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 300nt** || $8,127.00 || $8,939.70 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 100nt** || $10,395.00 || $11,434.50 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 200nt** || $12,960.00 || $14,256.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 300nt** || $13,500.00 || $14,850.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 50nt &amp;lt;br&amp;gt; Lane**|| $3,780.00 || $4,158.00 || rowspan=&amp;quot;2&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 300nt &amp;lt;br&amp;gt; Lane**|| $5,400.00 || $5,940.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 150PE &amp;lt;br&amp;gt; Lane^^ || $1,850.00 || $2,000.00 || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 150PE &amp;lt;br&amp;gt; Lane^^ || $2,600.00 || $2,860.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 300nt^^ || $12,160.00 || $13,376.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 300nt^^ || $16,200.00 || $17,820.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 100nt^^ || $5,750.00 || $6,325.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
** - minimal inventory maintained&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - MID OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Element_Sequencing ELEMENT AVITI24] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ELEMENT AVITI SEQUENCING !! Lane/Flowcell !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 75PE / 150nt || Full flowcell (2 lane, ~800M reads) || $1,900.00 || $2,090.00 || per flowcell || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,000.00 || $1,100.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 150PE / 300nt || Full flowcell (2 lane, ~800M reads) || $2,650.00 || $2,915.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,375.00 || $1,513.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 300PE / 600nt || Full flowcell (~200M reads) || $3,500.00 || $3,850.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - LOW OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Singular_Sequencing#Requirements%2FThings_to_Consider SINGULAR G4] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SINGULAR G4 SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 50 PE: F3 Lane (~100M reads) || $300.00 || $330.00 || per lane || rowspan=&amp;quot;3&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| Rapid 300nt: F3 flowcell* || $1,800.00 || $1,980.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
| 150 PE: F3 Lane (~100M reads) || $450.00 || $495.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
* Rapid flowcells are required for adapted Illumina libraries.&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== MISEQ SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Assisted ====&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt || $715.00 || $786.50 &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $1,040.00 || $1,144.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $925.00 || $1,017.50 &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt|| $1,334.00 || $1,467.40 &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,570.00 || $1,727.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt|| $2,590.00 || $2,849.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,540.00 || $1,694.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Walkup ====&lt;br /&gt;
Training and lab storage on BMC servers required. Run must be scheduled in the [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar.]&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 Kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! RunTime &lt;br /&gt;
|-&lt;br /&gt;
| Machine usage || $120.00 || $132.00 || Xh  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt|| $381.00 || $419.10 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $665.00 || $731.50 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $565.00 || $621.50 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt || $920.00 || $1,012.00 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,125.00 || $1,238.00 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt || $1,921.00 || $2,113.10 || 24h &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,130.00 || $1,243.00 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $1,638.50 || $1,802.35 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $1,638.50 || $1,802.35 || 16h &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq classic ====&lt;br /&gt;
&lt;br /&gt;
* MiSeq is off contract and will be retired upon instrument failure&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! MISEQ kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT&lt;br /&gt;
|-&lt;br /&gt;
| 70nt V2 || $1,320.00 || $1,452.00 &lt;br /&gt;
|-&lt;br /&gt;
| 150nt V3 || $1,430.00 || $1,573.00 &lt;br /&gt;
|-&lt;br /&gt;
| 300nt V2 || $1,595.00 || $1,754.50 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt V2 || $1,760.00 || $1,936.00 &lt;br /&gt;
|-&lt;br /&gt;
| 600nt V3  || $2,200.00 || $2,420.00 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt &#039;&#039;&#039;NANO&#039;&#039;&#039; Run  || $770.00 || $847.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OTHER SHORT READ SERVICES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SHORT READ SUPPORTING SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Quality Control Only - only one QC is included per sequencing lane. || $35.00 || $38.50 || per sample || Includes RT-PCR and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Quality Control - Use SYBR for sample quantification for pooling instead of qPCR. Only available for pooling. || $15.00 || $16.50 || per sample || Includes Fluorometric quantification and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (short read) || $25.00 || $27.50 || per sample || Includes qPCR values from standard QC only&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only - full plate (short read) || $400.00 || $440.00 || per plate || excludes column 1 (used for controls)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LONG READ SEQUENCING ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PROMETHION SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $1,200.00 || $1,320.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PACBIO REVIO SEQUENCING^^ !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $2,900.00 || $3,190.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== LIBRARY GENERATION ==&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - CONVERSION ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Input library !! Convert To !! Method !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || Index Overwrite (per sample) || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || P5/P7 conversion (per pool) || $100.00 || $110.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - DNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;STANDARD THROUGHPUT DNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| LIGATION BASED NEB UltraII || STD || per sample || $105.00 || $115.00 || Includes QC, adapter ligation, size selection, barcoding, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT DNA&#039;&#039;&#039;  Prices for sample batches. Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. &lt;br /&gt;
|-&lt;br /&gt;
| HTL NEB UltraII || HTL || 24 || $900.00 || $990.00 || Includes adapter ligation, size selection, barcoding, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-XT || STD || per Sample || $105.00 || $115.00 || Includes set-up, tagmentation, indexing, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-Flex || STD || per Sample || $157.00 || $173.00 &lt;br /&gt;
|-&lt;br /&gt;
| NEXTERA-XT OR FLEX || HTL || 24 || $900.00 || $990.00 || Includes tagmentation, indexing, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| 16S Amplicon || HTL || 48 || $1,900.00 || $2,090.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $650.00 || $715.00 &lt;br /&gt;
|-&lt;br /&gt;
| Other Amplicon || HTL || 48 || $1,600.00 || $1,760.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA). Samples *must* be submitted amplified with appropriate linkers.&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $630.00 || $693.00 &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples submitted not in a plated format will be subject to these additional charges. &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || STD || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || STD || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || STD || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - RNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; |&#039;&#039;&#039;STANDARD RNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| polyA based isolation NEB UltraII RNAseq || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $157.00 || $173.00 || Includes QC, polyA isolation, generation of cDNA, library construction, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $235.00 || $258.50 || Includes sample QC, ribosomal depletion, generation of cDNA, library construction, indexing and library quality control.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;STD&#039;&#039;&#039; v4 || per sample || $262.00 || $289.00 || Includes generation of cDNA, amplification, library construction, indexing and quality control (SYBR + FA). Single sample includes initial QC.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || STD || per sample || $210.00 || $231.00 || Includes generation of cDNA, amplification, library construction, rRNA degradation, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Small RNA || STD || per sample || $289.00 || $318.00 || Uses NEB, BIOO or QIAGEN small RNA kit&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT RNA&#039;&#039;&#039;  Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. Mixing of multiple projects not recommended. &lt;br /&gt;
|-&lt;br /&gt;
| polyA NEB UltraII RNAseq || &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || 24 || $1,500.00 || $1,650.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || 96 || $3,000.00 || $3,300.00 &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput 3&#039; Digital Gene Expression (HT3DGE) || &#039;&#039;&#039;HTL&#039;&#039;&#039; || 24 || $1,050.00 || $1,155.00 || Includes generation of cDNA, library construction, indexing and library quality control. Does not include sample QC.&lt;br /&gt;
|-&lt;br /&gt;
|  || &#039;&#039;&#039;HTL&#039;&#039;&#039; || 96 || $2,100.00 || $2,310.00 &lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || 24 || $2,500.00 || $2,750.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || 24 || $2,000.00 || $2,200.00 &lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $3,200.00 || $3,520.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || 24 || $3,000.00 || $3,300.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples not in proper input format will be subject to these additional charges. &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup ||  || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup ||  || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification ||  || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
=== LONG READ LIBRARIES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Oxford Nanopore Sample Preparation !! Nanopore Kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Standard Ligation || LSK || $160.00 || $176.00 || rowspan=&amp;quot;6&amp;quot; | Oxford Nanopore prep methods remain highly experimental and are continually in flux. As such, we can only estimate cost based on reagents/effort and cannot guarantee results. Please consult the core prior to sample submission for the latest information.&lt;br /&gt;
|-&lt;br /&gt;
| Native Barcoding (ligation indexing) || - || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| SMARTseq -&amp;gt; Ligation || Cv4+LSK || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| Rapid Prep (tagment - ~10-20kb) || RAD || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Long Insert Prep || RAD (modified, target &amp;gt;100kb) || $262.00 || $289.00 &lt;br /&gt;
|-&lt;br /&gt;
| Direct RNA || RNA004 || $160.00 || $176.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SAMPLE EXTRACTION ==&lt;br /&gt;
&lt;br /&gt;
=== CHEMAGIC360 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! TYPE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| DNA || 96 || $700.00 || $770.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA || 96 || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 12 samples || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 96 samples || $1,000.00 || $1,100.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SINGLE CELL &amp;amp; SPATIAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== 10X CHROMIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! 10X USAGE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Assisted Service&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;DIGITAL GENE EXPRESSION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - setup || setup || $1,015.00 || $1,116.50 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - per sample || per sample || $1,750.00 || $1,925.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - setup || setup || $1,150.00 || $1,265.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - per 4 samples || per 4 samples || $2,305.00 || $2,535.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) probe based. human/mouse only - setup || setup (up to 48 samples) || $2,700.00 || $2,970.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per sample (1-plex) || per sample || $270.00 || $297.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per 4-plex || per 4 samples || $3,900.00 || $4,290.00 &lt;br /&gt;
|-&lt;br /&gt;
| Amplicon (CITE-SEQ, TCR, BCR, antibody barcode, etc. // per amplicon) - setup || setup || $470.00 || $517.00 || additional prep beyond DGE&lt;br /&gt;
|-&lt;br /&gt;
| Amplicon - per sample || per sample || $45.00 || $50.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;scATACseq&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - setup || setup || $880.00 || $968.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - per sample || per sample || $1,675.00 || $1,843.00 || Includes QC and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;Multiome (ATAC+3&#039;RNA)&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| MULTI - setup || setup || $1,800.00 || $1,980.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| MULTI - per sample || per sample || $3,100.00 || $3,410.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;CANCELLATION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| per session || &amp;lt;24h notice || $200.00 || $220.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
* please let BMC know if you plan to run this method early so we will have reagents ready for you.&lt;br /&gt;
&lt;br /&gt;
=== VISIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SLIDES !! Batch Size !! KI Only !! [[BioMicroCenter:CoreDeps|Other CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Test Array || slide || colspan=&amp;quot;2&amp;quot; | $975.00 || $1,071.00 || recommended 1x per tissue type for fresh frozen&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - Fresh Frozen || 1 slide / 4 tiles || colspan=&amp;quot;2&amp;quot; | $6,010.00 || $6,609.00 || Includes H&amp;amp;E stain images + Library Generation&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - FFPE (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $4,550.00 || $4,996.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - HD (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $7,850.00 || $8,596.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| QC - FFPE Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $60.00 || $66.00 || RNA isolation from FFPE scroll&lt;br /&gt;
|-&lt;br /&gt;
| QC - Fresh Frozen Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $40.00 || $44.00 || RNA isolation from FF scroll&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== AVITI24 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! AVITI24 SPATIAL !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Slide Only || per slide || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Optimization Only || per slide || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| Teton Panel || per slide || $7,200.00 || $7,920.00 &lt;br /&gt;
|-&lt;br /&gt;
| Atlas Short || per slide || $5,500.00 || $6,050.00 &lt;br /&gt;
|-&lt;br /&gt;
| Antibody Add-on || per slide || $360.00 || $396.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== OTHER GENOMICS SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== [[BioMicroCenter:QC|QUALITY CONTROL]] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! QUALITY CONTROL !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: RNA or DNA || per sample || $15.00 || $16.50 &lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: Preloaded row || per row (12) || $80.00 || $88.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: RNA or DNA || per sample || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: Preloaded Row || per row (12) || $160.00 || $176.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| BioAnalyzer: Walkup Service || per chip || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (Short read quantification test) || per sample || $25.00 || $27.50 || 4 point serial dilution&lt;br /&gt;
|-&lt;br /&gt;
| Full plate qPCR (short read quantification test) || per plate || $400.00 || $440.00 || full plate only (exclude column 1 for standards) - must be to BMC specifications.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Sample QC services:&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Fresh Frozen Curl || per curl || $40.00 || $44.00 &lt;br /&gt;
|-&lt;br /&gt;
| FFPE Curl || per curl || $60.00 || $66.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OLIGO SYNTHESIS ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Platform !! Service !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Dr.Oligo || Assisted || $2,000.00 +consumables || $2,200.00 +consumables || includes setup and run of the instrument only. Large reagents / N2 included.&lt;br /&gt;
|-&lt;br /&gt;
|  || Walkup || $1,000.00 +consumables || $1,100.00 +consumables || includes run of the instrument only. Large reagents / N2 included.&lt;br /&gt;
|-&lt;br /&gt;
|  || Training || $4,000.00 || $4,400.00 || includes two instrument runs.&lt;br /&gt;
|-&lt;br /&gt;
| DNAscript Syntax || Setup (per run) || $1,000.00 || $1,100.00 || Per run cost&lt;br /&gt;
|-&lt;br /&gt;
|  || 2000 nucleotide synthesis || $500.00 || $550.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
|  || 8000 nucleotide synthesis || $1,500.00 || $1,650.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
|  || add Biotin (max 48) || $115.00 || $126.00 || max 48 per run and 2 per oligo. Couple to T only.&lt;br /&gt;
|-&lt;br /&gt;
|  || add Fluor || $300.00 || $330.00 ||&lt;br /&gt;
|-&lt;br /&gt;
|  || add Quench || $100.00 || $110.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== REAL TIME PCR ==&lt;br /&gt;
&lt;br /&gt;
Email biomicro@mit.edu for training&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! iLabs&lt;br /&gt;
|-&lt;br /&gt;
| Roche LightCycler 480 || $15.00 || per plate ||[https://mit.ilabsolutions.com/schedules/261680#/schedule/ ilab  qPCR calendar]&lt;br /&gt;
|-&lt;br /&gt;
| SYBR Green (KAPA/Roche) || $45.00 || per ml || [https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]&lt;br /&gt;
|-&lt;br /&gt;
| 96-well PLATES || $10.00 || per plate ||[https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]  &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
== OTHER LAB SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;COVARIS SONICATOR&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| COVARIS E220 || $20.00 / $22.00 || per hour || [https://mit.ilabsolutions.com/equipment/261752/?tab=schedule ilab calendar] || tubes available for purchase.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PIPPIN PREP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Gel Isolation || $75.00 / $82.50 || per gel (5 lanes) || TBA &lt;br /&gt;
|-&lt;br /&gt;
| Training || $25.00 / $27.50 || per session || TBA || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PLATE READER&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Varioskan || $18.00 / $20.00 || per hour || [https://mit.ilabsolutions.com/schedules/262715#/schedule/ ilabs plate reader calendar] || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;ROBOTICS&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Tecan EVO 150 || $75.00 / $82.50 || per 1h block - based on scheduled time. || [ &lt;br /&gt;
|-&lt;br /&gt;
| non-filter tips || $8.00 / $8.80 || per box ||  || ** Please let us know if there is additional plasticware you would like us to stock.&lt;br /&gt;
|-&lt;br /&gt;
| Filter tips || $12.00 / $13.20 || per box ||  [https://mit.ilabsolutions.com/service_center/3381/?tab=services services request]&lt;br /&gt;
|-&lt;br /&gt;
| Training || $65.00 / $71.50 || per hour || Email biomicro@mit.edu for training &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;NANODROP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Nanodrop || -- ||  || Walk up service || * no charge&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== COMPUTATIONAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! COMPUTATIONAL SERVICES !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! Other MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Support || per hour || $90.00 || $125.00 || Very limited support for non-MIT users&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Share || per 0.1FTE || $1,250.00 || N/A || MIT only. Priority access to informatics.&lt;br /&gt;
|-&lt;br /&gt;
| Ingenuity Pathway Analysis || per dataset || $100.00 || $110.00 || Recovery of licence cost.&lt;br /&gt;
|-&lt;br /&gt;
| Active Data storage || per TB per year || $100.00 || $300.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Tape Archive / Recovery || per tape || $60.00 || $70.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Training Classes || per session || $50.00 || $100.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
OLD&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2025 | FY2025 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023b | FY2023-Feb Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023 | FY2023 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2022 | FY2022 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2021 | FY2021 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2019 | FY2019 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2017 | FY2017 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2016 | FY2016 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2015 | FY2015 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2014 | FY2014 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2013 | FY2013 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2012 | FY2012 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2011 | FY2011 Pricing]]&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131326</id>
		<title>MIT:Pricing</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131326"/>
		<updated>2026-04-15T18:47:36Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* SHORT READ LIBRARY - RNA */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== SEQUENCING - HIGH OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== NOVASEQX / NOVASEQ6000 SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! NOVASEQ SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 100nt || $3,699.00 || $4,068.90 || rowspan=&amp;quot;9&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 300nt** || $5,238.00 || $5,761.80 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 500nt || $7,020.00 || $7,722.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 100nt** || $5,832.00 || $6,415.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 200nt** || $7,452.00 || $8,197.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 300nt** || $8,127.00 || $8,939.70 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 100nt** || $10,395.00 || $11,434.50 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 200nt** || $12,960.00 || $14,256.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 300nt** || $13,500.00 || $14,850.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 50nt &amp;lt;br&amp;gt; Lane**|| $3,780.00 || $4,158.00 || rowspan=&amp;quot;2&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 300nt &amp;lt;br&amp;gt; Lane**|| $5,400.00 || $5,940.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 150PE &amp;lt;br&amp;gt; Lane^^ || $1,850.00 || $2,000.00 || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 150PE &amp;lt;br&amp;gt; Lane^^ || $2,600.00 || $2,860.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 300nt^^ || $12,160.00 || $13,376.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 300nt^^ || $16,200.00 || $17,820.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 100nt^^ || $5,750.00 || $6,325.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
** - minimal inventory maintained&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - MID OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Element_Sequencing ELEMENT AVITI24] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ELEMENT AVITI SEQUENCING !! Lane/Flowcell !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 75PE / 150nt || Full flowcell (2 lane, ~800M reads) || $1,900.00 || $2,090.00 || per flowcell || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,000.00 || $1,100.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 150PE / 300nt || Full flowcell (2 lane, ~800M reads) || $2,650.00 || $2,915.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,375.00 || $1,513.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 300PE / 600nt || Full flowcell (~200M reads) || $3,500.00 || $3,850.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - LOW OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Singular_Sequencing#Requirements%2FThings_to_Consider SINGULAR G4] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SINGULAR G4 SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 50 PE: F3 Lane (~100M reads) || $300.00 || $330.00 || per lane || rowspan=&amp;quot;3&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| Rapid 300nt: F3 flowcell* || $1,800.00 || $1,980.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
| 150 PE: F3 Lane (~100M reads) || $450.00 || $495.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
* Rapid flowcells are required for adapted Illumina libraries.&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== MISEQ SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Assisted ====&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt || $715.00 || $786.50 &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $1,040.00 || $1,144.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $925.00 || $1,017.50 &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt|| $1,334.00 || $1,467.40 &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,570.00 || $1,727.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt|| $2,590.00 || $2,849.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,540.00 || $1,694.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Walkup ====&lt;br /&gt;
Training and lab storage on BMC servers required. Run must be scheduled in the [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar.]&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 Kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! RunTime &lt;br /&gt;
|-&lt;br /&gt;
| Machine usage || $120.00 || $132.00 || Xh  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt|| $381.00 || $419.10 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $665.00 || $731.50 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $565.00 || $621.50 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt || $920.00 || $1,012.00 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,125.00 || $1,238.00 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt || $1,921.00 || $2,113.10 || 24h &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,130.00 || $1,243.00 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $1,638.50 || $1,802.35 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $1,638.50 || $1,802.35 || 16h &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq classic ====&lt;br /&gt;
&lt;br /&gt;
* MiSeq is off contract and will be retired upon instrument failure&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! MISEQ kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT&lt;br /&gt;
|-&lt;br /&gt;
| 70nt V2 || $1,320.00 || $1,452.00 &lt;br /&gt;
|-&lt;br /&gt;
| 150nt V3 || $1,430.00 || $1,573.00 &lt;br /&gt;
|-&lt;br /&gt;
| 300nt V2 || $1,595.00 || $1,754.50 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt V2 || $1,760.00 || $1,936.00 &lt;br /&gt;
|-&lt;br /&gt;
| 600nt V3  || $2,200.00 || $2,420.00 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt &#039;&#039;&#039;NANO&#039;&#039;&#039; Run  || $770.00 || $847.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OTHER SHORT READ SERVICES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SHORT READ SUPPORTING SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Quality Control Only - only one QC is included per sequencing lane. || $35.00 || $38.50 || per sample || Includes RT-PCR and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Quality Control - Use SYBR for sample quantification for pooling instead of qPCR. Only available for pooling. || $15.00 || $16.50 || per sample || Includes Fluorometric quantification and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (short read) || $25.00 || $27.50 || per sample || Includes qPCR values from standard QC only&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only - full plate (short read) || $400.00 || $440.00 || per plate || excludes column 1 (used for controls)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LONG READ SEQUENCING ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PROMETHION SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $1,200.00 || $1,320.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PACBIO REVIO SEQUENCING^^ !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $2,900.00 || $3,190.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== LIBRARY GENERATION ==&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - CONVERSION ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Input library !! Convert To !! Method !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || Index Overwrite (per sample) || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || P5/P7 conversion (per pool) || $100.00 || $110.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - DNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;STANDARD THROUGHPUT DNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| LIGATION BASED NEB UltraII || STD || per sample || $105.00 || $115.00 || Includes QC, adapter ligation, size selection, barcoding, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT DNA&#039;&#039;&#039;  Prices for sample batches. Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. &lt;br /&gt;
|-&lt;br /&gt;
| HTL NEB UltraII || HTL || 24 || $900.00 || $990.00 || Includes adapter ligation, size selection, barcoding, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-XT || STD || per Sample || $105.00 || $115.00 || Includes set-up, tagmentation, indexing, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-Flex || STD || per Sample || $157.00 || $173.00 &lt;br /&gt;
|-&lt;br /&gt;
| NEXTERA-XT OR FLEX || HTL || 24 || $900.00 || $990.00 || Includes tagmentation, indexing, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| 16S Amplicon || HTL || 48 || $1,900.00 || $2,090.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $650.00 || $715.00 &lt;br /&gt;
|-&lt;br /&gt;
| Other Amplicon || HTL || 48 || $1,600.00 || $1,760.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA). Samples *must* be submitted amplified with appropriate linkers.&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $630.00 || $693.00 &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples submitted not in a plated format will be subject to these additional charges. &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || STD || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || STD || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || STD || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - RNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
|| colspan=&amp;quot;6&amp;quot; |&#039;&#039;&#039;STANDARD RNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| polyA based isolation NEB UltraII RNAseq || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $157.00 || $173.00 || Includes QC, polyA isolation, generation of cDNA, library construction, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $235.00 || $258.50 || Includes sample QC, ribosomal depletion, generation of cDNA, library construction, indexing and library quality control.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;STD&#039;&#039;&#039; v4 || per sample || $262.00 || $289.00 || Includes generation of cDNA, amplification, library construction, indexing and quality control (SYBR + FA). Single sample includes initial QC.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || STD || per sample || $210.00 || $231.00 || Includes generation of cDNA, amplification, library construction, rRNA degradation, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Small RNA || STD || per sample || $289.00 || $318.00 || Uses NEB, BIOO or QIAGEN small RNA kit&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT RNA&#039;&#039;&#039;  Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. Mixing of multiple projects not recommended. &lt;br /&gt;
|-&lt;br /&gt;
| polyA NEB UltraII RNAseq || &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || 24 || $1,500.00 || $1,650.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || 96 || $3,000.00 || $3,300.00 &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput 3&#039; Digital Gene Expression (HT3DGE) || &#039;&#039;&#039;HTL&#039;&#039;&#039; || 24 || $1,050.00 || $1,155.00 || Includes generation of cDNA, library construction, indexing and library quality control. Does not include sample QC.&lt;br /&gt;
|-&lt;br /&gt;
|  || &#039;&#039;&#039;HTL&#039;&#039;&#039; || 96 || $2,100.00 || $2,310.00 &lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || 24 || $2,500.00 || $2,750.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || 24 || $2,000.00 || $2,200.00 &lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $3,200.00 || $3,520.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || 24 || $3,000.00 || $3,300.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples not in proper input format will be subject to these additional charges. &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup ||  || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup ||  || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification ||  || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
=== LONG READ LIBRARIES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Oxford Nanopore Sample Preparation !! Nanopore Kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Standard Ligation || LSK || $160.00 || $176.00 || rowspan=&amp;quot;6&amp;quot; | Oxford Nanopore prep methods remain highly experimental and are continually in flux. As such, we can only estimate cost based on reagents/effort and cannot guarantee results. Please consult the core prior to sample submission for the latest information.&lt;br /&gt;
|-&lt;br /&gt;
| Native Barcoding (ligation indexing) || - || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| SMARTseq -&amp;gt; Ligation || Cv4+LSK || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| Rapid Prep (tagment - ~10-20kb) || RAD || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Long Insert Prep || RAD (modified, target &amp;gt;100kb) || $262.00 || $289.00 &lt;br /&gt;
|-&lt;br /&gt;
| Direct RNA || RNA004 || $160.00 || $176.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SAMPLE EXTRACTION ==&lt;br /&gt;
&lt;br /&gt;
=== CHEMAGIC360 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! TYPE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| DNA || 96 || $700.00 || $770.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA || 96 || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 12 samples || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 96 samples || $1,000.00 || $1,100.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SINGLE CELL &amp;amp; SPATIAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== 10X CHROMIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! 10X USAGE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Assisted Service&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;DIGITAL GENE EXPRESSION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - setup || setup || $1,015.00 || $1,116.50 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - per sample || per sample || $1,750.00 || $1,925.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - setup || setup || $1,150.00 || $1,265.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - per 4 samples || per 4 samples || $2,305.00 || $2,535.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) probe based. human/mouse only - setup || setup (up to 48 samples) || $2,700.00 || $2,970.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per sample (1-plex) || per sample || $270.00 || $297.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per 4-plex || per 4 samples || $3,900.00 || $4,290.00 &lt;br /&gt;
|-&lt;br /&gt;
| Amplicon (CITE-SEQ, TCR, BCR, antibody barcode, etc. // per amplicon) - setup || setup || $470.00 || $517.00 || additional prep beyond DGE&lt;br /&gt;
|-&lt;br /&gt;
| Amplicon - per sample || per sample || $45.00 || $50.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;scATACseq&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - setup || setup || $880.00 || $968.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - per sample || per sample || $1,675.00 || $1,843.00 || Includes QC and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;Multiome (ATAC+3&#039;RNA)&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| MULTI - setup || setup || $1,800.00 || $1,980.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| MULTI - per sample || per sample || $3,100.00 || $3,410.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;CANCELLATION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| per session || &amp;lt;24h notice || $200.00 || $220.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
* please let BMC know if you plan to run this method early so we will have reagents ready for you.&lt;br /&gt;
&lt;br /&gt;
=== VISIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SLIDES !! Batch Size !! KI Only !! [[BioMicroCenter:CoreDeps|Other CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Test Array || slide || colspan=&amp;quot;2&amp;quot; | $975.00 || $1,071.00 || recommended 1x per tissue type for fresh frozen&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - Fresh Frozen || 1 slide / 4 tiles || colspan=&amp;quot;2&amp;quot; | $6,010.00 || $6,609.00 || Includes H&amp;amp;E stain images + Library Generation&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - FFPE (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $4,550.00 || $4,996.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - HD (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $7,850.00 || $8,596.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| QC - FFPE Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $60.00 || $66.00 || RNA isolation from FFPE scroll&lt;br /&gt;
|-&lt;br /&gt;
| QC - Fresh Frozen Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $40.00 || $44.00 || RNA isolation from FF scroll&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== AVITI24 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! AVITI24 SPATIAL !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Slide Only || per slide || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Optimization Only || per slide || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| Teton Panel || per slide || $7,200.00 || $7,920.00 &lt;br /&gt;
|-&lt;br /&gt;
| Atlas Short || per slide || $5,500.00 || $6,050.00 &lt;br /&gt;
|-&lt;br /&gt;
| Antibody Add-on || per slide || $360.00 || $396.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== OTHER GENOMICS SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== [[BioMicroCenter:QC|QUALITY CONTROL]] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! QUALITY CONTROL !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: RNA or DNA || per sample || $15.00 || $16.50 &lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: Preloaded row || per row (12) || $80.00 || $88.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: RNA or DNA || per sample || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: Preloaded Row || per row (12) || $160.00 || $176.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| BioAnalyzer: Walkup Service || per chip || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (Short read quantification test) || per sample || $25.00 || $27.50 || 4 point serial dilution&lt;br /&gt;
|-&lt;br /&gt;
| Full plate qPCR (short read quantification test) || per plate || $400.00 || $440.00 || full plate only (exclude column 1 for standards) - must be to BMC specifications.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Sample QC services:&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Fresh Frozen Curl || per curl || $40.00 || $44.00 &lt;br /&gt;
|-&lt;br /&gt;
| FFPE Curl || per curl || $60.00 || $66.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OLIGO SYNTHESIS ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Platform !! Service !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Dr.Oligo || Assisted || $2,000.00 +consumables || $2,200.00 +consumables || includes setup and run of the instrument only. Large reagents / N2 included.&lt;br /&gt;
|-&lt;br /&gt;
|  || Walkup || $1,000.00 +consumables || $1,100.00 +consumables || includes run of the instrument only. Large reagents / N2 included.&lt;br /&gt;
|-&lt;br /&gt;
|  || Training || $4,000.00 || $4,400.00 || includes two instrument runs.&lt;br /&gt;
|-&lt;br /&gt;
| DNAscript Syntax || Setup (per run) || $1,000.00 || $1,100.00 || Per run cost&lt;br /&gt;
|-&lt;br /&gt;
|  || 2000 nucleotide synthesis || $500.00 || $550.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
|  || 8000 nucleotide synthesis || $1,500.00 || $1,650.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
|  || add Biotin (max 48) || $115.00 || $126.00 || max 48 per run and 2 per oligo. Couple to T only.&lt;br /&gt;
|-&lt;br /&gt;
|  || add Fluor || $300.00 || $330.00 ||&lt;br /&gt;
|-&lt;br /&gt;
|  || add Quench || $100.00 || $110.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== REAL TIME PCR ==&lt;br /&gt;
&lt;br /&gt;
Email biomicro@mit.edu for training&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! iLabs&lt;br /&gt;
|-&lt;br /&gt;
| Roche LightCycler 480 || $15.00 || per plate ||[https://mit.ilabsolutions.com/schedules/261680#/schedule/ ilab  qPCR calendar]&lt;br /&gt;
|-&lt;br /&gt;
| SYBR Green (KAPA/Roche) || $45.00 || per ml || [https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]&lt;br /&gt;
|-&lt;br /&gt;
| 96-well PLATES || $10.00 || per plate ||[https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]  &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
== OTHER LAB SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;COVARIS SONICATOR&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| COVARIS E220 || $20.00 / $22.00 || per hour || [https://mit.ilabsolutions.com/equipment/261752/?tab=schedule ilab calendar] || tubes available for purchase.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PIPPIN PREP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Gel Isolation || $75.00 / $82.50 || per gel (5 lanes) || TBA &lt;br /&gt;
|-&lt;br /&gt;
| Training || $25.00 / $27.50 || per session || TBA || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PLATE READER&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Varioskan || $18.00 / $20.00 || per hour || [https://mit.ilabsolutions.com/schedules/262715#/schedule/ ilabs plate reader calendar] || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;ROBOTICS&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Tecan EVO 150 || $75.00 / $82.50 || per 1h block - based on scheduled time. || [ &lt;br /&gt;
|-&lt;br /&gt;
| non-filter tips || $8.00 / $8.80 || per box ||  || ** Please let us know if there is additional plasticware you would like us to stock.&lt;br /&gt;
|-&lt;br /&gt;
| Filter tips || $12.00 / $13.20 || per box ||  [https://mit.ilabsolutions.com/service_center/3381/?tab=services services request]&lt;br /&gt;
|-&lt;br /&gt;
| Training || $65.00 / $71.50 || per hour || Email biomicro@mit.edu for training &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;NANODROP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Nanodrop || -- ||  || Walk up service || * no charge&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== COMPUTATIONAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! COMPUTATIONAL SERVICES !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! Other MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Support || per hour || $90.00 || $125.00 || Very limited support for non-MIT users&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Share || per 0.1FTE || $1,250.00 || N/A || MIT only. Priority access to informatics.&lt;br /&gt;
|-&lt;br /&gt;
| Ingenuity Pathway Analysis || per dataset || $100.00 || $110.00 || Recovery of licence cost.&lt;br /&gt;
|-&lt;br /&gt;
| Active Data storage || per TB per year || $100.00 || $300.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Tape Archive / Recovery || per tape || $60.00 || $70.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Training Classes || per session || $50.00 || $100.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
OLD&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2025 | FY2025 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023b | FY2023-Feb Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023 | FY2023 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2022 | FY2022 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2021 | FY2021 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2019 | FY2019 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2017 | FY2017 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2016 | FY2016 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2015 | FY2015 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2014 | FY2014 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2013 | FY2013 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2012 | FY2012 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2011 | FY2011 Pricing]]&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131325</id>
		<title>MIT:Pricing</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131325"/>
		<updated>2026-04-15T18:45:43Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* SHORT READ LIBRARY - RNA */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== SEQUENCING - HIGH OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== NOVASEQX / NOVASEQ6000 SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! NOVASEQ SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 100nt || $3,699.00 || $4,068.90 || rowspan=&amp;quot;9&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 300nt** || $5,238.00 || $5,761.80 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 500nt || $7,020.00 || $7,722.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 100nt** || $5,832.00 || $6,415.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 200nt** || $7,452.00 || $8,197.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 300nt** || $8,127.00 || $8,939.70 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 100nt** || $10,395.00 || $11,434.50 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 200nt** || $12,960.00 || $14,256.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 300nt** || $13,500.00 || $14,850.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 50nt &amp;lt;br&amp;gt; Lane**|| $3,780.00 || $4,158.00 || rowspan=&amp;quot;2&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 300nt &amp;lt;br&amp;gt; Lane**|| $5,400.00 || $5,940.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 150PE &amp;lt;br&amp;gt; Lane^^ || $1,850.00 || $2,000.00 || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 150PE &amp;lt;br&amp;gt; Lane^^ || $2,600.00 || $2,860.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 300nt^^ || $12,160.00 || $13,376.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 300nt^^ || $16,200.00 || $17,820.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 100nt^^ || $5,750.00 || $6,325.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
** - minimal inventory maintained&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - MID OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Element_Sequencing ELEMENT AVITI24] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ELEMENT AVITI SEQUENCING !! Lane/Flowcell !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 75PE / 150nt || Full flowcell (2 lane, ~800M reads) || $1,900.00 || $2,090.00 || per flowcell || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,000.00 || $1,100.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 150PE / 300nt || Full flowcell (2 lane, ~800M reads) || $2,650.00 || $2,915.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,375.00 || $1,513.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 300PE / 600nt || Full flowcell (~200M reads) || $3,500.00 || $3,850.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - LOW OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Singular_Sequencing#Requirements%2FThings_to_Consider SINGULAR G4] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SINGULAR G4 SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 50 PE: F3 Lane (~100M reads) || $300.00 || $330.00 || per lane || rowspan=&amp;quot;3&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| Rapid 300nt: F3 flowcell* || $1,800.00 || $1,980.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
| 150 PE: F3 Lane (~100M reads) || $450.00 || $495.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
* Rapid flowcells are required for adapted Illumina libraries.&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== MISEQ SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Assisted ====&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt || $715.00 || $786.50 &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $1,040.00 || $1,144.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $925.00 || $1,017.50 &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt|| $1,334.00 || $1,467.40 &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,570.00 || $1,727.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt|| $2,590.00 || $2,849.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,540.00 || $1,694.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Walkup ====&lt;br /&gt;
Training and lab storage on BMC servers required. Run must be scheduled in the [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar.]&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 Kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! RunTime &lt;br /&gt;
|-&lt;br /&gt;
| Machine usage || $120.00 || $132.00 || Xh  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt|| $381.00 || $419.10 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $665.00 || $731.50 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $565.00 || $621.50 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt || $920.00 || $1,012.00 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,125.00 || $1,238.00 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt || $1,921.00 || $2,113.10 || 24h &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,130.00 || $1,243.00 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $1,638.50 || $1,802.35 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $1,638.50 || $1,802.35 || 16h &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq classic ====&lt;br /&gt;
&lt;br /&gt;
* MiSeq is off contract and will be retired upon instrument failure&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! MISEQ kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT&lt;br /&gt;
|-&lt;br /&gt;
| 70nt V2 || $1,320.00 || $1,452.00 &lt;br /&gt;
|-&lt;br /&gt;
| 150nt V3 || $1,430.00 || $1,573.00 &lt;br /&gt;
|-&lt;br /&gt;
| 300nt V2 || $1,595.00 || $1,754.50 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt V2 || $1,760.00 || $1,936.00 &lt;br /&gt;
|-&lt;br /&gt;
| 600nt V3  || $2,200.00 || $2,420.00 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt &#039;&#039;&#039;NANO&#039;&#039;&#039; Run  || $770.00 || $847.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OTHER SHORT READ SERVICES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SHORT READ SUPPORTING SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Quality Control Only - only one QC is included per sequencing lane. || $35.00 || $38.50 || per sample || Includes RT-PCR and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Quality Control - Use SYBR for sample quantification for pooling instead of qPCR. Only available for pooling. || $15.00 || $16.50 || per sample || Includes Fluorometric quantification and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (short read) || $25.00 || $27.50 || per sample || Includes qPCR values from standard QC only&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only - full plate (short read) || $400.00 || $440.00 || per plate || excludes column 1 (used for controls)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LONG READ SEQUENCING ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PROMETHION SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $1,200.00 || $1,320.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PACBIO REVIO SEQUENCING^^ !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $2,900.00 || $3,190.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== LIBRARY GENERATION ==&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - CONVERSION ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Input library !! Convert To !! Method !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || Index Overwrite (per sample) || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || P5/P7 conversion (per pool) || $100.00 || $110.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - DNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;STANDARD THROUGHPUT DNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| LIGATION BASED NEB UltraII || STD || per sample || $105.00 || $115.00 || Includes QC, adapter ligation, size selection, barcoding, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT DNA&#039;&#039;&#039;  Prices for sample batches. Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. &lt;br /&gt;
|-&lt;br /&gt;
| HTL NEB UltraII || HTL || 24 || $900.00 || $990.00 || Includes adapter ligation, size selection, barcoding, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-XT || STD || per Sample || $105.00 || $115.00 || Includes set-up, tagmentation, indexing, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-Flex || STD || per Sample || $157.00 || $173.00 &lt;br /&gt;
|-&lt;br /&gt;
| NEXTERA-XT OR FLEX || HTL || 24 || $900.00 || $990.00 || Includes tagmentation, indexing, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| 16S Amplicon || HTL || 48 || $1,900.00 || $2,090.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $650.00 || $715.00 &lt;br /&gt;
|-&lt;br /&gt;
| Other Amplicon || HTL || 48 || $1,600.00 || $1,760.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA). Samples *must* be submitted amplified with appropriate linkers.&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $630.00 || $693.00 &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples submitted not in a plated format will be subject to these additional charges. &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || STD || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || STD || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || STD || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - RNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
|&#039;&#039;&#039;STANDARD RNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| polyA based isolation NEB UltraII RNAseq || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $157.00 || $173.00 || Includes QC, polyA isolation, generation of cDNA, library construction, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $235.00 || $258.50 || Includes sample QC, ribosomal depletion, generation of cDNA, library construction, indexing and library quality control.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;STD&#039;&#039;&#039; v4 || per sample || $262.00 || $289.00 || Includes generation of cDNA, amplification, library construction, indexing and quality control (SYBR + FA). Single sample includes initial QC.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || STD || per sample || $210.00 || $231.00 || Includes generation of cDNA, amplification, library construction, rRNA degradation, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Small RNA || STD || per sample || $289.00 || $318.00 || Uses NEB, BIOO or QIAGEN small RNA kit&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;HIGH THROUGHPUT RNA&#039;&#039;&#039;  Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. Mixing of multiple projects not recommended. &lt;br /&gt;
|-&lt;br /&gt;
| polyA NEB UltraII RNAseq || &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || 24 || $1,500.00 || $1,650.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || 96 || $3,000.00 || $3,300.00 &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput 3&#039; Digital Gene Expression (HT3DGE) || &#039;&#039;&#039;HTL&#039;&#039;&#039; || 24 || $1,050.00 || $1,155.00 || Includes generation of cDNA, library construction, indexing and library quality control. Does not include sample QC.&lt;br /&gt;
|-&lt;br /&gt;
|  || &#039;&#039;&#039;HTL&#039;&#039;&#039; || 96 || $2,100.00 || $2,310.00 &lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || 24 || $2,500.00 || $2,750.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || 24 || $2,000.00 || $2,200.00 &lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $3,200.00 || $3,520.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || 24 || $3,000.00 || $3,300.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples not in proper input format will be subject to these additional charges. ||&lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup ||  || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup ||  || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification ||  || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
=== LONG READ LIBRARIES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Oxford Nanopore Sample Preparation !! Nanopore Kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Standard Ligation || LSK || $160.00 || $176.00 || rowspan=&amp;quot;6&amp;quot; | Oxford Nanopore prep methods remain highly experimental and are continually in flux. As such, we can only estimate cost based on reagents/effort and cannot guarantee results. Please consult the core prior to sample submission for the latest information.&lt;br /&gt;
|-&lt;br /&gt;
| Native Barcoding (ligation indexing) || - || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| SMARTseq -&amp;gt; Ligation || Cv4+LSK || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| Rapid Prep (tagment - ~10-20kb) || RAD || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Long Insert Prep || RAD (modified, target &amp;gt;100kb) || $262.00 || $289.00 &lt;br /&gt;
|-&lt;br /&gt;
| Direct RNA || RNA004 || $160.00 || $176.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SAMPLE EXTRACTION ==&lt;br /&gt;
&lt;br /&gt;
=== CHEMAGIC360 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! TYPE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| DNA || 96 || $700.00 || $770.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA || 96 || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 12 samples || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 96 samples || $1,000.00 || $1,100.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SINGLE CELL &amp;amp; SPATIAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== 10X CHROMIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! 10X USAGE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Assisted Service&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;DIGITAL GENE EXPRESSION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - setup || setup || $1,015.00 || $1,116.50 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - per sample || per sample || $1,750.00 || $1,925.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - setup || setup || $1,150.00 || $1,265.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - per 4 samples || per 4 samples || $2,305.00 || $2,535.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) probe based. human/mouse only - setup || setup (up to 48 samples) || $2,700.00 || $2,970.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per sample (1-plex) || per sample || $270.00 || $297.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per 4-plex || per 4 samples || $3,900.00 || $4,290.00 &lt;br /&gt;
|-&lt;br /&gt;
| Amplicon (CITE-SEQ, TCR, BCR, antibody barcode, etc. // per amplicon) - setup || setup || $470.00 || $517.00 || additional prep beyond DGE&lt;br /&gt;
|-&lt;br /&gt;
| Amplicon - per sample || per sample || $45.00 || $50.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;scATACseq&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - setup || setup || $880.00 || $968.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - per sample || per sample || $1,675.00 || $1,843.00 || Includes QC and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;Multiome (ATAC+3&#039;RNA)&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| MULTI - setup || setup || $1,800.00 || $1,980.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| MULTI - per sample || per sample || $3,100.00 || $3,410.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;CANCELLATION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| per session || &amp;lt;24h notice || $200.00 || $220.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
* please let BMC know if you plan to run this method early so we will have reagents ready for you.&lt;br /&gt;
&lt;br /&gt;
=== VISIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SLIDES !! Batch Size !! KI Only !! [[BioMicroCenter:CoreDeps|Other CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Test Array || slide || colspan=&amp;quot;2&amp;quot; | $975.00 || $1,071.00 || recommended 1x per tissue type for fresh frozen&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - Fresh Frozen || 1 slide / 4 tiles || colspan=&amp;quot;2&amp;quot; | $6,010.00 || $6,609.00 || Includes H&amp;amp;E stain images + Library Generation&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - FFPE (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $4,550.00 || $4,996.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - HD (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $7,850.00 || $8,596.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| QC - FFPE Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $60.00 || $66.00 || RNA isolation from FFPE scroll&lt;br /&gt;
|-&lt;br /&gt;
| QC - Fresh Frozen Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $40.00 || $44.00 || RNA isolation from FF scroll&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== AVITI24 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! AVITI24 SPATIAL !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Slide Only || per slide || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Optimization Only || per slide || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| Teton Panel || per slide || $7,200.00 || $7,920.00 &lt;br /&gt;
|-&lt;br /&gt;
| Atlas Short || per slide || $5,500.00 || $6,050.00 &lt;br /&gt;
|-&lt;br /&gt;
| Antibody Add-on || per slide || $360.00 || $396.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== OTHER GENOMICS SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== [[BioMicroCenter:QC|QUALITY CONTROL]] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! QUALITY CONTROL !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: RNA or DNA || per sample || $15.00 || $16.50 &lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: Preloaded row || per row (12) || $80.00 || $88.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: RNA or DNA || per sample || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: Preloaded Row || per row (12) || $160.00 || $176.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| BioAnalyzer: Walkup Service || per chip || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (Short read quantification test) || per sample || $25.00 || $27.50 || 4 point serial dilution&lt;br /&gt;
|-&lt;br /&gt;
| Full plate qPCR (short read quantification test) || per plate || $400.00 || $440.00 || full plate only (exclude column 1 for standards) - must be to BMC specifications.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Sample QC services:&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Fresh Frozen Curl || per curl || $40.00 || $44.00 &lt;br /&gt;
|-&lt;br /&gt;
| FFPE Curl || per curl || $60.00 || $66.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OLIGO SYNTHESIS ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Platform !! Service !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Dr.Oligo || Assisted || $2,000.00 +consumables || $2,200.00 +consumables || includes setup and run of the instrument only. Large reagents / N2 included.&lt;br /&gt;
|-&lt;br /&gt;
|  || Walkup || $1,000.00 +consumables || $1,100.00 +consumables || includes run of the instrument only. Large reagents / N2 included.&lt;br /&gt;
|-&lt;br /&gt;
|  || Training || $4,000.00 || $4,400.00 || includes two instrument runs.&lt;br /&gt;
|-&lt;br /&gt;
| DNAscript Syntax || Setup (per run) || $1,000.00 || $1,100.00 || Per run cost&lt;br /&gt;
|-&lt;br /&gt;
|  || 2000 nucleotide synthesis || $500.00 || $550.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
|  || 8000 nucleotide synthesis || $1,500.00 || $1,650.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
|  || add Biotin (max 48) || $115.00 || $126.00 || max 48 per run and 2 per oligo. Couple to T only.&lt;br /&gt;
|-&lt;br /&gt;
|  || add Fluor || $300.00 || $330.00 ||&lt;br /&gt;
|-&lt;br /&gt;
|  || add Quench || $100.00 || $110.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== REAL TIME PCR ==&lt;br /&gt;
&lt;br /&gt;
Email biomicro@mit.edu for training&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! iLabs&lt;br /&gt;
|-&lt;br /&gt;
| Roche LightCycler 480 || $15.00 || per plate ||[https://mit.ilabsolutions.com/schedules/261680#/schedule/ ilab  qPCR calendar]&lt;br /&gt;
|-&lt;br /&gt;
| SYBR Green (KAPA/Roche) || $45.00 || per ml || [https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]&lt;br /&gt;
|-&lt;br /&gt;
| 96-well PLATES || $10.00 || per plate ||[https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]  &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
== OTHER LAB SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;COVARIS SONICATOR&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| COVARIS E220 || $20.00 / $22.00 || per hour || [https://mit.ilabsolutions.com/equipment/261752/?tab=schedule ilab calendar] || tubes available for purchase.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PIPPIN PREP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Gel Isolation || $75.00 / $82.50 || per gel (5 lanes) || TBA &lt;br /&gt;
|-&lt;br /&gt;
| Training || $25.00 / $27.50 || per session || TBA || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PLATE READER&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Varioskan || $18.00 / $20.00 || per hour || [https://mit.ilabsolutions.com/schedules/262715#/schedule/ ilabs plate reader calendar] || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;ROBOTICS&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Tecan EVO 150 || $75.00 / $82.50 || per 1h block - based on scheduled time. || [ &lt;br /&gt;
|-&lt;br /&gt;
| non-filter tips || $8.00 / $8.80 || per box ||  || ** Please let us know if there is additional plasticware you would like us to stock.&lt;br /&gt;
|-&lt;br /&gt;
| Filter tips || $12.00 / $13.20 || per box ||  [https://mit.ilabsolutions.com/service_center/3381/?tab=services services request]&lt;br /&gt;
|-&lt;br /&gt;
| Training || $65.00 / $71.50 || per hour || Email biomicro@mit.edu for training &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;NANODROP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Nanodrop || -- ||  || Walk up service || * no charge&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== COMPUTATIONAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! COMPUTATIONAL SERVICES !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! Other MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Support || per hour || $90.00 || $125.00 || Very limited support for non-MIT users&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Share || per 0.1FTE || $1,250.00 || N/A || MIT only. Priority access to informatics.&lt;br /&gt;
|-&lt;br /&gt;
| Ingenuity Pathway Analysis || per dataset || $100.00 || $110.00 || Recovery of licence cost.&lt;br /&gt;
|-&lt;br /&gt;
| Active Data storage || per TB per year || $100.00 || $300.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Tape Archive / Recovery || per tape || $60.00 || $70.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Training Classes || per session || $50.00 || $100.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
OLD&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2025 | FY2025 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023b | FY2023-Feb Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023 | FY2023 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2022 | FY2022 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2021 | FY2021 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2019 | FY2019 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2017 | FY2017 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2016 | FY2016 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2015 | FY2015 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2014 | FY2014 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2013 | FY2013 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2012 | FY2012 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2011 | FY2011 Pricing]]&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
	<entry>
		<id>http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131324</id>
		<title>MIT:Pricing</title>
		<link rel="alternate" type="text/html" href="http://bmcwiki.mit.edu/index.php?title=MIT:Pricing&amp;diff=131324"/>
		<updated>2026-04-15T18:45:08Z</updated>

		<summary type="html">&lt;p&gt;Hilo1: /* SHORT READ LIBRARY - RNA */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;== SEQUENCING - HIGH OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== NOVASEQX / NOVASEQ6000 SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! NOVASEQ SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 100nt || $3,699.00 || $4,068.90 || rowspan=&amp;quot;9&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 300nt** || $5,238.00 || $5,761.80 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq SP 500nt || $7,020.00 || $7,722.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 100nt** || $5,832.00 || $6,415.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 200nt** || $7,452.00 || $8,197.20 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S1 300nt** || $8,127.00 || $8,939.70 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 100nt** || $10,395.00 || $11,434.50 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 200nt** || $12,960.00 || $14,256.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S2 300nt** || $13,500.00 || $14,850.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 50nt &amp;lt;br&amp;gt; Lane**|| $3,780.00 || $4,158.00 || rowspan=&amp;quot;2&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeq S4 300nt &amp;lt;br&amp;gt; Lane**|| $5,400.00 || $5,940.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 150PE &amp;lt;br&amp;gt; Lane^^ || $1,850.00 || $2,000.00 || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 150PE &amp;lt;br&amp;gt; Lane^^ || $2,600.00 || $2,860.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 10B 300nt^^ || $12,160.00 || $13,376.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 300nt^^ || $16,200.00 || $17,820.00 &lt;br /&gt;
|-&lt;br /&gt;
| NovaSeqX 25B 100nt^^ || $5,750.00 || $6,325.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
** - minimal inventory maintained&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - MID OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Element_Sequencing ELEMENT AVITI24] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ELEMENT AVITI SEQUENCING !! Lane/Flowcell !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 75PE / 150nt || Full flowcell (2 lane, ~800M reads) || $1,900.00 || $2,090.00 || per flowcell || rowspan=&amp;quot;5&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,000.00 || $1,100.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 150PE / 300nt || Full flowcell (2 lane, ~800M reads) || $2,650.00 || $2,915.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
|  || One lane (~400M reads) || $1,375.00 || $1,513.00 || per lane &lt;br /&gt;
|-&lt;br /&gt;
| 300PE / 600nt || Full flowcell (~200M reads) || $3,500.00 || $3,850.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SEQUENCING - LOW OUTPUT ==&lt;br /&gt;
&lt;br /&gt;
Please note that samples submitted from [[BioMicroCenter:CoreDeps|&#039;&#039;&#039;CORE LAB&#039;&#039;&#039;s]] will be given priority on all equipment. The BioMicro Center reserves the right to reject samples for any reason.&lt;br /&gt;
&lt;br /&gt;
=== [https://openwetware.org/wiki/BioMicroCenter:Singular_Sequencing#Requirements%2FThings_to_Consider SINGULAR G4] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SINGULAR G4 SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 50 PE: F3 Lane (~100M reads) || $300.00 || $330.00 || per lane || rowspan=&amp;quot;3&amp;quot; | Includes final pool quality control (RT-PCR and FA), sequencing, and data storage of FASTQ files for 1 year&lt;br /&gt;
|-&lt;br /&gt;
| Rapid 300nt: F3 flowcell* || $1,800.00 || $1,980.00 || per flowcell &lt;br /&gt;
|-&lt;br /&gt;
| 150 PE: F3 Lane (~100M reads) || $450.00 || $495.00 || per lane &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
* Rapid flowcells are required for adapted Illumina libraries.&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
=== MISEQ SEQUENCING ===&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Assisted ====&lt;br /&gt;
Includes final pool quality control (RT-PCR and BioAnalyzer), sequencing, genome alignment and data storage of FASTQ files for 1 year.&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt || $715.00 || $786.50 &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $1,040.00 || $1,144.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $925.00 || $1,017.50 &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt|| $1,334.00 || $1,467.40 &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,570.00 || $1,727.00 &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt|| $2,590.00 || $2,849.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,540.00 || $1,694.00 &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $2,125.00 || $2,337.50 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq i100 Walkup ====&lt;br /&gt;
Training and lab storage on BMC servers required. Run must be scheduled in the [https://mit.ilabsolutions.com/schedules/555535#/schedule/ iLabs calendar.]&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
!i100 Kit!! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! RunTime &lt;br /&gt;
|-&lt;br /&gt;
| Machine usage || $120.00 || $132.00 || Xh  &lt;br /&gt;
|-&lt;br /&gt;
|5M 300nt|| $381.00 || $419.10 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|5M 600nt || $665.00 || $731.50 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 100nt || $565.00 || $621.50 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|25M 300nt || $920.00 || $1,012.00 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|25M 600nt || $1,125.00 || $1,238.00 || 16h  &lt;br /&gt;
|-&lt;br /&gt;
|25M 1000nt || $1,921.00 || $2,113.10 || 24h &lt;br /&gt;
|-&lt;br /&gt;
|100M 100nt || $1,130.00 || $1,243.00 || 5h &lt;br /&gt;
|-&lt;br /&gt;
|100M 300nt || $1,638.50 || $1,802.35 || 8h &lt;br /&gt;
|-&lt;br /&gt;
|50M 600nt || $1,638.50 || $1,802.35 || 16h &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==== MiSeq classic ====&lt;br /&gt;
&lt;br /&gt;
* MiSeq is off contract and will be retired upon instrument failure&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! MISEQ kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT&lt;br /&gt;
|-&lt;br /&gt;
| 70nt V2 || $1,320.00 || $1,452.00 &lt;br /&gt;
|-&lt;br /&gt;
| 150nt V3 || $1,430.00 || $1,573.00 &lt;br /&gt;
|-&lt;br /&gt;
| 300nt V2 || $1,595.00 || $1,754.50 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt V2 || $1,760.00 || $1,936.00 &lt;br /&gt;
|-&lt;br /&gt;
| 600nt V3  || $2,200.00 || $2,420.00 &lt;br /&gt;
|-&lt;br /&gt;
| 500nt &#039;&#039;&#039;NANO&#039;&#039;&#039; Run  || $770.00 || $847.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OTHER SHORT READ SERVICES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SHORT READ SUPPORTING SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Quality Control Only - only one QC is included per sequencing lane. || $35.00 || $38.50 || per sample || Includes RT-PCR and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| Rapid Quality Control - Use SYBR for sample quantification for pooling instead of qPCR. Only available for pooling. || $15.00 || $16.50 || per sample || Includes Fluorometric quantification and Frag.Analyzer&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (short read) || $25.00 || $27.50 || per sample || Includes qPCR values from standard QC only&lt;br /&gt;
|-&lt;br /&gt;
| qPCR only - full plate (short read) || $400.00 || $440.00 || per plate || excludes column 1 (used for controls)&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== LONG READ SEQUENCING ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PROMETHION SEQUENCING !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $1,200.00 || $1,320.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! PACBIO REVIO SEQUENCING^^ !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! unit !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| 72 hour Flowcell || $2,900.00 || $3,190.00 || per Flowcell || Fastq stored for 1y. Trace data stored only 30d.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
&amp;lt;pre&amp;gt;&lt;br /&gt;
^^ - through collaboration with nearby academic shared resources&lt;br /&gt;
&amp;lt;/pre&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== LIBRARY GENERATION ==&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - CONVERSION ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Input library !! Convert To !! Method !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || Index Overwrite (per sample) || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| Illumina || Singular || P5/P7 conversion (per pool) || $100.00 || $110.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - DNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;STANDARD THROUGHPUT DNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| LIGATION BASED NEB UltraII || STD || per sample || $105.00 || $115.00 || Includes QC, adapter ligation, size selection, barcoding, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;HIGH THROUGHPUT DNA&#039;&#039;&#039;  Prices for sample batches. Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. &lt;br /&gt;
|-&lt;br /&gt;
| HTL NEB UltraII || HTL || 24 || $900.00 || $990.00 || Includes adapter ligation, size selection, barcoding, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-XT || STD || per Sample || $105.00 || $115.00 || Includes set-up, tagmentation, indexing, enrichment, and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
| Tagmentation Nextera-Flex || STD || per Sample || $157.00 || $173.00 &lt;br /&gt;
|-&lt;br /&gt;
| NEXTERA-XT OR FLEX || HTL || 24 || $900.00 || $990.00 || Includes tagmentation, indexing, enrichment, and quality control spotcheck (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || 96 || $1,800.00 || $1,980.00 &lt;br /&gt;
|-&lt;br /&gt;
| 16S Amplicon || HTL || 48 || $1,900.00 || $2,090.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $650.00 || $715.00 &lt;br /&gt;
|-&lt;br /&gt;
| Other Amplicon || HTL || 48 || $1,600.00 || $1,760.00 || Includes normalization, enrichment, pooling and quality control (SYBR and FA). Samples *must* be submitted amplified with appropriate linkers.&lt;br /&gt;
|-&lt;br /&gt;
|  || HTL || add&#039;l 48 || $630.00 || $693.00 &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples submitted not in a plated format will be subject to these additional charges. &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup || STD || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup || STD || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification || STD || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== SHORT READ LIBRARY - RNA ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! ILLUMINA Sample Preparation !! Type !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;6&amp;quot; | &#039;&#039;&#039;STANDARD RNA&#039;&#039;&#039;  Prices for individual samples. Repreps will typically be attempted on failed samples without charge. &lt;br /&gt;
|-&lt;br /&gt;
| polyA based isolation NEB UltraII RNAseq || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $157.00 || $173.00 || Includes QC, polyA isolation, generation of cDNA, library construction, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || &#039;&#039;&#039;STD&#039;&#039;&#039; || per sample || $235.00 || $258.50 || Includes sample QC, ribosomal depletion, generation of cDNA, library construction, indexing and library quality control.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;STD&#039;&#039;&#039; v4 || per sample || $262.00 || $289.00 || Includes generation of cDNA, amplification, library construction, indexing and quality control (SYBR + FA). Single sample includes initial QC.&lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || STD || per sample || $210.00 || $231.00 || Includes generation of cDNA, amplification, library construction, rRNA degradation, indexing and quality control (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
| Small RNA || STD || per sample || $289.00 || $318.00 || Uses NEB, BIOO or QIAGEN small RNA kit&lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;HIGH THROUGHPUT RNA&#039;&#039;&#039;  Repreps will NOT be attempted on failed samples without charge. Low volume (&amp;lt;=5ul) submission must be coordinated with BMC staff. Initial QC not included. Mixing of multiple projects not recommended. &lt;br /&gt;
|-&lt;br /&gt;
| polyA NEB UltraII RNAseq || &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || 24 || $1,500.00 || $1,650.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  || &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only) || 96 || $3,000.00 || $3,300.00 &lt;br /&gt;
|-&lt;br /&gt;
| High Throughput 3&#039; Digital Gene Expression (HT3DGE) || &#039;&#039;&#039;HTL&#039;&#039;&#039; || 24 || $1,050.00 || $1,155.00 || Includes generation of cDNA, library construction, indexing and library quality control. Does not include sample QC.&lt;br /&gt;
|-&lt;br /&gt;
|  || &#039;&#039;&#039;HTL&#039;&#039;&#039; || 96 || $2,100.00 || $2,310.00 &lt;br /&gt;
|-&lt;br /&gt;
| Total RNA sequencing NEB RNAseq +Ribodepletion || &#039;&#039;&#039;HTL&#039;&#039;&#039; (NEB only, covaris RNA fragmentation) || 24 || $2,500.00 || $2,750.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input polyA+ Clontech SMARTseq + NexteraXT or Flex || &#039;&#039;&#039;HTL&#039;&#039;&#039; v2 || 24 || $2,000.00 || $2,200.00 &lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $3,200.00 || $3,520.00 &lt;br /&gt;
|-&lt;br /&gt;
| Low Input Mammalian Total Clontech ZapR Kit || &#039;&#039;&#039;HTL&#039;&#039;&#039; (covaris RNA fragmentation) || 24 || $3,000.00 || $3,300.00 || Includes polyA isolation, generation of cDNA, library construction, indexing and spot QC (SYBR + FA).&lt;br /&gt;
|-&lt;br /&gt;
|  ||  || 96 || $5,000.00 || $5,500.00 &lt;br /&gt;
|-&lt;br /&gt;
| &#039;&#039;&#039;ADDITIONAL FEES&#039;&#039;&#039;  Samples not in proper input format will be subject to these additional charges. ||&lt;br /&gt;
|-&lt;br /&gt;
| High Throughput Setup ||  || 48 samples || $60.00 || $66.00 &lt;br /&gt;
|-&lt;br /&gt;
| Sample Cleanup ||  || per sample || $5.00 || $5.50 || SPRI cleanup of samples to remove impurities.&lt;br /&gt;
|-&lt;br /&gt;
| Quantification ||  || per sample || $10.00 || $11.00 || Quantification of samples (FA) prior to arraying.&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
=== LONG READ LIBRARIES ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Oxford Nanopore Sample Preparation !! Nanopore Kit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Standard Ligation || LSK || $160.00 || $176.00 || rowspan=&amp;quot;6&amp;quot; | Oxford Nanopore prep methods remain highly experimental and are continually in flux. As such, we can only estimate cost based on reagents/effort and cannot guarantee results. Please consult the core prior to sample submission for the latest information.&lt;br /&gt;
|-&lt;br /&gt;
| Native Barcoding (ligation indexing) || - || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| SMARTseq -&amp;gt; Ligation || Cv4+LSK || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| Rapid Prep (tagment - ~10-20kb) || RAD || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Long Insert Prep || RAD (modified, target &amp;gt;100kb) || $262.00 || $289.00 &lt;br /&gt;
|-&lt;br /&gt;
| Direct RNA || RNA004 || $160.00 || $176.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SAMPLE EXTRACTION ==&lt;br /&gt;
&lt;br /&gt;
=== CHEMAGIC360 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! TYPE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| DNA || 96 || $700.00 || $770.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA || 96 || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 12 samples || $300.00 || $330.00 &lt;br /&gt;
|-&lt;br /&gt;
| RNA/DNA Isolation - Assisted || 96 samples || $1,000.00 || $1,100.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== SINGLE CELL &amp;amp; SPATIAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== 10X CHROMIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! 10X USAGE !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Assisted Service&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;DIGITAL GENE EXPRESSION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - setup || setup || $1,015.00 || $1,116.50 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - per sample || per sample || $1,750.00 || $1,925.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - setup || setup || $1,150.00 || $1,265.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| 5&#039; RNA / 3&#039; RNA - on chip multiplexing - per 4 samples || per 4 samples || $2,305.00 || $2,535.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) probe based. human/mouse only - setup || setup (up to 48 samples) || $2,700.00 || $2,970.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per sample (1-plex) || per sample || $270.00 || $297.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| Fixed RNA (Flex v2) - per 4-plex || per 4 samples || $3,900.00 || $4,290.00 &lt;br /&gt;
|-&lt;br /&gt;
| Amplicon (CITE-SEQ, TCR, BCR, antibody barcode, etc. // per amplicon) - setup || setup || $470.00 || $517.00 || additional prep beyond DGE&lt;br /&gt;
|-&lt;br /&gt;
| Amplicon - per sample || per sample || $45.00 || $50.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;scATACseq&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - setup || setup || $880.00 || $968.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| ATACseq - per sample || per sample || $1,675.00 || $1,843.00 || Includes QC and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;Multiome (ATAC+3&#039;RNA)&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| MULTI - setup || setup || $1,800.00 || $1,980.00 || charge per submission&lt;br /&gt;
|-&lt;br /&gt;
| MULTI - per sample || per sample || $3,100.00 || $3,410.00 || Includes QC of cDNA and creation of Short Read Library&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;CANCELLATION&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| per session || &amp;lt;24h notice || $200.00 || $220.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
* please let BMC know if you plan to run this method early so we will have reagents ready for you.&lt;br /&gt;
&lt;br /&gt;
=== VISIUM ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! SLIDES !! Batch Size !! KI Only !! [[BioMicroCenter:CoreDeps|Other CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Test Array || slide || colspan=&amp;quot;2&amp;quot; | $975.00 || $1,071.00 || recommended 1x per tissue type for fresh frozen&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - Fresh Frozen || 1 slide / 4 tiles || colspan=&amp;quot;2&amp;quot; | $6,010.00 || $6,609.00 || Includes H&amp;amp;E stain images + Library Generation&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - FFPE (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $4,550.00 || $4,996.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| Sample Slide - HD (hs/mm only) || 1 slide / 2 tiles || colspan=&amp;quot;2&amp;quot; | $7,850.00 || $8,596.00 || Includes library generation only.&lt;br /&gt;
|-&lt;br /&gt;
| QC - FFPE Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $60.00 || $66.00 || RNA isolation from FFPE scroll&lt;br /&gt;
|-&lt;br /&gt;
| QC - Fresh Frozen Scroll || per scroll || colspan=&amp;quot;2&amp;quot; | $40.00 || $44.00 || RNA isolation from FF scroll&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== AVITI24 ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! AVITI24 SPATIAL !! Batch Size !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT &lt;br /&gt;
|-&lt;br /&gt;
| Slide Only || per slide || $150.00 || $165.00 &lt;br /&gt;
|-&lt;br /&gt;
| Optimization Only || per slide || $800.00 || $880.00 &lt;br /&gt;
|-&lt;br /&gt;
| Teton Panel || per slide || $7,200.00 || $7,920.00 &lt;br /&gt;
|-&lt;br /&gt;
| Atlas Short || per slide || $5,500.00 || $6,050.00 &lt;br /&gt;
|-&lt;br /&gt;
| Antibody Add-on || per slide || $360.00 || $396.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== OTHER GENOMICS SERVICES ==&lt;br /&gt;
&lt;br /&gt;
=== [[BioMicroCenter:QC|QUALITY CONTROL]] ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! QUALITY CONTROL !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: RNA or DNA || per sample || $15.00 || $16.50 &lt;br /&gt;
|-&lt;br /&gt;
| Fragment Analyzer: Preloaded row || per row (12) || $80.00 || $88.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: RNA or DNA || per sample || $30.00 || $33.00 &lt;br /&gt;
|-&lt;br /&gt;
| FemtoPulse: Preloaded Row || per row (12) || $160.00 || $176.00 || 2ul per sample in each well using plates from BMC&lt;br /&gt;
|-&lt;br /&gt;
| BioAnalyzer: Walkup Service || per chip || $50.00 || $55.00 &lt;br /&gt;
|-&lt;br /&gt;
| qPCR only (Short read quantification test) || per sample || $25.00 || $27.50 || 4 point serial dilution&lt;br /&gt;
|-&lt;br /&gt;
| Full plate qPCR (short read quantification test) || per plate || $400.00 || $440.00 || full plate only (exclude column 1 for standards) - must be to BMC specifications.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;Sample QC services:&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Fresh Frozen Curl || per curl || $40.00 || $44.00 &lt;br /&gt;
|-&lt;br /&gt;
| FFPE Curl || per curl || $60.00 || $66.00 &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
=== OLIGO SYNTHESIS ===&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! Platform !! Service !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Dr.Oligo || Assisted || $2,000.00 +consumables || $2,200.00 +consumables || includes setup and run of the instrument only. Large reagents / N2 included.&lt;br /&gt;
|-&lt;br /&gt;
|  || Walkup || $1,000.00 +consumables || $1,100.00 +consumables || includes run of the instrument only. Large reagents / N2 included.&lt;br /&gt;
|-&lt;br /&gt;
|  || Training || $4,000.00 || $4,400.00 || includes two instrument runs.&lt;br /&gt;
|-&lt;br /&gt;
| DNAscript Syntax || Setup (per run) || $1,000.00 || $1,100.00 || Per run cost&lt;br /&gt;
|-&lt;br /&gt;
|  || 2000 nucleotide synthesis || $500.00 || $550.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
|  || 8000 nucleotide synthesis || $1,500.00 || $1,650.00 || Up to 96 samples&lt;br /&gt;
|-&lt;br /&gt;
|  || add Biotin (max 48) || $115.00 || $126.00 || max 48 per run and 2 per oligo. Couple to T only.&lt;br /&gt;
|-&lt;br /&gt;
|  || add Fluor || $300.00 || $330.00 ||&lt;br /&gt;
|-&lt;br /&gt;
|  || add Quench || $100.00 || $110.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== REAL TIME PCR ==&lt;br /&gt;
&lt;br /&gt;
Email biomicro@mit.edu for training&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! iLabs&lt;br /&gt;
|-&lt;br /&gt;
| Roche LightCycler 480 || $15.00 || per plate ||[https://mit.ilabsolutions.com/schedules/261680#/schedule/ ilab  qPCR calendar]&lt;br /&gt;
|-&lt;br /&gt;
| SYBR Green (KAPA/Roche) || $45.00 || per ml || [https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]&lt;br /&gt;
|-&lt;br /&gt;
| 96-well PLATES || $10.00 || per plate ||[https://mit.ilabsolutions.com/service_center/3381/?tab=services ilab consumables request]  &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
.&lt;br /&gt;
&lt;br /&gt;
== OTHER LAB SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! OTHER LAB SERVICES !! [[BioMicroCenter:CoreDeps|CORE LAB / MIT]] !! unit !! SIGN UP !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;COVARIS SONICATOR&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| COVARIS E220 || $20.00 / $22.00 || per hour || [https://mit.ilabsolutions.com/equipment/261752/?tab=schedule ilab calendar] || tubes available for purchase.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PIPPIN PREP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Gel Isolation || $75.00 / $82.50 || per gel (5 lanes) || TBA &lt;br /&gt;
|-&lt;br /&gt;
| Training || $25.00 / $27.50 || per session || TBA || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;PLATE READER&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Varioskan || $18.00 / $20.00 || per hour || [https://mit.ilabsolutions.com/schedules/262715#/schedule/ ilabs plate reader calendar] || Email biomicro@mit.edu for training.&lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;ROBOTICS&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Tecan EVO 150 || $75.00 / $82.50 || per 1h block - based on scheduled time. || [ &lt;br /&gt;
|-&lt;br /&gt;
| non-filter tips || $8.00 / $8.80 || per box ||  || ** Please let us know if there is additional plasticware you would like us to stock.&lt;br /&gt;
|-&lt;br /&gt;
| Filter tips || $12.00 / $13.20 || per box ||  [https://mit.ilabsolutions.com/service_center/3381/?tab=services services request]&lt;br /&gt;
|-&lt;br /&gt;
| Training || $65.00 / $71.50 || per hour || Email biomicro@mit.edu for training &lt;br /&gt;
|-&lt;br /&gt;
| colspan=&amp;quot;5&amp;quot; | &#039;&#039;&#039;NANODROP&#039;&#039;&#039; &lt;br /&gt;
|-&lt;br /&gt;
| Nanodrop || -- ||  || Walk up service || * no charge&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
== COMPUTATIONAL SERVICES ==&lt;br /&gt;
&lt;br /&gt;
{| class=&amp;quot;wikitable&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! COMPUTATIONAL SERVICES !! unit !! [[BioMicroCenter:CoreDeps|CORE LAB]] !! Other MIT !! Notes&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Support || per hour || $90.00 || $125.00 || Very limited support for non-MIT users&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Share || per 0.1FTE || $1,250.00 || N/A || MIT only. Priority access to informatics.&lt;br /&gt;
|-&lt;br /&gt;
| Ingenuity Pathway Analysis || per dataset || $100.00 || $110.00 || Recovery of licence cost.&lt;br /&gt;
|-&lt;br /&gt;
| Active Data storage || per TB per year || $100.00 || $300.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Tape Archive / Recovery || per tape || $60.00 || $70.00 ||&lt;br /&gt;
|-&lt;br /&gt;
| Informatics Training Classes || per session || $50.00 || $100.00 ||&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
OLD&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2025 | FY2025 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023b | FY2023-Feb Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2023 | FY2023 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2022 | FY2022 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2021 | FY2021 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2019 | FY2019 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2017 | FY2017 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2016 | FY2016 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2015 | FY2015 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2014 | FY2014 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2013 | FY2013 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2012 | FY2012 Pricing]]&amp;lt;BR&amp;gt;&lt;br /&gt;
[[BioMicroCenter:PricingFY2011 | FY2011 Pricing]]&lt;/div&gt;</summary>
		<author><name>Hilo1</name></author>
	</entry>
</feed>