User:Gibcus/vector-2022.js

2026-02-18T17:17:34Z

Gibcus: Blanked the page

2026-02-18T16:50:02Z

Gibcus:

User:Gibcus/vector-2022.js

2026-02-18T15:59:30Z

Gibcus: Created page with "/** * User:Gibcus/common.js * MIT BioMicro Center — Modern Wiki Theme Engine * * Paste this entire file into: * https://bmcwiki.mit.edu/index.php/User:Gibcus/common.js * * It applies to YOUR login session only. * To deploy for all users, an admin with editinterface rights * must paste it into MediaWiki:Common.js instead. */ ( function () { 'use strict'; /* ============================================================ 0. WAIT FOR DOM ==============..."

/**
* User:Gibcus/common.js
* MIT BioMicro Center — Modern Wiki Theme Engine
*
* Paste this entire file into:
* https://bmcwiki.mit.edu/index.php/User:Gibcus/common.js
*
* It applies to YOUR login session only.
* To deploy for all users, an admin with editinterface rights
* must paste it into MediaWiki:Common.js instead.
*/

( function () {
'use strict';

/* ============================================================
0. WAIT FOR DOM
============================================================ */
mw.hook( 'wikipage.content' ).add( function () {
BMC.init();
} );

/* ============================================================
1. DESIGN TOKENS
============================================================ */
var TOKENS = {
black: '#0d0d0d',
darkGray: '#1a1a1a',
midGray: '#2e2e2e',
border: '#e2ddd6',
bg: '#f5f3ef',
bgCard: '#ffffff',
gold: '#b8913a',
goldHov: '#d4a84b',
red: '#8b1a1a', // MIT red accent
text: '#1c1c1c',
textMid: '#555555',
textLight:'#888888',
fontBody: "'DM Sans', 'Helvetica Neue', Arial, sans-serif",
fontMono: "'DM Mono', 'Courier New', monospace",
};

/* ============================================================
2. GLOBAL CSS — injected once, applies to every BMC page
============================================================ */
var GLOBAL_CSS = [
"@import url('https://fonts.googleapis.com/css2?family=DM+Sans:ital,wght@0,300;0,400;0,500;0,600;1,400&family=DM+Mono:wght@400;500&display=swap');",

/* --- Reset MediaWiki chrome --- */
'#mw-navigation, #mw-head, #mw-panel, #mw-sidebar-button,',
'#mw-sidebar-checkbox, .mw-footer, #footer, #p-logo,',
'.vector-menu-tabs, .vector-header-start .vector-header-logo,',
'.mw-portlet-lang, #p-cactions, .vector-page-toolbar { display: none !important; }',

'#content, #mw-content-text, .mw-body, #mw-body-content,',
'.mw-body-content { margin: 0 !important; padding: 0 !important;',
'max-width: none !important; border: none !important; }',

'body { background: ' + TOKENS.bg + ' !important;',
'font-family: ' + TOKENS.fontBody + ' !important;',
'color: ' + TOKENS.text + ' !important; margin: 0 !important; padding: 0 !important; }',

/* hide edit pencil icons in headings */
'.mw-editsection { display: none !important; }',

/* --- BMC Top Nav Bar --- */
'#bmc-topnav {',
' position: sticky; top: 0; z-index: 1000;',
' background: ' + TOKENS.black + ';',
' display: flex; align-items: center;',
' padding: 0 32px; height: 56px;',
' box-shadow: 0 1px 0 rgba(255,255,255,0.06);',
' gap: 0;',
'}',
'#bmc-topnav .bmc-nav-logo {',
' font-family: ' + TOKENS.fontBody + ';',
' font-size: 0.95em; font-weight: 600;',
' color: #fff; text-decoration: none;',
' letter-spacing: -0.01em; white-space: nowrap;',
' padding-right: 32px;',
' border-right: 1px solid #333;',
' margin-right: 8px;',
' display: flex; align-items: center; gap: 10px;',
'}',
'#bmc-topnav .bmc-nav-logo span.accent { color: ' + TOKENS.gold + '; }',
'#bmc-topnav .bmc-nav-logo img { height: 28px; width: 28px; border-radius: 4px; }',
'#bmc-nav-links {',
' display: flex; align-items: center;',
' gap: 2px; flex: 1; overflow-x: auto;',
'}',
'#bmc-nav-links a {',
' color: #aaa; text-decoration: none;',
' font-size: 0.8em; font-weight: 500;',
' letter-spacing: 0.03em;',
' padding: 6px 13px; border-radius: 6px;',
' white-space: nowrap;',
' transition: color 0.15s, background 0.15s;',
'}',
'#bmc-nav-links a:hover { color: #fff; background: #2a2a2a; }',
'#bmc-nav-links a.bmc-nav-active { color: ' + TOKENS.gold + '; }',

'#bmc-nav-right {',
' display: flex; align-items: center; gap: 12px; margin-left: auto;',
'}',
'#bmc-nav-right a.bmc-ilabs-btn {',
' background: ' + TOKENS.gold + ';',
' color: ' + TOKENS.black + '; font-weight: 600;',
' font-size: 0.75em; letter-spacing: 0.05em;',
' padding: 6px 14px; border-radius: 6px;',
' text-decoration: none; white-space: nowrap;',
' transition: background 0.15s;',
'}',
'#bmc-nav-right a.bmc-ilabs-btn:hover { background: ' + TOKENS.goldHov + '; }',
'#bmc-nav-right a.bmc-nav-search {',
' color: #888; font-size: 1.1em;',
' text-decoration: none;',
' padding: 4px 8px; border-radius: 6px;',
' transition: color 0.15s;',
'}',
'#bmc-nav-right a.bmc-nav-search:hover { color: #fff; }',

/* --- Page wrapper --- */
'#bmc-page-wrap {',
' max-width: 1140px; margin: 0 auto;',
' padding: 40px 32px 80px;',
'}',
'@media (max-width: 768px) {',
' #bmc-page-wrap { padding: 24px 16px 60px; }',
' #bmc-topnav { padding: 0 16px; }',
'}',

/* --- Page title --- */
'#bmc-page-title {',
' margin-bottom: 32px;',
'}',
'#bmc-page-title h1 {',
' font-size: 2em; font-weight: 600;',
' color: ' + TOKENS.black + '; letter-spacing: -0.025em;',
' line-height: 1.1; margin: 0 0 6px;',
'}',
'#bmc-page-title .bmc-subtitle {',
' font-size: 0.92em; color: ' + TOKENS.textMid + ';',
' font-weight: 400;',
'}',

/* --- Section headings --- */
'#bmc-page-wrap h2 {',
' font-size: 1.1em; font-weight: 600;',
' color: ' + TOKENS.black + ';',
' letter-spacing: 0.06em; text-transform: uppercase;',
' margin: 40px 0 16px;',
' padding-bottom: 8px;',
' border-bottom: 1px solid ' + TOKENS.border + ';',
'}',
'#bmc-page-wrap h3 {',
' font-size: 0.95em; font-weight: 600;',
' color: ' + TOKENS.textMid + ';',
' letter-spacing: 0.04em; text-transform: uppercase;',
' margin: 28px 0 12px;',
'}',

/* --- Generic body content prose --- */
'#bmc-page-wrap p {',
' font-size: 0.95em; line-height: 1.7;',
' color: ' + TOKENS.textMid + '; margin-bottom: 12px;',
'}',
'#bmc-page-wrap a {',
' color: ' + TOKENS.gold + '; text-decoration: none;',
' border-bottom: 1px solid transparent;',
' transition: border-color 0.15s;',
'}',
'#bmc-page-wrap a:hover { border-bottom-color: ' + TOKENS.gold + '; }',

/* --- Generic list styling --- */
'#bmc-page-wrap ul, #bmc-page-wrap ol {',
' padding-left: 1.4em; margin-bottom: 12px;',
'}',
'#bmc-page-wrap li {',
' font-size: 0.92em; line-height: 1.7;',
' color: ' + TOKENS.textMid + '; margin-bottom: 3px;',
'}',

/* --- Generic wiki tables → clean style --- */
'#bmc-page-wrap table.wikitable, #bmc-page-wrap table {',
' border-collapse: collapse; width: 100%;',
' font-size: 0.87em; margin-bottom: 24px;',
' background: ' + TOKENS.bgCard + ';',
' border-radius: 10px; overflow: hidden;',
' border: 1px solid ' + TOKENS.border + ';',
' box-shadow: 0 1px 4px rgba(0,0,0,0.05);',
'}',
'#bmc-page-wrap table th {',
' background: ' + TOKENS.darkGray + ';',
' color: #ddd; font-weight: 500;',
' padding: 10px 14px; text-align: left;',
' font-size: 0.82em; letter-spacing: 0.04em;',
' text-transform: uppercase;',
'}',
'#bmc-page-wrap table td {',
' padding: 9px 14px;',
' border-bottom: 1px solid ' + TOKENS.border + ';',
' color: ' + TOKENS.text + '; vertical-align: top;',
'}',
'#bmc-page-wrap table tr:last-child td { border-bottom: none; }',
'#bmc-page-wrap table tr:hover td { background: #faf8f5; }',

/* --- Card component --- */
'.bmc-card {',
' background: ' + TOKENS.bgCard + ';',
' border: 1px solid ' + TOKENS.border + ';',
' border-radius: 12px;',
' padding: 24px;',
' box-shadow: 0 1px 4px rgba(0,0,0,0.05);',
'}',
'.bmc-card-grid {',
' display: grid;',
' grid-template-columns: repeat(auto-fill, minmax(260px, 1fr));',
' gap: 16px; margin-bottom: 32px;',
'}',

/* --- Inline badge --- */
'.bmc-badge {',
' display: inline-block;',
' font-size: 0.7em; font-weight: 600;',
' letter-spacing: 0.06em; text-transform: uppercase;',
' padding: 2px 7px; border-radius: 4px;',
' background: ' + TOKENS.gold + '22;',
' color: ' + TOKENS.gold + '; margin-left: 6px;',
' vertical-align: middle;',
'}',

/* --- TOC hide (we build nav instead) --- */
'#toc, .toc { display: none !important; }',

/* --- Breadcrumb strip under nav --- */
'#bmc-breadcrumb {',
' background: #fff;',
' border-bottom: 1px solid ' + TOKENS.border + ';',
' padding: 10px 32px;',
' font-size: 0.78em;',
' color: ' + TOKENS.textLight + ';',
' display: flex; align-items: center; gap: 6px;',
'}',
'#bmc-breadcrumb a { color: ' + TOKENS.textMid + '; text-decoration: none; }',
'#bmc-breadcrumb a:hover { color: ' + TOKENS.gold + '; }',
'#bmc-breadcrumb .sep { color: #ccc; }',

/* --- Pricing-specific styles (reused from earlier) --- */
'#bmc-pricing-tier-toggle {',
' display: flex; gap: 4px;',
' background: ' + TOKENS.darkGray + ';',
' border-radius: 10px; padding: 4px;',
' margin-bottom: 24px; width: fit-content;',
'}',
'#bmc-pricing-tier-toggle button {',
' padding: 7px 18px; border: none;',
' border-radius: 7px; font-size: 0.8em;',
' font-weight: 600; cursor: pointer;',
' letter-spacing: 0.04em;',
' transition: all 0.15s;',
' font-family: ' + TOKENS.fontBody + ';',
' background: transparent; color: #777;',
'}',
'#bmc-pricing-tier-toggle button.active-core { background: #1a6b3c; color: #fff; }',
'#bmc-pricing-tier-toggle button.active-mit { background: #8b1a1a; color: #fff; }',
'#bmc-pricing-tier-toggle button.active-nonmit{ background: #1a3b8b; color: #fff; }',

'.bmc-price-section {',
' background: ' + TOKENS.bgCard + ';',
' border: 1px solid ' + TOKENS.border + ';',
' border-radius: 12px; overflow: hidden;',
' margin-bottom: 12px;',
' box-shadow: 0 1px 3px rgba(0,0,0,0.04);',
'}',
'.bmc-price-section-header {',
' background: #faf9f7;',
' border-bottom: 1px solid ' + TOKENS.border + ';',
' padding: 13px 20px;',
' font-size: 0.88em; font-weight: 600;',
' color: #333; cursor: pointer;',
' display: flex; justify-content: space-between; align-items: center;',
' user-select: none;',
'}',
'.bmc-price-section-header:hover { background: #f2f0ec; }',
'.bmc-price-section-header .chevron { color: #aaa; font-size: 0.8em; transition: transform 0.2s; }',
'.bmc-price-section-header.collapsed .chevron { transform: rotate(-90deg); }',
'.bmc-price-row {',
' display: flex; justify-content: space-between; align-items: flex-start;',
' padding: 11px 20px;',
' border-bottom: 1px solid #f5f2ee;',
' transition: background 0.1s; gap: 16px;',
'}',
'.bmc-price-row:last-child { border-bottom: none; }',
'.bmc-price-row:hover { background: #faf8f5; }',
'.bmc-price-row-name {',
' font-size: 0.87em; color: #222;',
'}',
'.bmc-price-row-unit {',
' font-size: 0.74em; color: #aaa;',
' font-family: ' + TOKENS.fontMono + '; margin-top: 2px;',
'}',
'.bmc-price-row-note {',
' font-size: 0.74em; color: #999;',
' font-style: italic; margin-top: 3px;',
'}',
'.bmc-price-amount {',
' font-size: 1em; font-weight: 600;',
' font-family: ' + TOKENS.fontMono + ';',
' white-space: nowrap; text-align: right;',
' min-width: 90px;',
'}',
'.bmc-price-amount.tier-core { color: #1a6b3c; }',
'.bmc-price-amount.tier-mit { color: #8b1a1a; }',
'.bmc-price-amount.tier-nonmit { color: #1a3b8b; }',
'.bmc-price-amount.tier-na { color: #ccc; font-style: italic; font-size: 0.82em; }',

/* search bar */
'#bmc-pricing-search-wrap {',
' position: relative; margin-bottom: 20px; width: 260px;',
'}',
'#bmc-pricing-search {',
' width: 100%; padding: 9px 14px 9px 36px;',
' border: 1.5px solid #ddd; border-radius: 8px;',
' font-size: 0.85em; font-family: ' + TOKENS.fontBody + ';',
' background: #fff; outline: none;',
'}',
'#bmc-pricing-search:focus { border-color: ' + TOKENS.gold + '; }',
'#bmc-pricing-search-icon {',
' position: absolute; left: 12px; top: 50%;',
' transform: translateY(-50%); color: #aaa; pointer-events: none;',
'}',

/* tier indicator pill */
'#bmc-tier-pill {',
' display: inline-flex; align-items: center; gap: 8px;',
' padding: 5px 12px; border-radius: 6px;',
' font-size: 0.78em; font-weight: 600;',
' letter-spacing: 0.04em; margin-bottom: 20px;',
'}',

/* homepage card grid */
'.bmc-home-grid {',
' display: grid;',
' grid-template-columns: repeat(auto-fill, minmax(280px, 1fr));',
' gap: 16px; margin-top: 24px;',
'}',
'.bmc-home-card {',
' background: ' + TOKENS.bgCard + ';',
' border: 1px solid ' + TOKENS.border + ';',
' border-radius: 14px; padding: 22px 24px;',
' box-shadow: 0 1px 4px rgba(0,0,0,0.05);',
' transition: box-shadow 0.2s, transform 0.2s;',
'}',
'.bmc-home-card:hover {',
' box-shadow: 0 4px 16px rgba(0,0,0,0.1);',
' transform: translateY(-2px);',
'}',
'.bmc-home-card .card-icon {',
' font-size: 1.6em; margin-bottom: 12px;',
'}',
'.bmc-home-card .card-title {',
' font-size: 0.95em; font-weight: 600;',
' color: ' + TOKENS.black + '; margin-bottom: 8px;',
'}',
'.bmc-home-card .card-links {',
' list-style: none; padding: 0; margin: 0;',
'}',
'.bmc-home-card .card-links li {',
' font-size: 0.84em; line-height: 1.8;',
' color: ' + TOKENS.textMid + ';',
'}',
'.bmc-home-card .card-links li a {',
' color: ' + TOKENS.textMid + '; text-decoration: none;',
' border-bottom: none;',
' transition: color 0.15s;',
'}',
'.bmc-home-card .card-links li a:hover { color: ' + TOKENS.gold + '; }',
'.bmc-home-card .card-links li::before {',
' content: "→ "; color: ' + TOKENS.gold + '; font-size: 0.85em;',
'}',

/* contact strip */
'#bmc-contact-strip {',
' background: ' + TOKENS.darkGray + ';',
' color: #ccc; border-radius: 12px;',
' padding: 24px 28px; margin-top: 32px;',
' display: flex; gap: 32px; flex-wrap: wrap; align-items: center;',
'}',
'#bmc-contact-strip .contact-item {',
' font-size: 0.87em; display: flex; gap: 8px; align-items: center;',
'}',
'#bmc-contact-strip a { color: ' + TOKENS.gold + '; text-decoration: none; }',
'#bmc-contact-strip .contact-label { color: #666; font-size: 0.8em; text-transform: uppercase; letter-spacing: 0.08em; }',

].join('\n');

/* ============================================================
3. NAV STRUCTURE
============================================================ */
var NAV_LINKS = [
{ label: 'Home', href: '/index.php/BioMicroCenter', match: 'BioMicroCenter$' },
{ label: 'Sequencing', href: '/index.php/BioMicroCenter:Sequencing', match: 'Sequencing' },
{ label: 'Library Prep', href: '/index.php/BioMicroCenter:Illumina_Library_Preparation', match: 'Library' },
{ label: 'Single Cell', href: '/index.php/BioMicroCenter:SingleCell', match: 'SingleCell|SpTx|Visium' },
{ label: 'Long Read', href: '/index.php/BioMicroCenter:Oxford_Nanopore_Technologies', match: 'Nanopore|PacBio' },
{ label: 'Computing', href: '/index.php/BioMicroCenter:Computing', match: 'Computing' },
{ label: 'QC', href: '/index.php/BioMicroCenter:QC', match: ':QC' },
{ label: 'Pricing', href: '/index.php/BioMicroCenter:Pricing', match: 'Pricing' },
{ label: 'People', href: '/index.php/BioMicroCenter:People', match: 'People' },
{ label: 'FAQ', href: '/index.php/BioMicroCenter:FAQ', match: 'FAQ' },
];

/* ============================================================
4. MAIN BMC OBJECT
============================================================ */
var BMC = {

page: mw.config.get( 'wgPageName' ) || '',

/* ---- 4a. INIT ---- */
init: function () {
this.injectCSS();
this.injectNav();
this.injectBreadcrumb();
this.wrapContent();

// Page-specific transforms
if ( /^BioMicroCenter$/.test( this.page ) ) {
this.transformHomepage();
} else if ( /Pricing/.test( this.page ) ) {
this.transformPricing();
} else {
this.transformGeneric();
}
},

/* ---- 4b. INJECT GLOBAL CSS ---- */
injectCSS: function () {
var style = document.createElement( 'style' );
style.id = 'bmc-theme-css';
style.textContent = GLOBAL_CSS;
document.head.appendChild( style );
},

/* ---- 4c. INJECT TOP NAV ---- */
injectNav: function () {
var page = this.page;
var logoImg = document.querySelector( '#p-logo img, .mw-wiki-logo' );
var logoSrc = logoImg ? logoImg.src : '';

var linksHtml = NAV_LINKS.map( function ( l ) {
var active = new RegExp( l.match ).test( page ) ? ' bmc-nav-active' : '';
return '<a href="' + l.href + '" class="' + active + '">' + l.label + '</a>';
} ).join( '' );

var nav = document.createElement( 'div' );
nav.id = 'bmc-topnav';
nav.innerHTML =
'<a href="/index.php/BioMicroCenter" class="bmc-nav-logo">' +
( logoSrc ? '<img src="' + logoSrc + '" alt="BMC">' : '' ) +
'BioMicro <span class="accent">Center</span>' +
'</a>' +
'<div id="bmc-nav-links">' + linksHtml + '</div>' +
'<div id="bmc-nav-right">' +
'<a href="/index.php/Special:Search" class="bmc-nav-search" title="Search">⌕</a>' +
'<a href="https://mit-ki.ilabsolutions.com/sc/3381/ki-genomics-core-mit-biomicro-center?tab=about"' +
' class="bmc-ilabs-btn" target="_blank">Submit via iLabs ↗</a>' +
'</div>';

// Insert before body content
var body = document.body;
body.insertBefore( nav, body.firstChild );
},

/* ---- 4d. BREADCRUMB ---- */
injectBreadcrumb: function () {
var page = this.page;
if ( /^BioMicroCenter$/.test( page ) ) return; // no breadcrumb on homepage

var parts = page.split( ':' );
var crumb = document.createElement( 'div' );
crumb.id = 'bmc-breadcrumb';
crumb.innerHTML =
'<a href="/index.php/BioMicroCenter">Home</a>' +
'<span class="sep">›</span>' +
'<span>' + ( parts[1] || parts[0] ).replace( /_/g, ' ' ) + '</span>';

var nav = document.getElementById( 'bmc-topnav' );
if ( nav ) nav.after( crumb );
},

/* ---- 4e. WRAP MAIN CONTENT ---- */
wrapContent: function () {
var content = document.getElementById( 'mw-content-text' )
|| document.getElementById( 'content' )
|| document.querySelector( '.mw-body-content' );
if ( !content ) return;

// Get the first heading
var h1 = document.querySelector( '#firstHeading, h1.firstHeading' );
var titleText = h1 ? h1.textContent.replace( /^BioMicroCenter:?/, '' ).trim() : '';

// Build page title block
var titleBlock = document.createElement( 'div' );
titleBlock.id = 'bmc-page-title';
if ( titleText && !/^BioMicroCenter$/.test( this.page ) ) {
titleBlock.innerHTML =
'<h1>' + titleText + '</h1>';
}
if ( h1 ) h1.style.display = 'none';

// Wrap in page container
var wrap = document.createElement( 'div' );
wrap.id = 'bmc-page-wrap';
content.parentNode.insertBefore( wrap, content );
wrap.appendChild( titleBlock );
wrap.appendChild( content );
},

/* ---- 4f. GENERIC PAGE TRANSFORM ---- */
transformGeneric: function () {
// Just let the global CSS handle it — tables, headings, prose all look better automatically.
// Remove the old banner image if present (it's usually a 500px wide header)
var banner = document.querySelector( '#mw-content-text img[src*="BMC_Header"]' );
if ( banner ) {
var bannerParent = banner.closest( 'p, div' );
if ( bannerParent ) bannerParent.style.display = 'none';
}
},

/* ---- 4g. HOMEPAGE TRANSFORM ---- */
transformHomepage: function () {
var wrap = document.getElementById( 'bmc-page-wrap' );
if ( !wrap ) return;

// Hide the old content and replace with hero + cards
var oldContent = document.getElementById( 'mw-content-text' );

// Extract links from existing wiki tables to preserve them
var allLinks = {};
if ( oldContent ) {
oldContent.querySelectorAll( 'a' ).forEach( function ( a ) {
allLinks[a.textContent.trim()] = a.href;
} );
oldContent.style.display = 'none';
}

// Hero
var hero = document.createElement( 'div' );
hero.style.cssText = [
'background: ' + TOKENS.black + ';',
'border-radius: 16px; padding: 48px 40px;',
'margin-bottom: 32px; position: relative; overflow: hidden;',
'color: #fff;',
].join( '' );
hero.innerHTML = [
'<div style="position:relative;z-index:1">',
'<div style="font-size:0.72em;letter-spacing:0.16em;color:#888;text-transform:uppercase;',
'margin-bottom:12px;font-family:' + TOKENS.fontMono + '">',
'Koch Institute · MIT Department of Biology · Biological Engineering',
'</div>',
'<h1 style="font-size:2.4em;font-weight:600;letter-spacing:-0.03em;',
'line-height:1;margin:0 0 16px;color:#fff">',
'MIT BioMicro<br><span style="color:' + TOKENS.gold + '">Center</span>',
'</h1>',
'<p style="max-width:560px;font-size:0.95em;line-height:1.7;color:#aaa;margin:0 0 24px">',
'An integrated genomics core facility providing expertise and equipment for ',
'systems biology — from sample prep through sequencing, single-cell, and bioinformatics.',
'</p>',
'<div style="display:flex;gap:12px;flex-wrap:wrap">',
'<a href="https://mit-ki.ilabsolutions.com/sc/3381/ki-genomics-core-mit-biomicro-center?tab=about"',
' target="_blank"',
' style="background:' + TOKENS.gold + ';color:' + TOKENS.black + ';',
'font-weight:600;font-size:0.85em;padding:10px 20px;border-radius:8px;',
'text-decoration:none;letter-spacing:0.02em">',
'Submit Samples via iLabs ↗',
'</a>',
'<a href="/index.php/BioMicroCenter:Pricing"',
' style="background:#222;color:#ccc;',
'font-weight:500;font-size:0.85em;padding:10px 20px;border-radius:8px;',
'text-decoration:none">',
'View Pricing',
'</a>',
'</div>',
'</div>',
// subtle grid pattern overlay
'<div style="position:absolute;inset:0;opacity:0.04;pointer-events:none;',
'background-image:repeating-linear-gradient(0deg,#fff 0,#fff 1px,transparent 1px,transparent 40px),',
'repeating-linear-gradient(90deg,#fff 0,#fff 1px,transparent 1px,transparent 40px)">',
'</div>',
].join( '' );
wrap.appendChild( hero );

// Service cards
var CARDS = [
{
icon: '🧬',
title: 'Sequencing',
links: [
{ label: 'NovaSeq X / NovaSeq 6000', href: '/index.php/BioMicroCenter:Illumina_Sequencing' },
{ label: 'Element AVITI24', href: '/index.php/BioMicroCenter:Element_Sequencing' },
{ label: 'Singular G4 / MiSeq', href: '/index.php/BioMicroCenter:Illumina_Sequencing' },
{ label: 'ONT PromethION', href: '/index.php/BioMicroCenter:Oxford_Nanopore_Technologies' },
{ label: 'PacBio Revio †', href: '/index.php/BioMicroCenter:PacBio' },
],
},
{
icon: '📚',
title: 'Library Preparation',
links: [
{ label: 'Short Read — DNA', href: '/index.php/BioMicroCenter:DNA_LIB' },
{ label: 'Short Read — RNA', href: '/index.php/BioMicroCenter:RNA_LIB' },
{ label: 'High Throughput DNA', href: '/index.php/BioMicroCenter:DNA_HTL' },
{ label: 'High Throughput RNA', href: '/index.php/BioMicroCenter:RNA_HTL' },
{ label: 'Nanopore Library Prep', href: '/index.php/BioMicroCenter:NanoPore_Library_Prep' },
{ label: 'PacBio Library Prep', href: '/index.php/BioMicroCenter:PacBio_Library_Preparation' },
],
},
{
icon: '⬡',
title: 'Single Cell & Spatial',
links: [
{ label: '10X Chromium (5′/3′ RNA, ATAC)', href: '/index.php/BioMicroCenter:SingleCell' },
{ label: '10X Visium (Standard + HD)', href: '/index.php/BioMicroCenter:SpTx' },
{ label: 'AVITI24 in situ', href: '/index.php/BioMicroCenter:Element_Sequencing' },
],
},
{
icon: '🔬',
title: 'Sample Services & QC',
links: [
{ label: 'Fragment Analyzer / FemtoPulse', href: '/index.php/BioMicroCenter:QC' },
{ label: 'BioAnalyzer', href: '/index.php/BioMicroCenter:QC' },
{ label: 'Chemagic360 DNA/RNA Extraction', href: '/index.php/BioMicroCenter:Tecan_Freedom_Evo' },
{ label: 'Covaris Sonicator', href: '/index.php/BioMicroCenter:Covaris' },
{ label: 'RT-PCR (Roche LC480)', href: '/index.php/BioMicroCenter:RTPCR' },
],
},
{
icon: '🤖',
title: 'Automation',
links: [
{ label: 'Tecan EVO 150 Liquid Handler', href: '/index.php/BioMicroCenter:Tecan_Freedom_Evo' },
{ label: 'SPT Mosquito HV', href: '/index.php/BioMicroCenter:Tecan_Freedom_Evo' },
{ label: 'Pippin Prep Electrophoresis', href: '/index.php/BioMicroCenter:PippinPrep' },
{ label: 'Oligo Synthesis', href: '/index.php/BioMicroCenter:Oligo_Synthesis' },
],
},
{
icon: '💻',
title: 'Bioinformatics & Computing',
links: [
{ label: 'Bioinformatics Consulting (IGB)', href: 'https://igb.mit.edu/' },
{ label: 'Luria Computing Cluster', href: 'https://igb.mit.edu/computing-resources/luria-cluster' },
{ label: 'Active Data Storage', href: 'https://igb.mit.edu/computing-resources/active-data-storage' },
{ label: 'Data Transfer (Globus)', href: 'https://igb.mit.edu/data-management/globus' },
{ label: 'Training Sessions', href: 'https://igb.mit.edu/mini-courses' },
],
},
{
icon: '📋',
title: 'Get Started',
links: [
{ label: 'Pricing', href: '/index.php/BioMicroCenter:Pricing' },
{ label: 'New User Signup', href: '/index.php/BioMicroCenter:Forms#NEW_USERS' },
{ label: 'External Submission Forms', href: '/index.php/BioMicroCenter:Forms' },
{ label: 'FAQs', href: '/index.php/BioMicroCenter:FAQ' },
{ label: 'Staff Directory', href: '/index.php/BioMicroCenter:People' },
{ label: 'News & Updates', href: '/index.php/BioMicroCenter:News' },
],
},
{
icon: '📅',
title: 'News & Resources',
links: [
{ label: 'News & General Information', href: '/index.php/BioMicroCenter:News' },
{ label: 'Technology Seminar Series', href: '/index.php/BioMicroCenter:Technology_Seminar_Series' },
{ label: 'Biostuff Mailing List', href: 'http://mailman.mit.edu:/mailman/listinfo/biostuff' },
{ label: 'FAIR Data Management', href: 'https://koch-institute-mit.gitbook.io/mit-data-management-analysis-core/' },
],
},
];

var grid = document.createElement( 'div' );
grid.className = 'bmc-home-grid';
CARDS.forEach( function ( card ) {
var li = card.links.map( function ( lnk ) {
return '<li><a href="' + lnk.href + '">' + lnk.label + '</a></li>';
} ).join( '' );
var el = document.createElement( 'div' );
el.className = 'bmc-home-card';
el.innerHTML =
'<div class="card-icon">' + card.icon + '</div>' +
'<div class="card-title">' + card.title + '</div>' +
'<ul class="card-links">' + li + '</ul>';
grid.appendChild( el );
} );
wrap.appendChild( grid );

// Contact strip
var contact = document.createElement( 'div' );
contact.id = 'bmc-contact-strip';
contact.innerHTML = [
'<div><div class="contact-label">Location</div>',
'<div class="contact-item">Room 68-322, MIT</div></div>',
'<div><div class="contact-label">Email</div>',
'<div class="contact-item"><a href="mailto:biomicro@mit.edu">biomicro@mit.edu</a></div></div>',
'<div><div class="contact-label">Phone</div>',
'<div class="contact-item">617-715-4533</div></div>',
'<div style="margin-left:auto">',
'<a href="https://mit-ki.ilabsolutions.com/sc/3381/ki-genomics-core-mit-biomicro-center?tab=about"',
' target="_blank"',
' style="background:' + TOKENS.gold + ';color:#000;font-weight:600;',
'font-size:0.82em;padding:9px 18px;border-radius:7px;text-decoration:none">',
'iLabs — Internal Submission ↗',
'</a></div>',
].join( '' );
wrap.appendChild( contact );
},

/* ---- 4h. PRICING PAGE TRANSFORM ---- */
transformPricing: function () {
var self = this;
var oldContent = document.getElementById( 'mw-content-text' );
if ( !oldContent ) return;

// Current tier state
var tier = 'mit';
var tierColors = { core: '#1a6b3c', mit: '#8b1a1a', nonmit: '#1a3b8b' };
var tierBadges = { core: 'CORE', mit: 'MIT', nonmit: 'EXT' };
var tierLabels = { core: 'Core Lab', mit: 'MIT', nonmit: 'Non-MIT' };

// Parse all wiki tables from the existing rendered HTML
// Each table = one pricing section
var sections = self.parsePricingTables( oldContent );

// Hide original content
oldContent.style.display = 'none';

var wrap = document.getElementById( 'bmc-page-wrap' );
if ( !wrap ) return;

// Controls row
var controls = document.createElement( 'div' );
controls.style.cssText = 'display:flex;align-items:center;justify-content:space-between;flex-wrap:wrap;gap:16px;margin-bottom:8px;';

// Tier toggle
var toggle = document.createElement( 'div' );
toggle.id = 'bmc-pricing-tier-toggle';
[ 'core', 'mit', 'nonmit' ].forEach( function ( t ) {
var btn = document.createElement( 'button' );
btn.textContent = tierLabels[t];
btn.dataset.tier = t;
btn.className = t === tier ? 'active-' + t : '';
btn.addEventListener( 'click', function () {
tier = t;
toggle.querySelectorAll( 'button' ).forEach( function ( b ) { b.className = ''; } );
btn.className = 'active-' + t;
pill.style.background = tierColors[t] + '22';
pill.style.color = tierColors[t];
pill.style.borderColor = tierColors[t] + '44';
pillBadge.style.background = tierColors[t];
pillBadge.textContent = tierBadges[t];
pillLabel.textContent = 'Showing ' + tierLabels[t] + ' pricing';
self.updatePricingTier( t );
} );
toggle.appendChild( btn );
} );

// Search
var searchWrap = document.createElement( 'div' );
searchWrap.id = 'bmc-pricing-search-wrap';
searchWrap.innerHTML =
'<span id="bmc-pricing-search-icon">⌕</span>' +
'<input id="bmc-pricing-search" type="text" placeholder="Search services…">';
searchWrap.querySelector( 'input' ).addEventListener( 'input', function () {
self.filterPricingRows( this.value.toLowerCase() );
} );

controls.appendChild( toggle );
controls.appendChild( searchWrap );
wrap.appendChild( controls );

// Tier pill
var pill = document.createElement( 'div' );
pill.id = 'bmc-tier-pill';
pill.style.cssText = 'background:' + tierColors[tier] + '22;color:' + tierColors[tier] + ';border:1.5px solid ' + tierColors[tier] + '44;border-radius:6px;';
var pillBadge = document.createElement( 'span' );
pillBadge.style.cssText = 'background:' + tierColors[tier] + ';color:#fff;border-radius:3px;padding:1px 6px;font-size:0.82em;letter-spacing:0.08em;';
pillBadge.textContent = tierBadges[tier];
var pillLabel = document.createElement( 'span' );
pillLabel.textContent = 'Showing ' + tierLabels[tier] + ' pricing';
pill.appendChild( pillBadge );
pill.appendChild( pillLabel );
wrap.appendChild( pill );

// Render sections
var container = document.createElement( 'div' );
container.id = 'bmc-pricing-container';
wrap.appendChild( container );

sections.forEach( function ( section ) {
var card = document.createElement( 'div' );
card.className = 'bmc-price-section';

var header = document.createElement( 'div' );
header.className = 'bmc-price-section-header';
header.innerHTML = section.title + '<span class="chevron">▼</span>';
header.addEventListener( 'click', function () {
var body = card.querySelector( '.bmc-price-body' );
var collapsed = header.classList.toggle( 'collapsed' );
body.style.display = collapsed ? 'none' : '';
} );

var body = document.createElement( 'div' );
body.className = 'bmc-price-body';

section.rows.forEach( function ( row ) {
var rowEl = document.createElement( 'div' );
rowEl.className = 'bmc-price-row';
rowEl.dataset.rowName = row.name.toLowerCase();

var amt = row.prices[tier];
var amtClass = ( amt === null || amt === undefined || amt === '' )
? 'tier-na' : 'tier-' + tier;
var amtText = ( amt === null || amt === undefined || amt === '' )
? '—' : amt;

rowEl.innerHTML =
'<div>' +
'<div class="bmc-price-row-name">' + row.name + '</div>' +
( row.unit ? '<div class="bmc-price-row-unit">' + row.unit + '</div>' : '' ) +
( row.notes ? '<div class="bmc-price-row-note">' + row.notes + '</div>' : '' ) +
'</div>' +
'<div class="bmc-price-amount ' + amtClass + '" data-prices=\'' + JSON.stringify( row.prices ) + '\'>' +
amtText +
'</div>';

body.appendChild( rowEl );
} );

card.appendChild( header );
card.appendChild( body );
container.appendChild( card );
} );

// Footer note
var note = document.createElement( 'div' );
note.style.cssText = 'margin-top:24px;padding:14px 18px;background:#fff8e8;border-radius:8px;border:1px solid #e8d8a0;font-size:0.78em;color:#7a6a3a;line-height:1.6;';
note.innerHTML = '✦ = Minimal inventory maintained  ·  †† = Through collaboration with nearby academic shared resources  ·  Pricing as of January 2026. Questions? <a href="mailto:biomicro@mit.edu" style="color:#8b6914">biomicro@mit.edu</a>';
wrap.appendChild( note );
},

/* ---- 4i. PARSE PRICING TABLES FROM WIKI HTML ---- */
parsePricingTables: function ( container ) {
var sections = [];
// Walk h2/h3 + table pairs
var nodes = container.querySelectorAll( 'h2, h3, table' );
var currentTitle = 'Services';
var currentRows = [];

var flush = function () {
if ( currentRows.length > 0 ) {
sections.push( { title: currentTitle, rows: currentRows } );
currentRows = [];
}
};

nodes.forEach( function ( node ) {
if ( node.tagName === 'H2' || node.tagName === 'H3' ) {
flush();
// Clean up heading text (remove [edit] spans)
var clone = node.cloneNode( true );
clone.querySelectorAll( '.mw-editsection' ).forEach( function ( e ) { e.remove(); } );
currentTitle = clone.textContent.trim();
} else if ( node.tagName === 'TABLE' ) {
// Find header row to determine column order
var headers = [];
var headerRow = node.querySelector( 'tr' );
if ( headerRow ) {
headerRow.querySelectorAll( 'th, td' ).forEach( function ( cell ) {
headers.push( cell.textContent.trim().toLowerCase() );
} );
}

// Find price column indices
var coreIdx = -1, mitIdx = -1, nonmitIdx = -1;
var nameIdx = 0;
var unitIdx = -1, notesIdx = -1;
headers.forEach( function ( h, i ) {
if ( /core/.test( h ) ) coreIdx = i;
if ( /^mit$/.test( h ) ) mitIdx = i;
if ( /non.?mit/.test( h ) ) nonmitIdx = i;
if ( /unit/.test( h ) ) unitIdx = i;
if ( /note/.test( h ) ) notesIdx = i;
} );

// Parse data rows
var rows = node.querySelectorAll( 'tr' );
rows.forEach( function ( row, ri ) {
if ( ri === 0 ) return; // skip header
var cells = row.querySelectorAll( 'td, th' );
if ( cells.length < 2 ) return;

var getText = function ( idx ) {
if ( idx < 0 || idx >= cells.length ) return '';
return cells[idx].textContent.trim();
};

var name = getText( nameIdx );
if ( !name ) return;

var formatPrice = function ( idx ) {
var raw = getText( idx );
if ( !raw || raw === '' || /pricing in/i.test( raw ) ) return null;
// Already has $ sign in wiki? Return as-is, else prefix
return raw;
};

currentRows.push( {
name: name,
unit: unitIdx >= 0 ? getText( unitIdx ) : '',
notes: notesIdx >= 0 ? getText( notesIdx ) : '',
prices: {
core: formatPrice( coreIdx ),
mit: formatPrice( mitIdx ),
nonmit: formatPrice( nonmitIdx ),
}
} );
} );
}
} );
flush();
return sections;
},

/* ---- 4j. UPDATE PRICING TIER (live swap) ---- */
updatePricingTier: function ( tier ) {
document.querySelectorAll( '.bmc-price-amount' ).forEach( function ( el ) {
try {
var prices = JSON.parse( el.dataset.prices );
var amt = prices[tier];
var isNA = ( amt === null || amt === undefined || amt === '' );
el.textContent = isNA ? '—' : amt;
el.className = 'bmc-price-amount ' + ( isNA ? 'tier-na' : 'tier-' + tier );
} catch ( e ) {}
} );
},

/* ---- 4k. FILTER PRICING ROWS ---- */
filterPricingRows: function ( query ) {
document.querySelectorAll( '.bmc-price-row' ).forEach( function ( row ) {
var name = row.dataset.rowName || '';
row.style.display = name.includes( query ) ? '' : 'none';
} );
// Show/hide empty sections
document.querySelectorAll( '.bmc-price-section' ).forEach( function ( section ) {
var visible = section.querySelectorAll( '.bmc-price-row:not([style*="none"])' );
section.style.display = visible.length ? '' : 'none';
} );
},

}; // end BMC

/* ============================================================
5. KICK OFF
============================================================ */
if ( document.readyState === 'loading' ) {
document.addEventListener( 'DOMContentLoaded', function () { BMC.init(); } );
} else {
BMC.init();
}

}() );

2025-11-14T16:43:55Z

Gibcus:

== Singular Sequencing ==
The Center currently hosts a G4 platform by [https://singulargenomics.com/| Singular Genomics]. Singular’s G4 platform is a short-read mid-throughput sequencing platform delivering adequate sequencing data through its proprietary sequencing-by-synthesis chemistry at a significantly competitive price point.
{|
| valign="top" |
{| class="wikitable" border=1
!width=150| Service
!width=300| Singular Sequencing
|-
|INPUT || Singular libraries
|-
|MIN VOLUME || 12 uL
|-
|MIN CONCENTRATION || 4 nM
|-
|INCLUDED SERVICES
|
* Quality Control:Fragment Analyzer and qPCR
* Singular Sequencing
* Demultiplexing
|-
|ADDITIONAL SERVICES ||
* Quality Control
* Singular library preparation
|-
|DATA FORMATS
|
*FASTQ (stored 1 year)
|-
|QUALITY CONTROL
|
* [https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ FASTQC]
* Basic run metrics (alignment rate, complexity)
* Basic RNAseq metrics (where applicable)
* Basic paired end metrics (where applicable)
* Contamination checks
|-
|PRICING || [[BioMicroCenter:Pricing#SINGULAR_G4|LINK]]
|-
|SUBMISSION
|
* MIT - [https://mit.ilabsolutions.com/service_item/new/3381?spt_id=3863 ilabs]
|-
|}
| valign="top" |

=== ANCHORS ===
Singular requires S1/S2 anchors in place of Illumina P5/P7 anchors. These can be replaced 1:1 in most oligo designs:
*s1:ACAAAGGCAGCCACGCACTCCTTCCCTGT
*s2:CTCCAGCGAGATGACCCTCACCAACCACT

=== INDEXING ===
Singular indexes are read from the Anchor sequences in all cases and custom primers for indexes are not allowed. <BR>
Indexes are read from the S1 primer first (index1) followed by S2 (index2) <BR>
Index reads are the SAME SEQUENCE as ordered in most classical library preps. <BR>
Indexes are REQUIRED and should be 8 nucleotides in all lane by lane sequencing.
*Min custom primer submission: 20 uL at 100 uM

===LANE BY LANE===
*Must be 50 or 150 paired-end dual indexed
*Pool must be compatible with TruSeq, Nextera, TruSeq, smRNA and Solexa sequencing primers

=== MINIMUM READS ===
*the BMC has performed quality control.
* No custom primers.
*submitted libraries are at least 2 nM.

All other requests, including use of custom sequencing primers require a full flowcell. Illumina libraries which have been converted in the Center will also require a full flowcell.

|}

{|
|
== The G4 Platform ==
{| class="wikitable" border=1
!width=100| SPEC
!width=250| G4
|-
|'''SEQUENCER'''||[[Image:2023_Singular_G4.jpg|center|200px]]
|-
| '''READS/LANE'''<BR> Low number is minimum per lane for standard libraries||
* F3 per Lane: 50-100 M
|-
|'''RUN TIME'''||
* 50 PE 11 hours
* 150 PE 24 hours
|-
|'''KITS AVAILABLE'''||
* 100nt
* 300nt
|-
|'''KEY NOTES'''||
* 4-color chemistry
* Patterned flow cell
* 4-lanes per flow cell
* 4-flow cells per run
* Anchor replacement or anchor expansion of Illumina libraries
|-
|'''THANKS TO'''||
* Singular Genomics
|}
| valign='top' |
{|
! INDEX HOPPING
! ACCURACY
|-
|
[[IMAGE:IndexhopF3.jpeg|left|250px|Index hopping for a standard set of Singular libraries]]
|
[[IMAGE:PPPPF3.jpeg|right|200px|Percent Perfect Plot for Singular libraries 150PE]]
|-
| Index hopping on Singular runs is on par with GAIIx and HiSeq. High levels of index hopping as observed on Illumina X-AMP chemistry is not observed.
| Percent perfect plot for phiX on current Singular chemistry ([https://pmc.ncbi.nlm.nih.gov/articles/pmid/27672352/ Manley et al., 2016])
|}
|}

BioMicroCenter:Covaris

2025-11-14T16:05:19Z

Gibcus: /* E220 Evolution */

{{BioMicroCenter}}

= SONICATORS =
{|
|-style=vertical-align:top
|style=width:49%|
== E220 Evolution ==
[[Image:E220.jpg‎|thumb|right|250px| Covaris E220 Evo]]

The [https://www.covaris.com/e220evolution-focused-ultrasonicator-500429/ Covaris E220 evolution sonicator] is a multitube system that processes single samples at a time. The E220 evolution is capable of processing a wide range of sample types and volumes and may be programed to process from 1 to 96 samples in a single batch. The E220 is most appropriate <5ug clean DNA in 130ul (microTUBE-130) or 20-120 mg tissue mass in 1.0 ml (milliTUBE-1). Using adaptive focused acoustic energy, the E220 utilizing a spherical acoustic transducer, and delivers controlled energy precisely and accurately to sample volumes from 25 μl to 10 ml. The main applications are shearing of DNA, RNA, and chromatin but it can also perform tissue homogenization for cell lysis and drug delivery and formulation.
<BR><BR>
PROTOCOLS FOR [https://www.covaris.com/protocols?filter_tag=DNA%20Shearing%20Protocols/ DNA]
PROTOCOLS FOR [https://www.covaris.com/protocols?filter_tag=Chromatin%20Shearing%20Protocols/ Chromatin, FFPE] e
MANUAL: [https://www.covaris.com/e220evolution-focused-ultrasonicator-500429/ E220 evolution].
<br>

[[BioMicroCenter:Covaris_Maintenance| E220 Maintenance Instructions]]
|style=width:2%|

|style=width:49%|

== R230 ==
[[IMAGE:R230pic.jpeg|right|250px| Covaris R230]]
<br><br>
The Covaris R230 is a high throughput sonicator fitted for 96 AFA-TUBE® TPX Plates. Both RNA and DNA have been sheared with similar programs to the ones found on the E220 Evolution at maximum input 5 ug 20-50 uL per well in the sonication by column mode. With this column sonication mode, an entire 96 well plate can be sonicated 10x faster in the R230 versus the E220. <BR><BR>

The Covaris R230 is a critical component in High-throughput libraries produced using ribosomal depletion methods.<BR><BR>

The Covaris R230 was funded by an NIH grant and R24OD035444 should be included in any publications using the instrument.
|}